TANOX INC
S-1/A, 2000-04-06
MEDICAL LABORATORIES
Previous: RESIDENTIAL ASSET MORTGAGE PRODUCTS INC, 8-K, 2000-04-06
Next: TANOX INC, 8-A12G, 2000-04-06



     AS FILED WITH THE SECURITIES AND EXCHANGE COMMISSION ON APRIL 6, 2000
                                                      REGISTRATION NO. 333-96025

================================================================================
                       SECURITIES AND EXCHANGE COMMISSION
                             Washington, D.C. 20549

                      ------------------------------------

                                AMENDMENT NO. 4
                                       TO

                                    FORM S-1

                             REGISTRATION STATEMENT
                                     UNDER
                           THE SECURITIES ACT OF 1933

                      ------------------------------------
                                  TANOX, INC.
             (Exact name of registrant as specified in its charter)

<TABLE>
<S>                                    <C>                                     <C>
              DELAWARE                                  2836                                 76-0196733
   (State or Other Jurisdiction of          (Primary Standard Industrial                  (I.R.S. Employer
   Incorporation or Organization)           Classification Code Number)                 Identification No.)
</TABLE>
                      ------------------------------------

                          10301 STELLA LINK, SUITE 110
                           HOUSTON, TEXAS 77025-5497
                                 (713) 664-2288
              (Address, including zip code, and telephone number,
       including area code, of registrant's principal executive offices)

                      ------------------------------------

                             NANCY T. CHANG, PH.D.
                     PRESIDENT AND CHIEF EXECUTIVE OFFICER
                                  TANOX, INC.
                          10301 STELLA LINK, SUITE 110
                           HOUSTON, TEXAS 77025-5497
                                 (713) 664-2288
           (Name, address, including zip code, and telephone number,
            including area code, of registrant's agent for service)

                      ------------------------------------

                                   COPIES TO:

   WILBURN O. MCDONALD, JR., ESQ.                   RODD M. SCHREIBER, ESQ.
       CHAMBERLAIN, HRDLICKA,                    SKADDEN, ARPS, SLATE, MEAGHER
      WHITE, WILLIAMS & MARTIN                         & FLOM (ILLINOIS)
    1200 SMITH STREET, SUITE 1400                    333 WEST WACKER DRIVE
      HOUSTON, TEXAS 77002-4310                     CHICAGO, ILLINOIS 60606

                      ------------------------------------

     APPROXIMATE DATE OF COMMENCEMENT OF PROPOSED SALE TO THE PUBLIC:  As soon
as practicable after this Registration Statement becomes effective.

     If any of the securities being registered on this Form are to be offered on
a delayed or continuous basis pursuant to Rule 415 under the Securities Act,
check the following box. [ ]

     If this Form is filed to register additional securities for an offering
pursuant to Rule 462(b) under the Securities Act, check the following box and
list the Securities Act registration statement number of the earlier effective
registration statement for the same offering. [ ]

     If this Form is a post-effective amendment filed pursuant to Rule 462(c)
under the Securities Act, check the following box and list the Securities Act
registration statement number of the earlier effective registration statement
for the same offering. [ ]

     If this Form is a post-effective amendment filed pursuant to Rule 462(d)
under the Securities Act, check the following box and list the Securities Act
registration statement number of the earlier effective registration statement
for the same offering. [ ]

     If delivery of the prospectus is expected to be made pursuant to Rule 434,
please check the following box. [ ]

                      ------------------------------------

                        CALCULATION OF REGISTRATION FEE
================================================================================
                                               PROPOSED
        TITLE OF EACH CLASS OF                  MAXIMUM             AMOUNT OF
           SECURITIES TO BE                    AGGREGATE          REGISTRATION
            REGISTERED                      OFFERING PRICE(1)        FEE(2)
- --------------------------------------------------------------------------------
Common Stock, $.01 par value per share.....   $241,500,000           $63,756
================================================================================

(1)  Estimated solely for the purpose of calculating the amount of the
     Registration Fee in accordance with Rule 457(o) of the Securities Act of
     1933, as amended.

(2)  The company has previously paid $33,264 of the registration fee.

     THE REGISTRANT HEREBY AMENDS THIS REGISTRATION STATEMENT ON SUCH DATE OR
DATES AS MAY BE NECESSARY TO DELAY ITS EFFECTIVE DATE UNTIL THE REGISTRANT SHALL
FILE A FURTHER AMENDMENT WHICH SPECIFICALLY STATES THAT THIS REGISTRATION
STATEMENT SHALL THEREAFTER BECOME EFFECTIVE IN ACCORDANCE WITH SECTION 8(A) OF
THE SECURITIES ACT OF 1933 OR UNTIL THE REGISTRATION STATEMENT SHALL BECOME
EFFECTIVE ON SUCH DATE AS THE COMMISSION, ACTING PURSUANT TO SAID SECTION 8(A),
MAY DETERMINE.
================================================================================
<PAGE>

                   SUBJECT TO COMPLETION, DATED APRIL 6, 2000

THE INFORMATION CONTAINED IN THIS PROSPECTUS IS NOT COMPLETE AND MAY BE CHANGED.
THESE SECURITIES MAY NOT BE SOLD UNTIL THE REGISTRATION STATEMENT FILED WITH THE
SECURITIES AND EXCHANGE COMMISSION IS EFFECTIVE. THIS PROSPECTUS IS NOT AN OFFER
TO SELL THESE SECURITIES AND IT IS NOT SOLICITING AN OFFER TO BUY THESE
SECURITIES IN ANY STATE WHERE THE OFFER OR SALE IS NOT PERMITTED.

                                7,000,000 SHARES

                                  TANOX, INC.

                                  COMMON STOCK
                                  $  PER SHARE

- --------------------------------------------------------------------------------
This is an initial public offering of common stock of Tanox, Inc.

Tanox expects that the price to the public in the offering will be between
$27.00 and $30.00 per share. The market price of the shares after the offering
may be higher or lower than the offering price.

We have applied to include the common stock on the Nasdaq National Market under
the symbol "TNOX."

INVESTING IN THE COMMON STOCK INVOLVES RISKS. SEE "RISK FACTORS" BEGINNING ON
PAGE 8.

                                        PER SHARE       TOTAL
                                        ----------    ----------
Price to the public..................   $             $
Underwriting discount................
Proceeds to Tanox....................

Tanox has granted an over-allotment option to the underwriters. Under this
option, the underwriters may elect to purchase a maximum of 1,050,000 additional
shares from Tanox within 30 days following the date of this prospectus to cover
over-allotments.
- --------------------------------------------------------------------------------
NEITHER THE SECURITIES AND EXCHANGE COMMISSION NOR ANY STATE SECURITIES
COMMISSION HAS APPROVED OR DISAPPROVED OF THESE SECURITIES OR DETERMINED IF THIS
PROSPECTUS IS TRUTHFUL OR COMPLETE. ANY REPRESENTATION TO THE CONTRARY IS A
CRIMINAL OFFENSE.

                  CIBC WORLD MARKETS
                             ROBERTSON STEPHENS
                                      WARBURG DILLON READ LLC
                                              ADAMS, HARKNESS & HILL, INC.
                                                                  KBC SECURITIES

              The date of this prospectus is        , 2000.
<PAGE>
                 (This page has been intentionally left blank)
<PAGE>
                               TABLE OF CONTENTS

                                                                            PAGE
                                                                            ----
Prospectus Summary ........................................................    4
Risk Factors ..............................................................    8
Forward-Looking Statements ................................................   19
Use of Proceeds ...........................................................   20
Dividend Policy ...........................................................   20
Capitalization ............................................................   21
Dilution ..................................................................   22
Selected Consolidated Financial Data ......................................   23
Management's Discussion and Analysis of Financial Condition
  and Results of Operations ...............................................   24
Business ..................................................................   29
Management ................................................................   47
Principal Stockholders ....................................................   56
Certain Transactions ......................................................   58
Description of Capital Stock ..............................................   59
Shares Eligible for Future Sale ...........................................   62
Underwriting ..............................................................   64
Legal Matters .............................................................   66
Experts ...................................................................   66
Where You Can Find More Information .......................................   66
Index to Consolidated Financial
  Statements ..............................................................  F-1

                                       3
<PAGE>
                               PROSPECTUS SUMMARY

THIS SUMMARY HIGHLIGHTS INFORMATION CONTAINED IN OTHER PARTS OF THIS PROSPECTUS.
BECAUSE IT IS A SUMMARY, IT DOES NOT CONTAIN ALL OF THE INFORMATION THAT YOU
SHOULD CONSIDER BEFORE INVESTING IN THE SHARES. YOU SHOULD READ THE ENTIRE
PROSPECTUS CAREFULLY.

                                  THE COMPANY

                                    OVERVIEW

Tanox identifies and develops therapeutic monoclonal antibodies to address
significant unmet medical needs in the areas of immunology, infectious diseases
and cancer. Monoclonal antibodies are genetically engineered antibodies that
target a specific foreign substance, or antigen. E25, our most advanced product
in development, is an anti-immunoglobulin E, or anti-IgE, antibody. We are
developing E25 in collaboration with Novartis Pharma AG and Genentech, Inc. E25
has successfully completed Phase III clinical trials in both allergic asthma and
seasonal allergic rhinitis (hay fever). Based on the results of these trials,
our collaboration partners intend to file for marketing approval in the United
States and Europe in mid-2000. In addition, we are developing a number of
monoclonal antibodies to treat other allergic diseases or conditions, such as
severe allergic reactions to peanuts, autoimmune diseases, HIV and to restore
the suppressed immune systems of chemotherapy patients.

                        MONOCLONAL ANTIBODY THERAPEUTICS

Monoclonal antibodies represent an exciting area of novel therapeutic
development. Because of advances in antibody technologies, scientists are now
able to develop antibody products that can be administered to patients on a
chronic basis with reduced concern for adverse responses by the human immune
system. Companies can also manufacture these antibody products more cost-
effectively. As a result, a large number of monoclonal antibodies are now in
clinical and preclinical development. According to an industry survey, 74 out of
350, or 21% of all, biotechnology medicines in clinical trials in 1998 were
antibodies. The FDA has approved eight therapeutic antibodies, six of them in
the last three years. In 1999, total sales of these products exceeded $1.3
billion.

                          OUR PRODUCTS IN DEVELOPMENT

E25.  In 1987, we discovered a novel approach for treating allergies and asthma
by using monoclonal antibodies to inhibit IgE. E25, a product based on this
discovery, is a humanized (human-like) anti-IgE monoclonal antibody in
development for allergic asthma and allergic rhinitis. We estimate that, in the
United States, allergic asthma afflicts approximately 11 million people, and
allergic rhinitis afflicts approximately 40 million people, of whom
approximately 32 million are seasonal sufferers. A pivotal Phase III clinical
trial and a pivotal Phase IIb clinical trial have demonstrated E25's ability to
prevent or reduce symptoms of seasonal allergic rhinitis. Two Phase III clinical
trials in allergic asthma have demonstrated E25's ability to reduce symptoms
related to asthma. Clinicians who participated in the studies presented the
results of those trials at the American Academy of Allergy Asthma and Immunology
in March 2000. As mentioned above, Novartis and Genentech intend to file for
marketing approval for both indications in the United States and Europe in
mid-2000.

OTHER PRODUCT CANDIDATES.  Using our comprehensive understanding of the human
immune system, we are building a diverse pipeline of monoclonal antibody product
candidates. In addition to E25, we have two other products in clinical
development and we are evaluating several product candidates in preclinical and
research studies.

  o    HU-901 is a humanized anti-IgE monoclonal antibody similar to E25 that is
       in a Phase I/II trial to test its effectiveness in reducing severe
       allergic reactions to peanuts. According to a recently published survey,
       peanut or tree nut (e.g., walnut, almond and cashew) allergy affects
       about 3 million people in the United States. If our clinical trial
       indicates that Hu-901 reduces sensitivity

                                       4
<PAGE>
       to peanuts, we may also investigate its benefit to patients with other
       food allergies. Novartis and Genentech are currently disputing our right
       to independently develop this product.

  o    5D12 is an anti-CD40 monoclonal antibody that we are developing to treat
       autoimmune diseases. We are currently conducting a Phase I/II trial in
       patients with Crohn's disease. We expect the results of this trial to
       play an important role in determining clinical indications that we intend
       to pursue with this product. We have exclusive rights to 5D12 in Europe
       and Japan under a license from Chiron Corporation. We believe potential
       autoimmune disease indications, such as Crohn's disease, rheumatoid
       arthritis, multiple sclerosis and psoriasis, represent significant market
       opportunities in Europe and Japan.

  o    5A8 is an anti-CD4 antibody that is in preclinical development for
       treating HIV.

  o    166-32 is a complement factor D inhibiting antibody in research for
       treating acute inflammation.

  o    163-93 is an anti-G-CSF receptor activating antibody in research for
       treating neutropenia, or suppression of the immune system caused by
       depletion of white blood cells during chemotherapy.

                                  OUR STRATEGY

Our objective is to leverage our expertise in monoclonal antibodies and our
understanding of the human immune system to advance our product pipeline and
become a profitable biopharmaceutical company. We intend to accomplish this
through the following strategic initiatives:

  o    continuing to identify and develop novel monoclonal antibodies using our
       demonstrated expertise in immunology and monoclonal antibody technology;

  o    maximizing the market opportunity for anti-IgE antibodies by exploring
       indications beyond allergic asthma and seasonal allergic rhinitis;

  o    expanding our product pipeline through attractive acquisition and
       in-licensing opportunities;

  o    forming strategic collaborations to complement our research and
       development resources and enhance the value of our product development
       programs; and

  o    capturing additional value from our pipeline by retaining marketing
       rights for products that we can effectively sell using a small, targeted
       sales force.

                               OTHER INFORMATION

We were incorporated in Texas in March 1986 and we reincorporated in Delaware in
January 2000. Our corporate headquarters, manufacturing facility and principal
research laboratories are located at 10301 Stella Link, Houston, Texas
77025-5497 and our telephone number is 713-664-2288. Tanox(R) and our logo are
our registered service marks.

                                       5
<PAGE>
                                  THE OFFERING

<TABLE>
<S>                                    <C>
Common stock offered.................  7,000,000 shares

Common stock to be outstanding after
  the offering.......................  40,973,123 shares

Use of proceeds......................  For research and development activities, for capital
                                       expenditures, to finance possible acquisitions and
                                       investments in technology, products or businesses and
                                       for working capital and other general corporate
                                       purposes.

Proposed Nasdaq National Market
  symbol.............................  TNOX
</TABLE>

The share amounts in the table above are based on the number of shares
outstanding at March 31, 2000 and excludes:

  o    2,586,993 shares of common stock issuable on exercise of outstanding
       options at a weighted average exercise price of $5.36 per share; and

  o    8,172,980 shares of common stock reserved for issuance pursuant to future
       grants under our stock option plans.

Unless otherwise stated, all information contained in this prospectus assumes no
exercise of the underwriters' over-allotment option. On February 1, 2000, we
effected a 1.6 for 1 stock split by paying a stock dividend. All common share
numbers in this prospectus reflect the stock split.

                                       6
<PAGE>
                   SUMMARY CONSOLIDATED FINANCIAL INFORMATION
                     (in thousands, except per share data)

                                            YEAR ENDED DECEMBER 31,
                                       ---------------------------------
                                         1997        1998        1999
                                       ---------  ----------  ----------

STATEMENT OF OPERATIONS DATA:

Revenues.............................  $   8,939  $    2,422  $    1,405

Research and development.............      6,926      11,933      17,163

General and administrative...........      2,230       3,431       8,582
                                       ---------  ----------  ----------

Total operating costs and expenses...      9,156      15,364      25,745
                                       ---------  ----------  ----------

Income (loss) from operations........       (217)    (12,942)    (24,340)

Other income, net....................      1,045       1,240       1,028
                                       ---------  ----------  ----------

Income (loss) before income taxes....        828     (11,702)    (23,312)

(Provision) benefit of income
  taxes..............................       (198)      1,533         (34)
                                       ---------  ----------  ----------

Net income (loss)....................  $     630  $  (10,169) $  (23,346)
                                       =========  ==========  ==========

Earnings (loss) per share:

     Basic...........................  $    0.02  $    (0.35) $    (0.75)
                                       =========  ==========  ==========

     Diluted.........................  $    0.02  $    (0.35) $    (0.75)
                                       =========  ==========  ==========

Shares used in computing earnings
  (loss) per share:

     Basic...........................     27,909      29,105      31,113

     Diluted.........................     31,190      29,105      31,113


                                           DECEMBER 31, 1999
                                       --------------------------
                                        ACTUAL      AS ADJUSTED
                                       ---------   --------------

BALANCE SHEET DATA:

Cash, cash equivalents and short-term
  investments........................  $  47,254      $231,704

Working capital......................     42,718       227,168

Total assets.........................     55,328       239,778

Long term debt.......................     10,000        10,000

Retained earnings (deficit)..........    (30,461)      (30,461)

Total stockholders' equity...........     40,007       224,457

The as adjusted balance sheet data in the table above reflects the sale of
7,000,000 shares of common stock in this offering at an assumed public offering
price of $28.50 per share, after deducting estimated underwriters' discounts and
commissions and offering expenses.

                                       7

<PAGE>
                                  RISK FACTORS

YOU SHOULD CAREFULLY CONSIDER THE FOLLOWING FACTORS AND OTHER INFORMATION IN
THIS PROSPECTUS BEFORE DECIDING TO INVEST IN OUR COMMON STOCK.

WE HAVE A HISTORY OF NET LOSSES; WE EXPECT TO CONTINUE TO INCUR NET LOSSES AND
WE MAY NEVER ACHIEVE OR MAINTAIN PROFITABILITY.

We have incurred net losses since our inception. As of December 31, 1999, we had
an accumulated deficit of approximately $30.5 million, including a net loss of
approximately $23.3 million for the year ended December 31, 1999. Our losses
have primarily been the result of costs incurred in our research and development
programs and from our general and administrative costs.

We have not earned any revenues from commercial sales of any of our therapeutic
products, and we do not expect sales to commence until at least 2001, if at all.
We have funded our operations principally from licensing fees and milestone
payments under our current or former collaborations and private placements of
our common stock. We expect to continue to incur substantial operating losses
for the foreseeable future, particularly as we increase our research and
development, manufacturing, clinical trial and administrative activities. We
expect that losses will continue until such time, if ever, that we are able to
generate sufficient revenue from milestone payments and royalties on our lead
product candidate, E25, to cover our expenses.

Our ability to achieve and maintain long term profitability depends to a
significant extent on obtaining regulatory approval for and successfully
commercializing E25, and also on successfully completing preclinical and
clinical trials, obtaining required regulatory approvals and successfully
developing, manufacturing and marketing our other current and future product
candidates. We cannot assure you that we will be able to achieve any of the
foregoing or that we will be profitable even if we successfully commercialize
our products.

IF WE DO NOT RECEIVE REGULATORY APPROVALS FOR E25, WE WOULD BE SIGNIFICANTLY
HARMED AND OUR STOCK PRICE WOULD DROP SHARPLY.

E25 is our lead product candidate. Our success will depend, to a great degree,
on the success of E25. In order to successfully commercialize E25, our
collaborators, Novartis and Genentech, must be able to, among other things,
obtain regulatory approvals for E25.

Neither the U.S. Food and Drug Administration, or FDA, nor any European
regulatory agency, has approved E25. Novartis and Genentech intend to file a
biologics license application, or BLA, for E25 in the United States and apply
for registration of E25 in Europe by mid-2000. We cannot assure you that the FDA
or other regulatory authorities will accept these filings, that E25 will be
approved in a timely manner or that it will be approved at all.

If our collaborators fail to successfully obtain regulatory approvals for E25,
our business, financial condition and results of operations will be materially
harmed. Moreover, since E25 is our most advanced product candidate, a setback of
this nature would cause a sharp drop in our stock price. Failure of our E25
program could also reflect adversely on our Hu-901 program, which is also based
on anti-IgE technology.

FAILURE TO RECEIVE MARKET ACCEPTANCE FOR AND SUCCESSFULLY COMMERCIALIZE E25
WOULD HAVE A SIGNIFICANT ADVERSE EFFECT ON US.

Even if the FDA approves E25, we cannot be certain that physicians, patients,
insurers or other third-party payors will accept E25 as a treatment for its
approved indications in the United States or in any foreign markets. A number of
factors may affect the rate and level of E25's market acceptance including:

  o    regulatory developments related to manufacturing or using E25;

  o    E25's price relative to other products or competing treatments;

                                       8
<PAGE>
  o    the effectiveness of Novartis' and Genentech's sales and marketing
       efforts;

  o    the perception by physicians and other members of the healthcare
       community of E25's safety, efficacy and benefits compared to those of
       competing products or therapies;

  o    the willingness of physicians to adopt a new allergy treatment regimen;

  o    the availability of third-party reimbursement; and

  o    unfavorable publicity concerning E25 or comparable products or therapies.

If E25 is not accepted as a safe and effective drug and we are unable to
successfully commercialize it, our business, financial condition and results of
operations will be materially harmed.

FAILURE BY NOVARTHS OR GENENTECH TO DEVELOP, OBTAIN REGULATORY APPROVAL FOR,
MANUFACTURE, MARKET, OR DISTRIBUTE E25 OR OTHER ANTI-IGE PRODUCTS MAY DELAY OR
SIGNIFICANTLY IMPAIR OUR ABILITY TO GENERATE REVENUES.

Under the terms of our collaboration agreements, Novartis and Genentech are
responsible for developing, obtaining regulatory approval for, manufacturing,
marketing and distributing E25 and other anti-IgE products that the
collaboration may select for development. We expect for the extended future that
Novartis and Genentech will manufacture, market and distribute E25 and other
selected anti-IgE products, if the FDA approves any of these products. We also
rely on Novartis and Genentech for significant financial and technical
contributions to develop products covered by our collaboration agreements. Our
ability to profit from these products depends on Novartis' and Genentech's
performance under their agreements with us. We cannot control the amount and
timing of resources Novartis and Genentech will devote to any of our products.
If Novartis or Genentech experiences manufacturing or distribution difficulties,
does not actively market E25 or other selected anti-IgE products or does not
otherwise perform under our collaboration agreements, our potential for revenue
from those products will be dramatically reduced. Novartis and Genentech may
terminate our collaboration agreements on short notice. If Novartis or Genentech
terminates our collaboration, we would experience increased capital requirements
to undertake development and marketing at our expense, and we cannot assure you
that we would be able to develop E25 or our other anti-IgE products on our own.

FAILURE BY OUR FUTURE COLLABORATION PARTNERS TO DEVELOP, MANUFACTURE, MARKET OR
DISTRIBUTE OUR OTHER PRODUCTS MAY DELAY OR SIGNIFICANTLY IMPAIR OUR ABILITY TO
GENERATE REVENUES OR OTHERWISE MATERIALLY HARM OUR PROFITABILITY.

We will rely on other collaboration partners to develop, manufacture,
commercialize, market and distribute our other products. Many of our competitors
are similarly seeking to develop or expand their collaboration and license
arrangements with pharmaceutical companies. The success of these efforts by our
competitors could have an adverse impact on our ability to form future
collaboration arrangements. We cannot assure you that we will be able to
negotiate acceptable collaboration agreements in the future or that efforts
under any collaboration agreements will succeed. To the extent that we choose
not to or are unable to enter into future collaboration agreements, we would
experience increased capital requirements to undertake research, development and
marketing at our own expense. In addition, we may encounter significant delays
in introducing our product candidates or find that the absence of these
collaboration agreements adversely affects our ability to develop, manufacture
or sell our product candidates.

Our reliance on collaboration partners poses the following additional risks:

  o    disputes with our partners may arise, delaying or terminating our product
       candidates' research, development or commercialization or resulting in
       significant litigation or arbitration;

  o    contracts with our partners may fail to provide significant protection or
       may become unenforceable if one of these partners fails to perform;

  o    our partners may not commit enough capital or other resources to
       successfully develop our products;

                                       9
<PAGE>

  o    our partners may not continue to develop and commercialize products
       resulting from our collaborations; and

  o    our partners with marketing and distribution rights to one or more of our
       products may not commit enough resources to marketing and distributing
       our products.

If any of these risks occur, our product development and productivity may
suffer, and our business, financial condition and results of operations would be
materially harmed.

WE ARE INVOLVED IN LITIGATION AND ARBITRATION PROCEEDINGS WITH NOVARTIS AND
GENENTECH THAT MAY BE VERY COSTLY TO US AND COULD CAUSE US TO LOSE OUR RIGHTS TO
INDEPENDENTLY DEVELOP PRODUCTS.

We are a party to arbitrations and a related federal district court lawsuit with
our collaboration partners Novartis and Genentech, relating to our rights to
develop Hu-901 and other anti-IgE antibodies independently of our collaboration
with Novartis and Genentech. Novartis and Genentech are disputing our right to
pursue development of Hu-901 independently and are claiming that we are using
their unspecified confidential and proprietary information that we have no right
to use.

If we do not succeed in these proceedings, we could incur substantial damages
that would harm our financial position and we could lose our rights to
independently develop products covered by the collaboration, including Hu-901.
Even if we succeed, we may not be able to secure any recovery or develop
anti-IgE products independently of the collaboration. In either case, we expect
these proceedings to consume substantial amounts of our financial and managerial
resources. Further, because of the substantial amount of discovery required in
connection with this type of litigation, there is a risk that disclosure might
compromise some of our confidential information.

NONE OF OUR PRODUCTS HAVE RECEIVED REGULATORY APPROVAL. IF WE DO NOT RECEIVE AND
MAINTAIN REGULATORY APPROVALS, WE WILL NOT BE ABLE TO MARKET OUR PRODUCTS.

Neither the FDA, nor any regulatory authority, has approved any of our products,
including E25. We must receive FDA approval to manufacture and market our
products in the United States. Other countries have similar requirements.

The process that pharmaceutical products must undergo to receive this approval
is extensive, and includes preclinical testing and clinical trials to
demonstrate safety and efficacy and a review of the manufacturing process to
ensure compliance with good manufacturing practices. This process can last many
years, be very costly and still be unsuccessful. The FDA can delay, limit or not
grant approval for many reasons, including:

  o    a product candidate may not be safe or effective;

  o    FDA officials may interpret data from preclinical testing and clinical
       trials in different ways than we interpret it;

  o    the FDA might not approve our manufacturing processes or facilities or
       the processes or facilities of our collaboration partners;

  o    the FDA may change its approval policies or adopt new regulations; and

  o    the FDA may approve a product candidate for fewer than all the
       indications requested.

The process of obtaining approvals in foreign countries is subject to delay and
failure for the same reasons. Any delay in or failure to receive approval for
any of our products could materially harm our business, financial condition and
results of operations.

Our products other than E25 require significant additional laboratory
development and/or clinical trials prior to commercialization. We may not
successfully develop products in research and development and our products may
not meet applicable regulatory standards or obtain required regulatory
approvals.

Approval of a product candidate could also depend on post-marketing studies. In
addition, any marketed product and its manufacturer continue to be subject to
strict regulation after approval. Any unforeseen problems with an approved
product or any violation of regulations could result in restrictions on the
product, including its withdrawal from the market. Delays in receiving or
failing to receive regulatory approvals, or losing previously received
approvals, would delay or prevent product commercialization, which would
adversely affect

                                       10
<PAGE>
our business, financial condition and results of operations.

WE ARE INVOLVED IN LEGAL PROCEEDINGS WITH OUR FORMER ATTORNEYS THAT MAY BE VERY
COSTLY TO US.

We have been involved in an arbitration regarding a fee dispute with our former
attorneys who represented us in our 1993 lawsuit against Genentech and F.
Hoffman-La Roche, Ltd. and its affiliates, and a 1994 lawsuit filed against us
by Genentech. The arbitration panel issued an award which entitled those
attorneys to receive approximately $3.5 million, including interest, payments
ranging from 33 1/3% to 40% of any future milestone payments received by us from
Genentech following product approval and 10% of the royalties that we receive on
sales of anti-IgE products. We sought a court order vacating the arbitration
award. However, a judgment was entered confirming the award. We intend to pursue
all available remedies, including appealing the decision.

We may not be successful in this proceeding. If this proceeding continues to
result in decisions unfavorable to us, we could lose substantial value from our
collaboration with Novartis and Genentech which could negatively affect our
stock price and harm our business, financial condition and results of
operations. Whether or not we are successful in this proceeding, we expect it to
consume substantial amounts of our financial and managerial resources.

OUR PRECLINICAL AND CLINICAL TESTING RESULTS ARE UNCERTAIN. IF TRIAL RESULTS ARE
NEGATIVE, WE MAY BE FORCED TO STOP DEVELOPING PRODUCTS IMPORTANT TO OUR FUTURE.

We must demonstrate through preclinical studies and clinical trials that our
products are safe and effective for use in each target indication before we can
obtain regulatory approvals to sell our products commercially. These studies and
trials may be very costly and time consuming. The results of preclinical studies
and initial clinical trials of our products do not necessarily predict the
results from later-stage clinical trials. Drugs in later stages of clinical
trials may fail to show the desired safety and efficacy traits despite having
progressed through initial clinical testing. We cannot assure you that the data
collected from clinical trials of our products will be sufficient to support FDA
or other regulatory approval.

The speed with which we are able to enroll patients in clinical trials is an
important factor in determining how quickly we may complete clinical trials.
Many factors affect patient enrollment, including the size of the patient
population, the proximity of patients to clinical sites and the eligibility
criteria for the study. We may target our clinical trial protocols at
indications that have small patient populations, which may make it difficult for
us to enroll enough patients to complete the trials. Delays in patient
enrollment in the trials may result in increased costs, program delays, or both,
which could slow down our product development and approval process, and could
materially harm our business.

Administering any product we develop to humans may produce undesirable side
effects. These side effects could interrupt or delay clinical trials of products
and could result in the FDA or other regulatory authorities denying approval of
our products for any or all targeted indications. The FDA, other regulatory
authorities or we may suspend or terminate clinical trials at any time. Even if
we receive FDA and other regulatory approvals, our products may later exhibit
adverse effects that limit or prevent their widespread use or that force us to
withdraw those products from the market. We cannot assure you that any of our
products will be safe for human use.

WE HAVE LIMITED EXPERIENCE AND CAPABILITY IN MANUFACTURING AND MAY ENCOUNTER
MANUFACTURING PROBLEMS OR DELAYS THAT COULD RESULT IN LOST REVENUE.

To commercialize our products successfully, we and our collaboration partners
must manufacture our products in commercial quantities in compliance with
regulatory requirements and at an acceptable cost. If the manufacturing
facilities used to produce our products cannot pass a pre-approval or periodic
plant inspection, the FDA may not approve our products or it may delay or bar
their sale. Although we expect Novartis and Genentech to manufacture E25 and
other anti-IgE products that our collaboration develops, if the FDA and other
regulatory authorities approve these products, we have reserved the right to
manufacture up to 50% of the worldwide requirements for these

                                       11
<PAGE>
products. We currently have a process development and manufacturing facility for
biological products located in Houston, Texas. However, we have no experience in
manufacturing commercial quantities of antibodies and currently have limited
manufacturing capacity. In order to obtain regulatory approvals and to create
capacity to produce our products in sufficient quantities for commercial sale at
an acceptable cost, we will have to develop or acquire additional technology for
large scale manufacturing and build or otherwise obtain access to adequate
facilities, which will require substantial additional funds. We will also be
required to demonstrate to the FDA and corresponding foreign authorities our
ability to manufacture our products using controlled, reproducible processes. We
cannot assure you that we can develop the necessary manufacturing technology or
that we will be able to fund or build an adequate commercial manufacturing
facility necessary to obtain regulatory approvals and to produce adequate
commercial supplies of our potential products on a timely basis. We cannot
assure you that we, operating alone or with the assistance of others, will be
able to successfully make the transition to commercial production.

WE LACK SALES AND MARKETING EXPERIENCE, WHICH MAKES US DEPEND ON THIRD PARTIES
FOR THEIR EXPERTISE IN THIS AREA.

If we receive the required regulatory approvals, we expect to market and sell
our products principally through distribution, co-marketing, co-promotion or
licensing arrangements with third parties. Under our current collaboration
agreement, Novartis and Genentech have exclusive marketing rights to E25 and
other selected anti-IgE products. However, commercialization rights may revert
back to us if either we or our collaborators terminate our relationship. We
currently have no sales, marketing or distribution capabilities. Any revenues we
receive from our E25 collaboration will depend primarily on the efforts of our
collaboration partners. We intend to retain marketing rights in the United
States and selected Asian countries for products that we can develop and sell
effectively with a small, targeted sales force. If we elect to market products
directly, we would require significant additional expenditures and management
resources to develop an internal sales force. We cannot assure you that we would
be able to establish a successful sales force should we choose to do so.

WE FACE INTENSE COMPETITION AND RAPID TECHNOLOGICAL CHANGE THAT COULD RESULT IN
PRODUCTS THAT ARE SUPERIOR TO THE PRODUCTS WE ARE DEVELOPING.

The biotechnology and pharmaceutical industries are subject to rapid and
significant technological change. We have numerous competitors in the United
States and abroad, including, among others, major pharmaceutical and chemical
companies, specialized biotechnology firms, universities and other research
institutions. These competitors may develop technologies and products that are
more effective or less costly than any of our current or future products or that
could render our technologies and products obsolete or noncompetitive. Many of
these competitors have substantially more resources and product development,
production and marketing capabilities than we do. In addition, many of our
competitors have significantly greater experience than we do in undertaking
preclinical testing and clinical trials of new or improved pharmaceutical
products and obtaining FDA and other regulatory approvals of products for use in
health care. If we succeed in achieving significant commercial sales of our
products, we also will be competing in manufacturing efficiency and marketing
capability, areas in which we have limited or no experience. Furthermore, our
competitors may obtain FDA approval for products sooner and be more successful
in manufacturing and marketing their products than are we or our collaborators.

Products currently exist in the market that will compete directly with the
products that we seek to develop. Any product candidate that we develop and that
obtains regulatory approval must then compete for market acceptance and market
share. Our product candidates may not gain market acceptance among physicians,
patients, healthcare payors and the medical community. Significant factors in
determining whether we will be able to compete successfully include:

  o    efficacy and safety of our products;

  o    timing and scope of regulatory approval;

  o    product availability;

                                       12
<PAGE>
  o    potential advantages over alternative treatment methods;

  o    development, marketing, distribution and manufacturing capabilities and
       support of our collaborators;

  o    reimbursement coverage from insurance companies and others;

  o    price and cost-effectiveness of our products; and

  o    patent protection.

If our products are not competitive based on these or other factors, our
business, financial condition and results of operations will be materially
harmed.

WE DEPEND ON OUR PATENTS AND PROPRIETARY RIGHTS. THE VALIDITY, ENFORCEABILITY
AND COMMERCIAL VALUE OF THESE RIGHTS ARE HIGHLY UNCERTAIN.

Our success depends in part on obtaining, maintaining and enforcing patents,
licensing the rights to patents and patent applications owned by others,
maintaining trade secrets and operating without infringing on the proprietary
rights of third parties. While we file and prosecute patent applications to
protect our inventions, our pending patent applications may not result in the
issuance of valid patents and our issued patents may not provide competitive
advantages. Also, our patent protection may not prevent others from developing
competitive products using related technology. We cannot assure you that pending
patent applications licensed to us will result in patents being issued or that,
if issued, the patents will give us an advantage over competitors with similar
technology.

We own and have licenses to certain issued patents. The patents we own that are
most material to our business are five U.S. patents and six foreign patents
relating to anti-IgE antibodies. However, the patent position of biotechnology
and pharmaceutical firms is highly uncertain and involves many complex legal and
technical issues. There is no clear policy involving the breadth of claims
allowed or the degree of protection afforded under such patents. Issued patents
can be challenged in litigation in the courts and in proceedings in the patent
and trademark office in the United States and in courts and patent offices in
foreign countries. Issuance of a patent is not conclusive as to its validity,
enforceability or the scope of its claim. We cannot assure you that our patents
will not be successfully challenged as to enforceability, invalidated or limited
in the scope of their coverage. Moreover, litigation to uphold the validity of
patents and to prevent infringement can be very costly and can result in
diverting technical and management personnel's time and attention, which may
materially harm our business, financial condition and results of operations. If
the outcome of litigation is adverse to us, third parties may be able to use our
patented technology without paying us. Moreover, we cannot assure you that our
patents will not be infringed or successfully avoided through design innovation.
Any of these events may materially and adversely effect our business.

There may be patent rights belonging to others that require us to alter our
products, pay licensing fees or cease certain activities. If our products
conflict with patent rights of others, the owners of those patent rights could
bring legal actions against us claiming damages and seeking to stop us from
manufacturing and marketing the affected products. If these legal actions are
successful, in addition to any potential liability for damages, we could be
required to obtain a license in order to continue to manufacture or market the
affected products. We cannot assure you that we would prevail in any such action
or that any license required under any such patent would be made available on
acceptable terms or at all. Any of these events may materially harm our
business, financial condition and results of operations.

Researching, developing and commercializing a biopharmaceutical product often
involves alternative development and optimization routes that are presented at
various stages in the development process. We cannot predict the preferred
routes at the outset of a research and development program, because they will
depend on subsequent discoveries and test results. There are numerous
third-party patents in our field, and it is possible that, to pursue the
preferred development route of one or more of our products, we will need to
obtain a license to a patent, which would decrease the ultimate profitability of
the applicable product. If we cannot negotiate a license, we might have to
pursue a less desirable development route or terminate the program altogether.

                                       13
<PAGE>
We are aware that other groups have claimed discoveries similar to those covered
by our patent applications. In addition, other companies, some of which may be
our competitors, have filed applications for or have been issued patents and may
obtain additional patents and proprietary rights relating to products or
processes used in, necessary to, competitive with or otherwise related to our
patents and products. These products and processes include, among other items,
patents covering technology relating to humanized monoclonal antibodies that we
anticipate developing. Protein Design Labs, Inc. owns certain patents and patent
applications relating to such humanized antibodies. We have recently taken a
non-exclusive license to these patents and patent applications for one of our
products. We do not know if we can obtain licenses from Protein Design Labs for
our other antibody products.

We must make substantial cash payments and achieve certain milestones and
satisfy certain conditions, including filing investigational new drug
applications, obtaining product approvals and introducing products, to maintain
our rights under certain of our licenses, including our licenses from Chiron and
Biogen, Inc. We cannot assure you that we will be able to maintain our rights
under these licenses. If any of these licenses terminate, we may be unable to
commercialize any related product.

In addition to the intellectual property rights described above, we also rely on
unpatented technology, trade secrets and confidential information. We cannot
assure you that others will not independently develop substantially equivalent
information and techniques or otherwise gain access to our technology or
disclose such technology, or that we can effectively protect our rights in
unpatented technology, trade secrets and confidential information. We require
each of our employees, consultants and advisors to execute a confidentiality
agreement at the commencement of an employment or consulting relationship with
us. We cannot assure you, however, that these agreements will provide effective
protection if an unauthorized use or disclosure of this confidential information
occurs.

WE MAY EXPERIENCE DIFFICULTIES IN MANAGING GROWTH, WHICH COULD MATERIALLY HARM
OUR BUSINESS, FINANCIAL CONDITION AND RESULTS OF OPERATIONS.

If our product development efforts and the product development efforts of our
collaborators succeed, our growth could strain our operations, product
development and other managerial and operating resources. Future growth will
impose significant added responsibilities on members of management, including
the need to identify, recruit, maintain and integrate additional employees,
including management. In the future, our financial performance and our ability
to compete effectively will depend, in part, on our ability to manage any future
growth effectively. To that end, we must be able to:

  o    manage our research and development efforts effectively;

  o    expand the capacity, scalability and performance of our product
       development infrastructure;

  o    develop our administrative, accounting and management information systems
       and controls;

  o    improve coordination among our research, accounting, finance, marketing
       and operations personnel; and

  o    hire and train additional qualified personnel.

We cannot assure you that we will be able to accomplish these tasks, and our
failure to accomplish any of these tasks could materially harm our business,
financial condition and results of operations.

FAILURE TO ATTRACT AND RETAIN KEY PERSONNEL AND PRINCIPAL MEMBERS OF OUR
SCIENTIFIC AND MANAGEMENT STAFF COULD MATERIALLY HARM OUR BUSINESS, FINANCIAL
CONDITION AND RESULTS OF OPERATIONS.

Our success depends greatly on our abilities to attract and retain qualified
scientific and technical personnel, as well as to retain the services of our
existing technical management staff. To expand our research and development
programs and pursue our product development plans, we will be required to hire
additional qualified scientific and technical personnel, as well as personnel
with expertise in clinical testing and government regulation. There is intense
competition for

                                       14
<PAGE>
qualified staff, and we cannot assure you that we will be able to attract and
retain the necessary qualified staff to develop our business. The failure to
attract and retain key scientific and technical personnel and management staff
or the loss of any of our current management team could materially harm our
business and financial condition. We do not maintain, and do not currently
intend to obtain, key employee global life insurance on any of our personnel.

WE MAY NEED ADDITIONAL FINANCING, BUT OUR ACCESS TO CAPITAL FUNDING IS
UNCERTAIN.

Our current and anticipated development projects require substantial additional
capital. We expect that the net proceeds from this offering, together with our
existing assets and revenue from operations, will sufficiently fund our
operations for the next three years. However, our future capital needs will
depend on many factors, including successfully commercializing E25, receiving
milestone payments from our collaboration partners, and making progress in our
research and development activities. Our success may also depend on the
magnitude and scope of these activities, the progress and level of unreimbursed
costs associated with preclinical studies and clinical trials, the costs
associated with acquisitions, the costs of preparing, filing, prosecuting,
maintaining and enforcing patent claims and other intellectual property rights,
competing technological and market developments, changes in or terminations of
existing collaboration and licensing arrangements, the establishment of
additional collaboration and licensing arrangements, and the cost of
manufacturing scale-up and development of marketing activities, if undertaken by
us. We do not have committed external sources of funding and we cannot assure
you that we will be able to obtain additional funds on acceptable terms, if at
all. If adequate funds are not available, we may be required to:

  o    delay, reduce the scope of or eliminate one or more of our development
       programs;

  o    obtain funds through arrangements with collaboration partners or others
       that may require us to relinquish rights to technologies, product
       candidates or products that we would otherwise seek to develop or
       commercialize ourselves; or

  o    license rights to technologies, product candidates or products on terms
       that are less favorable to us than might otherwise be available.

If we raise additional funds by issuing additional stock, further dilution to
our stockholders may result, and new investors could have rights superior to
existing stockholders. If funding is insufficient at any time in the future, we
may be unable to develop or commercialize our products, take advantage of
business opportunities or respond to competitive pressures.

WE ARE SUBJECT TO THE UNCERTAINTY RELATED TO REIMBURSEMENT POLICIES AND
HEALTHCARE REFORM MEASURES.

In recent years, there have been numerous proposals to change the healthcare
system in the United States. Some of these proposals have included measures that
would limit or eliminate payments for medical procedures and treatments or
subject pharmaceutical product pricing to government control. In addition, as a
result of the trend towards managed healthcare in the United States, as well as
legislative proposals to reduce government insurance programs, third-party
payors are increasingly attempting to contain healthcare costs by limiting both
coverage and the level of reimbursement of new drug products. Consequently,
significant uncertainty exists as to the reimbursement status of newly-approved
healthcare products. If we or any of our collaborators succeed in bringing one
or more of our products to market, we cannot assure you that third-party payors
will establish and maintain price levels sufficient for us to realize an
appropriate return on our investment in product development. Significant changes
in the healthcare system in the United States or elsewhere, including changes
resulting from adverse trends in third-party reimbursement programs, could
materially reduce our profitability. Such changes could also significantly harm
our ability to raise the capital we would need to continue our operations.
Furthermore, if these proposals affect our collaborators, the proposals may harm
our ability to commercialize the products we develop jointly with them.

                                       15
<PAGE>
WE ARE EXPOSED TO PRODUCT LIABILITY CLAIMS, AND IT IS UNCERTAIN THAT WE CAN
OBTAIN INSURANCE AGAINST THESE CLAIMS AT A REASONABLE RATE IN THE FUTURE.

Our business exposes us to potential product liability risks, which are inherent
in testing, manufacturing, marketing and selling pharmaceutical products. We may
be held liable if any product we develop, or any product that uses or
incorporates any of our technologies, causes injury or is found otherwise
unsuitable during product testing, manufacturing, marketing or sale. We cannot
assure you that we will be able to avoid product liability exposure. Product
liability insurance for the biopharmaceutical industry is generally expensive,
if available at all. We have obtained product liability insurance coverage in
the amount of $5.0 million per occurrence, subject to a $5.0 million aggregate
limitation. However, we cannot assure you that our present insurance coverage is
now or will continue to be adequate. In addition, some of our license and
collaboration agreements require us to obtain product liability insurance.
Future license and collaboration agreements may also include such a requirement.
We cannot assure you that we can obtain adequate insurance coverage at a
reasonable cost in the future. Our inability to obtain sufficient insurance
coverage at an acceptable cost or otherwise to protect against potential product
liability claims could prevent or inhibit us or our collaborators from
commercializing our products. If we are sued for any injury caused by our
products, our liability could exceed our total assets.

WE DEAL WITH HAZARDOUS MATERIALS AND MUST COMPLY WITH ENVIRONMENTAL LAWS AND
REGULATIONS, WHICH CAN BE EXPENSIVE AND RESTRICT HOW WE DO BUSINESS.

Our research and development work and manufacturing processes involve the
controlled use of hazardous materials, including chemical, radioactive and
biological materials. Our operations also produce hazardous waste products. We
are subject to federal, state and local laws and regulations governing how we
use, manufacture, store, handle and dispose of these materials. Although we
believe that we comply in all material respects with applicable environmental
laws and regulations, we cannot assure you that we will not incur significant
costs to comply with environmental laws and regulations in the future. In
addition, current or future environmental laws and regulations may impair our
research, development or production efforts.

WE COULD BE LIABLE FOR DAMAGES, PENALTIES OR OTHER FORMS OF CENSURE IF WE ARE
INVOLVED IN A HAZARDOUS WASTE SPILL OR OTHER ACCIDENT.

Despite precautionary procedures that we implement for handling and disposing of
hazardous materials, we cannot eliminate the risk of accidental contamination or
discharge or any resultant injury from these materials. If a hazardous waste
spill or other accident occurs, we could be liable for damages, penalties or
other forms of censure. In addition, we may be sued for injury or contamination
that results from our use or the use by third parties of these materials, and
our liability could exceed our total assets.

OUR EXECUTIVE OFFICERS AND DIRECTORS OWN A LARGE PERCENTAGE OF OUR VOTING STOCK
AND WILL CONTINUE TO CONTROL OUR COMPANY AND THE OUTCOME OF MATTERS PUT TO A
VOTE OF STOCKHOLDERS AFTER THIS OFFERING.

Immediately after we complete this offering, our executive officers and
directors and their affiliates will, in the aggregate, own shares representing
approximately 36% of our outstanding common stock. As a result, these
stockholders, acting together, will significantly influence our general
management and affairs, and all matters submitted to our stockholders for
approval, including electing directors and approving changes in control. Such
control could discourage others from initiating potential merger, takeover or
other change of control transactions, and may adversely affect the market price
of our common stock. For a more detailed description of our management team and
their ownership of common stock, please refer to "Management" on page 47.

                                       16
<PAGE>
OUR AMENDED AND RESTATED CERTIFICATE OF INCORPORATION AND BYLAWS AND DELAWARE
LAW CONTAIN CERTAIN PROVISIONS THAT COULD DELAY OR PREVENT A TAKEOVER AND
SUPPRESS OUR STOCK PRICE.

Provisions of our amended and restated certificate of incorporation, bylaws and
Delaware law could delay, defer or prevent a third party from acquiring us,
despite the possible benefit to our stockholders, or otherwise adversely affect
the price of our common stock.

These provisions include:

  o    the ability of our board of directors to issue shares of preferred stock
       and to determine the price and other terms, including preferences and
       voting rights, of those shares without stockholder approval;

  o    a staggered board of directors;

  o    a limitation on who may call special meetings of stockholders; and

  o    advance notice requirements for nomination for election to the board of
       directors or for proposing matters that stockholders may act on at
       stockholder meetings.

In addition to these provisions, we are subject to certain Delaware laws,
including one that prohibits us from engaging in a business combination with any
interested stockholder for a period of three years from the date the person
became an interested stockholder unless certain conditions are met. We may also
adopt a shareholder rights plan or "poison pill" after this offering. All of
this may discourage potential takeover attempts, discourage bids for our common
stock at a premium over market price or adversely affect the market price of,
and the voting and other rights of the holders of, our common stock.

YOU MAY NOT BE ABLE TO TRADE OUR COMMON STOCK IF AN ACTIVE TRADING MARKET DOES
NOT DEVELOP.

Prior to this offering, there has been no public market for our common stock. We
cannot predict the extent to which investor interest in us will lead to an
active trading market in our common stock or how liquid that market might
become. We will determine the initial public offering price for our shares by
negotiating with representatives of the underwriters. This price may not
indicate prices that will prevail in any future trading market. You may not be
able to sell shares of our common stock at or above our initial public offering
price.

MARKET VOLATILITY MAY AFFECT OUR STOCK PRICE AND THE VALUE OF YOUR INVESTMENT
MAY BE SUBJECT TO SUDDEN DECREASES.

The trading price for our common stock is likely to be volatile. Prices for our
common stock will be determined in the marketplace and may be influenced by many
factors, including variations in our financial results, changes in earnings
estimates by industry research analysts, investors' perceptions of us and our
financial prospects, results of the governmental approval process for our
products, results of clinical trials, changes in government regulations,
developments in our relationships with our collaboration partners, developments
in our litigation, announcements of new products, technologies or treatments by
us or our competitors and general economic, industry and market conditions. In
addition, the stock markets from time to time have experienced extreme price and
volume fluctuations. In particular, the market prices of the securities of
biotechnology companies have been especially volatile, and often these
fluctuations do not relate to operating performance. These broad fluctuations
may adversely affect the trading price of our common stock, regardless of our
actual operating performance.

In the past, following periods of market volatility, security holders have
instituted class action litigation. If the market value of our stock experiences
adverse fluctuations and we become involved in this type of litigation, we could
incur substantial legal costs and management's attention could be diverted,
which could materially harm our business or the market price of our common
stock.

SALES OF COMMON STOCK MAY HAVE AN ADVERSE IMPACT ON THE MARKET PRICE OF OUR
COMMON STOCK.

Sales of significant amounts of our common stock after this offering or the
perception that such sales will occur could adversely affect the market price of
our common stock or our future ability to raise capital by selling equity
securities. After this

                                       17
<PAGE>

offering is completed, 40,973,123 shares of our common stock will be issued and
outstanding. All of the shares of common stock to be sold in this offering will
be freely tradable without restriction or further registration under the federal
securities laws unless purchased by our "affiliates" within the meaning of
Rule 144 under the Securities Act. The 33,973,123 remaining shares of
outstanding common stock will be "restricted securities" under the Securities
Act, subject to restrictions on the timing, manner and volume of sales of those
shares.

Our officers and directors and stockholders who together own 32,338,553 shares
of common stock have agreed for a period of 180 days after the date of this
prospectus not to sell or otherwise dispose of any shares of our common stock,
other than shares acquired in this offering. When the lock-up period expires,
the shares owned by these persons prior to completion of this offering may be
sold into the public market without a registration statement, to the extent
permitted by Rule 144 or exemptions under the Securities Act. Moreover,
following this offering, a substantial number of shares of common stock issuable
on exercise of outstanding options will be eligible for sale in the public
market.

For a more detailed description of additional shares that may be sold in the
future, please refer to "Shares Eligible for Future Sale" on page 62 and
"Underwriting" on page 64.

AS A NEW INVESTOR, YOU WILL INCUR IMMEDIATE AND SUBSTANTIAL DILUTION IN THE BOOK
VALUE OF YOUR SHARES.

The public offering price for our shares will be substantially higher than our
net tangible book value per share, which at December 31, 1999, was $1.20 per
share. If you purchase shares of our common stock in this offering, you will
suffer immediate, substantial net tangible book value dilution of $22.93 per
share, or $22.40 per share, if the underwriters exercise their over-allotment
option in full, assuming an initial public offering price of $28.50. You will
also incur additional dilution if the holders of outstanding options to purchase
common stock at prices below our net tangible book value per share after this
offering exercise their options. For a more detailed discussion of dilution,
please refer to "Dilution" on page 22.

OUR MANAGEMENT WILL HAVE BROAD DISCRETION TO ALLOCATE THE NET PROCEEDS OF THIS
OFFERING AND MAY NOT USE THE PROCEEDS APPROPRIATELY.

Our management will have broad discretion over how we use the proceeds of this
offering. We estimate the net proceeds from this offering to be approximately
$184.5 million, after deducting underwriting discounts and commissions and
estimated offering expenses, assuming an initial public offering price of
$28.50. We plan to use these proceeds to substantially increase clinical
development of our products, expand our research and development infrastructure
and research facilities in the United States, The Netherlands and Taiwan,
acquire or in-license additional technologies and products and market our
products. We have no specific allocations for any other net proceeds of this
offering. The amount of proceeds we will actually expend on general corporate
purposes will vary depending on a number of factors, including successfully
commercializing E25. Our progress in and scope of our research and development
activities, changes in or termination of existing collaboration and licensing
arrangements, costs and magnitude of product or technology acquisitions and our
need for manufacturing capacity. Consequently, management will retain a
significant amount of discretion in spending these proceeds. Because of the
number and variability of factors that will determine the use of these proceeds,
how we spend these proceeds may vary substantially from our current intentions.

                                       18
<PAGE>
                           FORWARD-LOOKING STATEMENTS

Some of the information in this prospectus contains forward-looking statements.
You can find these statements under "Prospectus Summary," "Risk Factors,"
"Use of Proceeds," "Management's Discussion and Analysis of Financial
Condition and Results of Operations," "Business" and elsewhere in this
prospectus.

We typically identify forward-looking statements by using terms such as "may,"
"will," "should," "could," "expect," "plan," "anticipate,"
"believe," "estimate," "predict," "potential" or "continue" or similar
words, although we express some forward-looking statements differently. You
should be aware that actual events could differ materially from those suggested
in the forward-looking statements due to a number of factors, including:

  o    the ability to develop safe and efficacious drugs;

  o    failure to achieve positive results in clinical trials;

  o    failure to successfully commercialize our products;

  o    relationships with our collaboration partners;

  o    variability of royalty, license and other revenues;

  o    ability to enter into future collaboration agreements;

  o    competition and technological change; and

  o    existing and future regulations affecting our business.

You should also consider carefully the statements under "Risk Factors" and
other sections of this prospectus, which address additional factors that could
cause our actual results to differ from those set forth in the forward-looking
statements.

                                       19
<PAGE>
                                USE OF PROCEEDS

We estimate that our net proceeds from the sale of the shares of common stock in
this offering will be approximately $184,450,000. If the underwriters fully
exercise their over-allotment option, we estimate that our net proceeds from the
offering will be $212,280,250. "Net Proceeds" are what we expect to receive
after paying the underwriters' discounts and commissions and other expenses of
the offering. For the purpose of estimating net proceeds, we are assuming an
initial public offering price of $28.50 per share.

We intend to use the net proceeds of this offering primarily for research and
development, capital expenditures and general corporate purposes, including
working capital. We may use a portion of the proceeds to acquire or invest in
technologies, products or businesses that we believe may complement our
business. We currently have no agreements or commitments in this regard. The
amount of proceeds we will actually spend on general corporate purposes will
vary depending on a number of factors, including:

  o    successfully commercializing E25;

  o    our progress in and the scope of our research and development activities;

  o    changes in or termination of existing collaboration and licensing
       arrangements;

  o    costs and magnitude of product or technology acquisitions; and

  o    our need for manufacturing capacity.

Our management will have broad discretion over how we use the net proceeds of
this offering. Pending such uses, we intend to invest the net proceeds of this
offering in short-term, interest-bearing investment grade securities.

                                DIVIDEND POLICY

We have never declared or paid any cash dividends on our capital stock. We
anticipate that we will retain earnings to support operations and to finance our
business growth and development. Therefore, we do not expect to pay cash
dividends in the foreseeable future.

                                       20
<PAGE>
                                 CAPITALIZATION

The following table shows:

  o    our actual capitalization on December 31, 1999; and

  o    our as adjusted capitalization on December 31, 1999, assuming the
       completion of the offering as adjusted for the sale of 7,000,000 shares
       of common stock by us at an assumed public offering price of $28.50 per
       share, net of estimated underwriters' discounts and commissions and
       offering expenses.

                                           DECEMBER 31, 1999
                                        ------------------------
                                         ACTUAL     AS ADJUSTED
                                        --------    ------------
                                             (IN THOUSANDS)

Long term debt.......................   $ 10,000      $ 10,000
                                        --------    ------------
Stockholders' equity:
  Preferred stock, $.01 par value;
     10,000,000 shares authorized, no
     shares issued and outstanding;
     no shares issued or outstanding,
     as adjusted.....................      --           --
  Common stock, $.01 par value;
     120,000,000 shares authorized;
     33,324,402 shares issued and
     outstanding, actual; 40,324,402
     shares issued and outstanding,
     as adjusted.....................        333           403
  Additional paid-in capital.........     71,701       256,081
  Deferred compensation..............       (651)         (651)
  Loans receivable from employees....     (1,086)       (1,086)
  Other comprehensive income,
     cumulative translation
     adjustment......................        171           171
  Retained earnings (deficit)........    (30,461)      (30,461)
                                        --------    ------------
     Total stockholders' equity......     40,007       224,457
                                        --------    ------------
       Total capitalization..........   $ 50,007      $234,457
                                        ========    ============

The shares of common stock outstanding in the actual and as adjusted columns
exclude 3,183,920 shares of common stock issuable upon exercise of options
outstanding at December 31, 1999 at a weighted average exercise price of $4.39
per share.

                                       21
<PAGE>
                                    DILUTION

Our net tangible book value on December 31, 1999 was approximately $39,965,000,
or $1.20 per share. "Net tangible book value" is total assets minus the sum of
liabilities and intangible assets. "Net tangible book value per share" is net
tangible book value divided by the total number of shares outstanding.

After giving effect to adjustments relating to the offering, our pro forma net
tangible book value on December 31, 1999, would have been $224,415,000 or $5.57
per share. The adjustments made to determine pro forma net tangible book value
per share are the following:

  o    increasing total assets to reflect the estimated net proceeds of the
       offering as described under "Use of Proceeds" assuming that the public
       offering price will be $28.50 per share; and

  o    adding the number of shares offered by this prospectus to the number of
       shares outstanding.

The following table illustrates the pro forma increase in net tangible book
value of $4.37 per share and the dilution (the difference between the offering
price per share and net tangible book value per share) to new investors:

  Assumed public offering price per
     share...........................             $   28.50
  Net tangible book value per share
     as of December 31, 1999.........  $    1.20
  Increase in net tangible book value
     per share attributable to the
     offering........................       4.37
                                       ---------
  Pro forma net tangible book value
     per share as of December 31,
     1999, after giving effect to the
     offering........................                  5.57
                                                  ---------
  Dilution per share to new investors
     in the offering.................             $   22.93
                                                  =========

The following table shows the difference between existing stockholders as of
December 31, 1999 and new investors with respect to the number of shares
purchased from Tanox, the total consideration paid and the average price paid
per share. We assume that the public offering price will be $28.50 per share.

<TABLE>
<CAPTION>
                                          SHARES PURCHASED        TOTAL CONSIDERATION
                                       ----------------------   ------------------------     AVERAGE PRICE
                                          NUMBER      PERCENT       AMOUNT       PERCENT       PER SHARE
                                       ------------   -------   --------------   -------     -------------
<S>                                    <C>            <C>       <C>              <C>         <C>
Existing stockholders................    33,324,402     82.6%   $   61,924,000     23.7%        $  1.86
New investors........................     7,000,000     17.4       199,500,000     76.3           28.50
                                       ------------   -------   --------------   -------
     Total...........................    40,324,402    100.0%   $  261,424,000    100.0%
                                       ============   =======   ==============   =======
</TABLE>

In the discussion and tables above, we assume no exercise of outstanding options
to purchase shares of our common stock. As of December 31, 1999, there were
outstanding options to purchase a total of 3,183,920 shares of common stock at a
weighted average exercise price of $4.39 per share. To the extent that option
holders exercise their outstanding options, new investors will be further
diluted.

                                       22
<PAGE>
                      SELECTED CONSOLIDATED FINANCIAL DATA

This section presents our selected historical financial data. You should read
carefully the consolidated financial statements included in this prospectus,
including the notes to the consolidated financial statements. We do not intend
the selected data in this section to replace the consolidated financial
statements.

We derived the statement of operations data for the years ended December 31,
1997, 1998 and 1999, and balance sheet data as of December 31, 1998 and 1999
from the audited consolidated financial statements in this prospectus, which
Arthur Andersen LLP, independent public accountants, audited. We derived the
statement of operations data for the years ended December 31, 1995 and 1996 and
the balance sheet data as of December 31, 1995, 1996 and 1997 from our audited
consolidated financial statements that we have not included in the prospectus.

<TABLE>
<CAPTION>
                                                       YEAR ENDED DECEMBER 31,
                                       -------------------------------------------------------
                                         1995       1996       1997        1998        1999
                                       ---------  ---------  ---------  ----------  ----------
<S>                                    <C>        <C>        <C>        <C>         <C>
                                                (IN THOUSANDS, EXCEPT PER SHARE DATA)
STATEMENT OF OPERATIONS DATA:
Revenues.............................  $   6,957  $  15,017  $   8,939  $    2,422  $    1,405
Research and development.............      5,499      5,626      6,926      11,933      17,163
General and administrative...........      1,707      1,165      2,230       3,431       8,582
                                       ---------  ---------  ---------  ----------  ----------
Total operating costs and expenses...      7,206      6,791      9,156      15,364      25,745
                                       ---------  ---------  ---------  ----------  ----------
Income (loss) from operations........       (249)     8,226       (217)    (12,942)    (24,340)
Other income, net....................        470        433      1,045       1,240       1,028
                                       ---------  ---------  ---------  ----------  ----------
Income (loss) before income taxes....        221      8,659        828     (11,702)    (23,312)
(Provision) benefit of income
  taxes..............................        (10)    (1,922)      (198)      1,533         (34)
                                       ---------  ---------  ---------  ----------  ----------
Net income (loss)....................  $     211  $   6,737  $     630  $  (10,169) $  (23,346)
                                       =========  =========  =========  ==========  ==========
Earnings (loss) per share:
     Basic...........................  $    0.01  $    0.26  $    0.02  $    (0.35) $    (0.75)
                                       =========  =========  =========  ==========  ==========
     Diluted.........................  $    0.01  $    0.23  $    0.02  $    (0.35) $    (0.75)
                                       =========  =========  =========  ==========  ==========
Shares used in computing earnings
  (loss) per share:
     Basic...........................     26,215     26,215     27,909      29,105      31,113
     Diluted.........................     29,418     29,382     31,190      29,105      31,113
</TABLE>

<TABLE>
<CAPTION>
                                                           DECEMBER 31,
                                       -----------------------------------------------------
                                         1995       1996       1997       1998       1999
                                       ---------  ---------  ---------  ---------  ---------
<S>                                    <C>        <C>        <C>        <C>        <C>
                                                          (IN THOUSANDS)
BALANCE SHEET DATA:
Cash, cash equivalents and short-term
  investments........................  $  15,443  $  18,235  $  36,857  $  33,735  $  47,254
Working capital......................     13,847     15,575     35,871     34,323     42,718
Total assets.........................     18,147     25,871     44,831     43,422     55,328
Long term debt.......................      7,000      7,000      9,000     10,000     10,000
Retained earnings (deficit)..........     (4,313)     2,424      3,054     (7,115)   (30,461)
Total stockholders' equity...........      8,470     15,811     34,428     31,540     40,007
</TABLE>

                                       23

<PAGE>
                    MANAGEMENT'S DISCUSSION AND ANALYSIS OF
                 FINANCIAL CONDITION AND RESULTS OF OPERATIONS

YOU SHOULD READ THIS DISCUSSION TOGETHER WITH THE FINANCIAL STATEMENTS AND OTHER
FINANCIAL INFORMATION INCLUDED IN THIS PROSPECTUS.

OVERVIEW

Tanox identifies and develops therapeutic monoclonal antibodies to address
significant unmet medical needs in the areas of immunology, infectious diseases
and cancer. E25, our most advanced product in development, is an anti-IgE
antibody we are developing in collaboration with Novartis and Genentech. E25 has
successfully completed Phase III clinical trials in both allergic asthma and
seasonal allergic rhinitis (hay fever). Based on the results of these trials, in
mid-2000, our collaboration partners intend to file for marketing approval in
the United States and Europe for both indications. In addition, we are
developing a number of monoclonal antibodies to treat other allergic diseases or
conditions, such as severe allergic reactions to peanuts, autoimmune diseases,
HIV and neutropenia.

We currently have no products available for sale and are focusing on product
development, clinical trials and process development. We have incurred
substantial losses since inception and incurred an accumulated deficit through
December 31, 1999, of $30.5 million. We expect to continue to incur substantial
operating losses for the foreseeable future, particularly as we increase our
research and development, manufacturing, clinical trial and administrative
activities. We expect that losses will continue until such time, if ever, that
we generate sufficient revenue from royalties on E25 to cover our expenses.

Historically, we have earned revenues primarily from license fees, milestone
payments and sponsored research under our collaboration agreements. In the
future, we expect our principal revenues will be milestone payments, royalties
and profit-sharing payments from Novartis and Genentech. We may also receive
royalties from Hoffman-La Roche Ltd. should it participate in selling E25 in
Europe. Our revenues will depend particularly on the success of our
collaboration partners in developing, manufacturing, obtaining regulatory
approvals for and marketing E25. Because a substantial portion of our revenues
for the foreseeable future will depend on achieving development and
commercialization milestones, we anticipate that our results of operations will
vary substantially from year to year and even quarter to quarter.

RESULTS OF OPERATIONS

YEAR ENDED DECEMBER 31, 1999 COMPARED TO YEAR ENDED DECEMBER 31, 1998

REVENUES.  Revenues decreased to $1.4 million in 1999 from $2.4 million in 1998,
a decrease of $1.0 million. This decrease was primarily due to a difference of
$1.3 million in milestone and sponsored research revenues earned under our
agreements with Novartis and Genentech. These agreements accounted for 76% of
our revenues in 1999 and 98% of our revenues in 1998. The $1.3 million decrease
was partially offset by higher revenues of $0.4 million from foreign government
grants and technology licensing fees.

RESEARCH AND DEVELOPMENT EXPENSES.   Research and development expenses increased
to $17.2 million in 1999 from $11.9 million in 1998, an increase of $5.3
million. This increase was principally due to increased personnel, expansion of
preclinical and clinical development activities and a $2.7 million non-cash
charge resulting from extending the exercise periods for stock options to some
research and development employees and consultants. In addition, we incurred a
$3.4 million charge in 1999 and a $2.8 million charge in 1998 for in-process
research and development costs from the first two purchase payments made to the
former shareholders of PanGenetics B.V., a company we acquired in 1998. Please
see "Acquisition of PanGenetics B.V."

GENERAL AND ADMINISTRATIVE EXPENSES.  General and administrative expenses
increased to $8.6 million in 1999 from $3.4 million in 1998, an increase of $5.2
million. This increase was primarily attributable to recognizing an arbitration
award of $3.5 million to the attorneys who represented us in our litigation
against

                                       24
<PAGE>
Genentech, and a $1.9 million non-cash charge for stock-based compensation,
which was due to extending some employee and consultant stock options.

OTHER INCOME.  Other income decreased to $1.0 million in 1999 from $1.2 million
in 1998, a decrease of $0.2 million. This decrease was principally due to a
decline in interest income as a result of lower average cash balances and a loss
in 1999 on foreign currency transactions.

NET LOSS.  Net loss increased to $23.3 million in 1999 from $10.2 million in
1998.

YEAR ENDED DECEMBER 31, 1998 COMPARED TO YEAR ENDED DECEMBER 31, 1997

REVENUES. Revenues decreased to $2.4 million in 1998 from $8.9 million in 1997,
a decrease of $6.5 million. This decrease was due to a $4.0 million decline in
revenues from our agreements with Novartis and Genentech and a decline of $2.5
million in revenues from a former collaboration. Revenues from our collaboration
agreements with Novartis and Genentech accounted for 98% of our 1998 revenues
and 71% of our 1997 revenues.

RESEARCH AND DEVELOPMENT EXPENSES.  Research and development expenses increased
to $11.9 million in 1998 from $6.9 million in 1997, an increase of $5.0 million.
This increase was primarily due to expanding our research organization,
including $2.8 million of in-process research and development expenses
associated with purchasing PanGenetics in the first quarter of 1998.
Additionally, we incurred a $1.5 million charge in 1998 to license patents that
we may need to commercialize one of our products.

GENERAL AND ADMINISTRATIVE EXPENSES.  General and administrative expenses
increased to $3.4 million in 1998 from $2.2 million in 1997, an increase of $1.2
million. This increase was principally due to increased expenses associated with
our legal proceedings.

OTHER INCOME.  Other income increased to $1.2 million in 1998 from $1.0 million
in 1997, an increase of $0.2 million. This increase was primarily due to a $0.4
million increase in interest income due to higher average cash balances,
partially offset by a $0.2 million increase in interest expense.

NET LOSS/INCOME.  Net loss totaled $10.2 million in 1998, compared to net income
of $0.6 million in 1997.

LIQUIDITY AND CAPITAL RESOURCES

We have financed our operations since inception primarily through collaboration
and grant revenues, sales of equity securities, interest income and equipment
financing agreements. From inception through 1999, we recognized approximately
$59.3 million in collaboration, grant and other revenues. Additionally, we have
raised approximately $54.9 million from sales of equity securities and $1.5
million from the exercise of stock options, and we have earned approximately
$8.8 million of interest income. As of December 31, 1999, we had approximately
$47.3 million in cash, cash equivalents and short-term investments available for
working capital.

During 1999, we used $8.2 million to finance our operating activities. The
primary use of cash for operating purposes was our net loss of $23.3 million,
although $10.0 million of this amount was attributable to non-cash items. In
1999, changes in working capital were our primary source of cash from operating
activities, including a $2.0 million income tax refund and a $3.5 million
increase in accrued liabilities for the arbitration award. Our investing
activities generated $0.9 million in 1999. Financing activities generated $23.0
million in 1999, principally from selling our common stock. The combination of
the above items resulted in a cash increase of $15.9 million during the year.

During 1998, we used $6.5 million to finance our operating activities. The
primary use of cash for operating activities was $10.2 million to finance our
net loss, although the net loss included $4.8 million of non-cash items. In
1998, we used $1.2 million of cash for working capital. The primary use of cash
for working capital was a $1.6 million increase in taxes receivable from the
carry back of the 1998 net loss to prior years. Our acquisition of PanGenetics
did not have a material impact on working capital. Investing activities used
$6.2 million of cash in 1998, primarily for the purchase of short-term
investments, purchases of fixed assets and leasehold improvements and the
initial cash purchase payment for PanGenetics.

                                       25
<PAGE>
Financing activities generated $4.2 million in 1998, primarily from the sale of
common stock to private investors and $1.0 million from the proceeds of a note
payable to Novartis. As a result of the above items, our cash balance decreased
by $8.5 million during 1998.

Our current and anticipated development projects will require substantial
additional capital to complete. We anticipate that the amount of cash we need to
fund operations will grow substantially in the future as our projects move from
research to preclinical and clinical development. We also expect that we will
need to expand our administrative, clinical development, facilities and business
development activities to support the future development of our programs and to
support the ongoing requirements of a public company.

From 1994 through 1998, Novartis advanced us $10.0 million, pursuant to a loan
agreement to finance our new clinical manufacturing facility. The loan bears
interest at the London Interbank Offered Rate, or LIBOR, plus two percent (7.3%
and 8.1% at December 31, 1998 and 1999, respectively). Through December 31,
1999, because the facility is not yet operational, Novartis has agreed to
forgive interest on the loan. For the years 1997, 1998 and 1999, the interest
Novartis has forgiven has been reflected as interest expense and a capital
contribution. Although the loan is currently scheduled to be due in full on
December 31, 2005, Novartis may partially or totally forgive the principal and
future interest payments based on the future use of the facility.

From inception through December 31, 1999, we have invested approximately $11.6
million in property and equipment, primarily to support research and product
development activities and to construct our new clinical manufacturing facility.
We pledged all of the assets of the new clinical manufacturing facility as
security for the Novartis loan.

We have agreed to loan some employees up to $1.5 million in April 2000 to pay
tax obligations resulting from their stock option exercises in 1999.

At December 31, 1999, we had a net operating loss of approximately $6.6 million
for federal income tax reporting purposes, which begins to expire in 2019. We
also have a foreign net operating loss carryforward of approximately $5.2
million. Additionally, we have an unused U.S. research and development tax
credit carryforward of approximately $1.0 million, which begins to expire in
2011. Because we have incurred cumulative losses to date and there is no
assurance of future taxable income, we have established a valuation allowance to
fully offset the deferred tax asset at December 31, 1999.

We expect to incur substantial additional capital, research and development,
manufacturing and other costs as we continue to develop our products.
Consequently, we may need to raise substantial additional funds. We expect that
the net proceeds from this offering, together with our existing assets and
revenue from operations, will fund our operations for the next three years.
However, our future capital needs will depend on many factors, including
successfully commercializing E25, receiving payments from our collaboration
partners, progress in our research and development activities, the magnitude and
scope of these activities, the progress and level of unreimbursed costs
associated with preclinical studies and clinical trials, the costs and magnitude
of product or technology acquisitions, the cost of preparing, filing,
prosecuting, maintaining and enforcing patent claims and other intellectual
property rights, competing technological and market developments, changes in or
terminations of existing collaboration and licensing arrangements, the
establishment of additional collaboration and licensing arrangements, and
manufacturing scale-up costs and marketing activities, if we undertake those
activities. We do not have committed external sources of funding and we cannot
assure that we will be able to obtain additional funds on acceptable terms, if
at all. If adequate funds are not available, we may be required to:

  o    delay, reduce the scope of or eliminate one or more of our programs;

  o    obtain funds through arrangements with collaboration partners or others
       that may require us to relinquish rights to technologies, product
       candidates or products that we would otherwise seek to develop or
       commercialize ourselves; or

  o    license rights to technologies, product candidates or products on terms
       that are less favorable to us than might otherwise be available.

                                       26
<PAGE>
We are currently engaged in litigation and arbitration relating to a fee dispute
with the law firms that represented us in connection with the Genentech
litigation. An arbitration panel issued an award entitling the attorneys to
receive approximately $3.5 million, including interest, payments ranging from
33 1/3% to 40% of the future payments we would receive from Genentech following
product approval, and 10% of the royalties that we would receive on all sales of
anti-IgE products by Genentech and Novartis. We are contesting this award.
During the appeals process, we will either post a bond or place amounts in
escrow to secure payment of the award. See "Business -- Pending Legal
Proceedings."

ACQUISITION OF PANGENETICS B.V.

In March 1998, we purchased PanGenetics B.V., now our subsidiary Tanox Pharma
B.V., for an initial payment to its shareholders of $0.5 million in cash and
226,409 shares of our common stock, valued at $11.25 per share, for a total
initial consideration of $3.1 million. In addition, we agreed to pay future
consideration, in two installments, totaling up to $0.7 million in cash and
484,147 shares of our common stock upon occurrence of certain future events.

In September 1999, we paid the second installment of $0.3 million in cash and
242,075 shares of our common stock, valued at $12.50 per share, for a total
consideration of $3.4 million. If we make the final future payment as scheduled
in March 2001, we will record an additional purchase price amount based on the
cash paid and the fair value of the common stock issued at the time of payment.
If we make the final payment in March 2001, we will allocate the final payment
to acquired in-process research and development and goodwill based on the
appraisal obtained as of the date of the acquisition.

Tanox engaged an independent firm, KPMG LLP, to perform an appraisal of the
assets acquired in the transaction. The appraisal was completed and the report
issued in 1998. We accounted for the costs to acquire PanGenetics under the
purchase method of accounting. At the time of the acquisition, we valued the
total current and future consideration for accounting purposes at $9.2 million,
based on the total of the cash and then fair value of common stock paid, or
expected to be paid, to PanGenetics shareholders. Of this amount, we allocated
approximately $7.2 million to in-process research and development and $2.0
million to goodwill and other assets. See "Note 2 of the Notes to Consolidated
Financial Statements."

QUANTITATIVE AND QUALITATIVE DISCLOSURES ABOUT MARKET RISK

We are exposed to a variety of risks, including foreign currency exchange
fluctuations and changes in interest rates. In the normal course of business, we
have established policies and procedures to manage these risks.

FOREIGN CURRENCY EXCHANGE RATES.  During 1999, our operating results reflect
foreign exchange losses of $0.1 million and our balance sheet reflects a foreign
currency translation adjustment of $0.2 million. We are subject to foreign
currency exchange risk because:

  o    we invest in our foreign subsidiaries;

  o    we incur a significant portion of our costs and expenses and a smaller
       portion of our revenues in the local currencies of the countries where we
       do business; and

  o    we finance part of the cost of our subsidiaries' operations through
       dollar denominated inter-company loans and equity investments that are
       recorded on their books in the respective local currencies.

Fluctuations in exchange rates have not had a material impact on our revenues or
costs and expenses, but have affected the value of our equity investments and
inter-company loans. As a result of our international operations and our current
financing approach, fluctuations in exchange rates of the local currencies
versus the U.S. dollar impact our operating results. We are primarily exposed to
gains and losses with respect to Dutch guilders and Taiwan dollars because our
subsidiaries conduct business in these currencies. To date, we have not
implemented a program to hedge our foreign currency risk, but we may do so in
the future.

INTEREST RATE RISK.   Cash and short-term investments were approximately $47.3
million at December 31, 1999. These assets were primarily invested in investment
grade commercial paper which we hold to

                                       27
<PAGE>
maturity. We do not invest in derivative securities. Although our portfolio is
subject to fluctuations in interest rates and market conditions, no gain or loss
on any security would actually be recognized in earnings unless we sell the
asset. In addition, our loan from Novartis is based on a premium over LIBOR. As
such, if general interest rates increase, our interest costs will increase.

THE YEAR 2000

During 1998 and 1999, we had a Year 2000 Project (Y2K Project) in place to
address the potential exposures related to the impact on our computer systems
and scientific and manufacturing equipment containing computer-related
components for the Year 2000 and beyond. As of December 31, 1999, all scheduled
Y2K work was completed. As of the date of this prospectus, we have not
encountered any material Y2K system problems and we have not experienced any
impact on operations or expenses.

Nevertheless, we do use and rely on a wide variety of information technologies,
computer systems and scientific and manufacturing equipment containing
computer-related components (such as programmable logic controllers and other
embedded systems). As a result, time-sensitive functions of those software
programs and equipment may yet misinterpret dates after January 1, 2000, to
refer to the twentieth century rather than the twenty-first century. Although we
do not anticipate any material problems, we could suffer system or equipment
shutdowns, failures or miscalculations. Such conditions could result in
inaccuracies in computer output or disruptions of operations, including, among
other things, inaccurate processing of financial information and/or temporary
inabilities to process transactions, manufacture products, or engage in similar
normal business activities.

In addition, although all of our significant suppliers and our significant
service providers indicated that they were or expected to be Year 2000 compliant
by December 31, 1999, and although as of the date of this prospectus we are not
aware of any material Year 2000 compliance problems with these third parties'
systems, we cannot be certain that these third parties made accurate
representations or that their systems are or will continue to be Year 2000
compliant. If any of our significant suppliers or significant service providers
experience Year 2000 compliance problems and we cannot replace them with
alternate sources, our business would be harmed.

                                       28
<PAGE>
                                    BUSINESS

OVERVIEW

Tanox identifies and develops therapeutic monoclonal antibodies to address
significant unmet medical needs in the areas of immunology, infectious diseases
and cancer. In 1987, we discovered a novel approach for treating allergies and
asthma by using monoclonal antibodies capable of inhibiting IgE. E25, our most
advanced product in development is a genetically engineered monoclonal antibody
that attaches to, and inhibits, the activity of IgE. We are developing E25 in
collaboration with Novartis and Genentech for treatment of allergic asthma and
allergic rhinitis (hay fever). We estimate that in the United States, allergic
asthma afflicts approximately 11 million people, and allergic rhinitis afflicts
approximately 40 million people, of whom approximately 32 million are seasonal
sufferers. E25 has successfully completed Phase III clinical trials in allergic
asthma and seasonal allergic rhinitis patients. Based on the results of these
trials, our collaboration partners intend to file a BLA with the FDA
concurrently with European registration for both indications in mid-2000.

Using our extensive understanding of the human immune system, we are building a
diverse pipeline of monoclonal antibody product candidates. We are conducting
clinical trials with two additional monoclonal antibodies. Hu-901, an anti-IgE
antibody distinct from E25, is currently in a Phase I/II trial for treating
severe peanut allergy. 5D12, an anti-CD40 antibody, is currently in a Phase I/II
trial for treating Crohn's disease and in preclinical studies for treating other
autoimmune diseases. We are conducting preclinical and research studies with
5A8, an anti-CD4 antibody for treating HIV, 166-32, a complement factor D
inhibiting antibody for treating acute inflammation and 163-93, an anti-G-CSF
receptor activating antibody for treating neutropenia.

STRATEGY

Our objective is to leverage our expertise in monoclonal antibodies and
understanding of the human immune system to advance our product pipeline and
become a profitable biopharmaceutical company. We intend to accomplish this
through the following strategic initiatives:

  o    CONTINUING TO IDENTIFY AND DEVELOP NOVEL MONOCLONAL ANTIBODIES. We have
       focused on the research and development of monoclonal antibodies since
       our inception and have successfully identified and obtained patents for
       novel monoclonal antibodies with potential therapeutic applications. We
       believe that monoclonal antibodies will be one of the primary areas for
       pharmaceutical development for the foreseeable future, particularly as
       genomic research identifies novel disease targets. We will continue to
       apply our expertise in immunology to identify new antibodies that may
       bind to these novel targets. We will focus on diseases for which current
       therapies are substandard or unavailable and the market opportunities are
       large. With product candidates targeting autoimmune diseases, HIV,
       inflammation and cancer, we believe that we have a diverse monoclonal
       antibody product pipeline.

  o    MAXIMIZING THE MARKET OPPORTUNITY FOR ANTI-IGE ANTIBODIES. We are focused
       on identifying diseases and conditions for which anti-IgE antibodies are
       likely to provide a safe and effective therapy. In this regard, we intend
       to work with our partners, Novartis and Genentech, in establishing market
       awareness for E25 in asthma, allergic rhinitis and potential future
       indications targeted through the collaboration. Concurrently with this
       effort, we are pursuing the independent development of Hu-901 to
       demonstrate the efficacy of anti-IgE antibodies for indications our
       partners are not currently pursuing.

  o    IDENTIFYING ATTRACTIVE ACQUISITION AND IN-LICENSING CANDIDATES. In
       addition to our in-house development efforts, we will continue our
       efforts to identify opportunities to acquire or in-license products and
       technologies. We believe that we are well positioned to continue to
       attract in-licensing and acquisition candidates as a result of our
       demonstrated expertise in immunology and monoclonal antibodies. Our
       anti-CD40 and anti-CD4 programs are the result of in-licensing.

                                       29
<PAGE>
  o    FORMING STRATEGIC COLLABORATIONS TO SUPPORT DEVELOPMENT AND
       COMMERCIALIZATION OF OUR PRODUCTS. We often deem it advantageous to
       partner with large pharmaceutical and biotechnology companies to obtain
       funding and marketing support for our development activities. These
       collaborations generally:

       -   enable us to develop a greater number of products than otherwise
           would be possible;

       -   lower the substantial financial investment that is required of us to
           develop our products; and

       -   provide us with domestic and international marketing and sales
           expertise for our partnered products once approved.

    Under future collaborations, we expect to retain strategically important
    development, manufacturing or marketing rights in order to optimize the
    value of our drug development opportunities.

  o    RETAINING STRATEGIC MARKETING RIGHTS TO OUR PRODUCTS. As we pursue
       strategic collaborations, we intend to reserve strategic marketing rights
       for our products. We will focus initially on markets for which our
       products have a clear advantage over other therapies or that we can
       market using a relatively small, targeted sales force.

HUMAN IMMUNE SYSTEM

The human immune system has three general mechanisms that protect the body
against infections, toxins and cancer by responding to and clearing foreign
agents, or antigens, that have penetrated the body's protective barriers. These
mechanisms are:

  o    ANTIBODIES. The body produces proteins called antibodies that deactivate
       and help remove the antigens from the body. Each antibody matches an
       antigen much as a key matches a lock. Antibodies are made by specialized
       white blood cells called B cells, with the help of other white blood
       cells, called helper T cells. When a B cell encounters its triggering
       antigen, it manufactures millions of identical antibody molecules and
       releases them into the bloodstream.

  o    CELL-MEDIATED IMMUNE RESPONSE. The second protective immune mechanism
       relies on cells to recognize and destroy foreign antigens. This mechanism
       is known as cell-mediated immunity. T cells are important in
       cell-mediated immune responses. Some T cells, called killer T cells, seek
       out and kill cancer cells or virus-infected cells. Helper T cells also
       play a role in cell-mediated immune response by stimulating inflammatory
       cells called macrophages to actively destroy foreign antigens,
       microorganisms and cancer cells.

  o    INNATE IMMUNE RESPONSE. Innate immunity is the body's first line of
       defense against injury and infection and serves a surveillance and
       maintenance role. One part of the innate immune system involves large
       white blood cells called phagocytes (literally, "cell-eaters") that can
       engulf and digest foreign microorganisms and other antigens. Important
       phagocytes include macrophages, that rid the body of dead cells and other
       debris, and granulocytes, including neutrophils, that contain granules
       filled with potent chemicals. These chemicals, in addition to destroying
       microorganisms, play a key role in acute inflammatory reactions. Another
       part of the innate immune response is known as the complement system. The
       complement system includes a series of proteins that work to "complement"
       the activity of antibodies in destroying bacteria, either by stimulating
       the macrophages and neutrophils, or by puncturing the bacterial cell
       membrane to kill the cells. These proteins also cause the neutrophils to
       accumulate at the site of infection or tissue damage.

Most of the time, the immune system protects us from infections, cancer and some
toxic agents. However, sometimes the immune system actually causes the disease
or symptoms of the disease. For example, in the case of allergic diseases, such
as asthma and hay fever, the immune system responds to the antigen, or allergen
in this case, by producing an IgE form of antibody. IgE is instrumental in
triggering the symptoms of the disease. In other cases, T and B cells may
recognize a part of the body as foreign, triggering an immune response against
the body resulting in an autoimmune disease and associated tissue destruction.

MONOCLONAL ANTIBODIES AS THERAPEUTICS

Monoclonal antibodies represent an exciting area of novel therapeutic product
development. Genetically engineered monoclonal antibodies are man-made
antibodies that target a specific antigen. Most monoclonal antibodies are
derived from animals such as mice. Advances in antibody design technologies have
enabled

                                       30
<PAGE>
scientists to develop humanized (human-like) and fully human antibody products
that can be administered to patients on a chronic basis with reduced concern for
adverse responses by the human immune system. Advances in antibody production
technologies, such as high productivity fermentation and transgenic plants and
animals, have enabled manufacturers to produce antibody products more
cost-effectively. Because of these advances, a large number of monoclonal
antibodies are currently undergoing clinical and preclinical investigation.
According to a survey conducted by the Pharmaceutical Research and Manufacturers
of America, 74 out of 350, or 21% of all, biotechnology medicines in clinical
trials in 1998 were antibodies. The FDA has approved eight therapeutic
antibodies, six of them in the last three years, with total sales in 1999 in
excess of $1.3 billion.

Generally speaking, there are three basic methods for using monoclonal
antibodies as therapeutics. Each of the approaches described below capitalizes
on the monoclonal antibody's ability to precisely target selected receptors on
specific cells:

  o    BLOCKING CELL ACTIVITY AND IMMUNE FUNCTIONS -- monoclonal antibodies can
       be produced to bind to specific bioactive molecules or cell receptors to
       prevent undesirable cell responses, such as allergic reactions and
       autoimmune diseases.

  o    ACTIVATING CELL ACTIVITY AND IMMUNE FUNCTIONS -- monoclonal antibodies
       can be produced to bind to specific cell receptors in order to activate a
       desired cellular response.

  o    DELIVERING THERAPEUTIC AGENTS -- monoclonal antibodies bind to specific
       target receptors. Consequently, antibodies can be used to deliver active
       agents, such as radioactive isotopes and toxins, to specific cells and
       tissues targeted for destruction.

PRODUCT DEVELOPMENT PROGRAMS

We have three products in clinical development and are evaluating several
product candidates in preclinical and research studies. Our drugs target various
elements or malfunctions of the immune system, and all are monoclonal
antibodies. We have designed drugs to deactivate or reduce the activity of the
immune system for diseases caused by over-activation or inappropriate activation
of immune responses, such as autoimmune and allergic diseases and acute
inflammation. We also have designed drugs to activate the immune system for
treatment of diseases where boosting immune protection is desirable, such as
AIDS, infectious diseases and cancer. Our products have either resulted from our
internal research and development activities or were in-licensed or acquired.

The table below summarizes the development status for our principal product
candidates.

           ANTIBODY
PRODUCT   DESCRIPTION       INDICATION           STATUS            PARTNERS
- -------------------------------------------------------------------------------

E25      Anti-IgE         Allergic Asthma       Phase III     Novartis/Genentech
                                                Completed

                          Seasonal Allergic     Phase III     Novartis/Genentech
                          Rhinitis              Completed

Hu-901   Anti-IgE         Severe Peanut         Phase I/II           --
                          Allergy

5D12     Anti-CD40        Crohn's Disease       Phase I/II           --

                          Other Autoimmune      Preclinical          --
                          Diseases

5A8      Anti-CD4         HIV/AIDS              Preclinical          --

166-32   Anti-complement  Acute                 Research             --
         Factor D         Inflammation

163-93   Anti-G-CSF       Chemotherapy-Induced  Research             --
         Receptor         Neutropenia

Novartis and Genentech are disputing our rights to independently develop Hu-901.
We discuss the dispute in this prospectus in the section entitled
"Business -- Pending Legal Proceedings." In addition, we have the right to
develop and commercialize 5D12 only in Europe and Japan.

                                       31
<PAGE>
ANTI-IGE DEVELOPMENT -- E25

E25 is a humanized anti-IgE monoclonal antibody designed to prevent symptoms of
allergic asthma and allergic rhinitis. E25 works by preventing the ability of
allergens to activate the immune system. We are developing E25 in collaboration
with Novartis and Genentech. The product has successfully completed Phase III
clinical trials in both allergic asthma and seasonal allergic rhinitis. Our
partners intend to file a BLA with the FDA concurrently with European
registration for both indications by mid-2000. We expect E25 to be administered
by subcutaneous injections once or twice per month.

In allergic diseases, the immune system responds to the antigen, or allergen in
this case, by producing IgE. IgE binds to the surface of mast cells and
basophils. These cells, which are found in tissue and also circulate in the
blood, contain chemicals such as histamine and leukotrienes, which induce
inflammation. The first time an allergy-prone person is exposed to an allergen,
he or she makes large amounts of an IgE antibody specific to that allergen.
These IgE molecules attach to the surfaces of mast cells or basophils. When an
IgE antibody sitting on a mast cell or basophil next comes in contact with its
specific allergen, the IgE antibody signals the mast cell or basophil to release
its powerful chemicals, causing tissue inflammation and asthma and allergy
symptoms, including wheezing, bronchospasm, sneezing, runny nose, watery eyes
and itching. E25 blocks IgE from binding to mast cells and basophils, thereby
inhibiting the allergic response.

The diagram below shows how allergic reactions are triggered (The Allergy
Cascade) and how E25 works to prevent or reduce allergy symptoms (How E25
Works).

                                   [DIAGRAM]

                                       32
<PAGE>
MARKET OPPORTUNITY

Allergic reactions triggered by IgE include allergic rhinitis and allergic
asthma.

ALLERGIC RHINITIS.  Allergic rhinitis is a disease characterized by runny nose,
sneezing, congestion, itchy eyes and similar symptoms, and includes hay fever.
Allergic rhinitis afflicts at least 39.5 million people in the United States,
most of whom have seasonal allergies. In 1993, it was estimated that the total
cost associated with all forms of allergic rhinitis in the United States was
$3.4 billion. Doctors commonly treat the symptoms of allergic rhinitis with
antihistamines, decongestants, nasal steroids and other drugs. For many
patients, however, these medications do not completely alleviate the allergic
reactions or eliminate the symptoms. According to a 1997 study, only 26% of
treated allergic rhinitis patients reported symptoms as "well" or completely
controlled. Doctors sometimes prescribe allergy shots, called hyposensitization
therapy, for severely allergic persons to treat allergic rhinitis and systemic
allergic reactions. If the treating health care professional knows the allergen
to which the patient is reacting, hyposensitization can be effective. However,
it is difficult to identify which allergen causes the patient's allergy, and the
frequent and lengthy treatment protocols, as well as the potential for serious
adverse side effects, generally make hyposensitization undesirable.

ASTHMA.  Asthma makes breathing difficult and is potentially life threatening.
According to a 1998 report by the Centers for Disease Control, approximately 17
million people in the United States suffer from asthma. Published reports also
indicate that asthma's prevalence in the United States has increased 75% from
1980 to 1994. Approximately two-thirds of these patients have allergic asthma.
The American Lung Association estimates that over $9.8 billion is spent annually
on asthma-related costs in the United States. Corticosteroids and beta-agonists,
the mainstay of asthma therapy, are sometimes effective, yet each is associated
with specific safety drawbacks. Particular side effects of corticosteroid
treatment include growth retardation in children, osteoporosis and cataracts.
Beta-agonists offer only short-term relief and do not control the underlying
inflammation. Leukotriene modifiers, a new class of controller medications with
the potential to reduce steroid requirements, appear to be modestly effective
for some patients. However, these modifiers have been associated with drug
interactions and adverse events including liver injury. Increasing use of
beta-agonists indicates inadequate control of the underlying inflammation
causing asthma.

DEVELOPMENT STATUS AND CLINICAL DATA

SEASONAL ALLERGIC RHINITIS.  A Phase III clinical trial of E25 for seasonal
allergic rhinitis was conducted in Scandinavia during the spring 1998 birch
season. The randomized, placebo-controlled, multicenter clinical trial examined
symptoms of rhinoconjunctivitis and rescue medication usage in 251 adult and
adolescent patients with a history of birch pollen allergy. Patients were
treated with 300 mg of E25 or placebo via subcutaneous injection every three or
four weeks and treatment lasted eight or nine weeks. Patients received rescue
medications, such as antihistamines, when their symptoms were severe enough to
require additional medication. This Phase III clinical trial confirmed the
statistically significant results of an earlier pivotal Phase II trial in 536
patients conducted during the 1997 ragweed season in the United States. The
statistical significance of clinical results is determined by a widely-used
statistical method that establishes the par value, or p value, of the clinical
results. A par value of less than 0.01 (p<0.01) means that the chance of the
clinical results occurring by accident is less than 1 in 100.

Results from the Phase III seasonal allergic rhinitis trial were reported in May
1999 and showed that:

  o    E25 DECREASED THE SEVERITY OF NASAL AND OCULAR ALLERGY SYMPTOMS. Compared
       to placebo, E25 treatment improved average daily nasal (p<0.001) and
       ocular (p=0.031) symptom severity scores. Patients treated with placebo
       experienced recurring sneezing, itchy nose and similar symptoms that
       increased over the pollen season and were greatest during highest pollen
       exposure. In contrast, patients treated with E25 did not experience an
       increase in nasal symptoms over the whole E25 treatment period compared
       to symptoms reported before the pollen season began and before treatment
       began. 21% of patients treated with E25 reported complete control of
       symptoms and an additional 59% reported symptom control was improved
       compared to previous seasons. In addition, 6 of 7 patients

                                       33
<PAGE>
       who discontinued treatment because of unsatisfactory treatment effects
       were in the placebo group, even though there were twice as many patients
       receiving E25.

  o    E25 DECREASED USE OF RESCUE MEDICATION. Patients receiving E25 used an
       average 0.5 antihistamine tablets per day versus 1.3 tablets per day in
       the placebo group (p<0.001), and required rescue medication on half as
       many days (p<0.001). Increased use of rescue medication by placebo group
       patients may have blunted the difference in symptom scores reported.

  o    E25 IMPROVED PATIENTS' QUALITY OF LIFE. E25 treatment delivered
       clinically meaningful and statistically significant improvement over
       placebo in total rhinitis quality of life score (p < 0.001) and in the
       specific categories of activity limitations, nasal symptoms, non-nose and
       non-eye symptoms and practical problems. E25 treated patients also
       experienced improvements in sleep, eye symptoms and emotional state.

  o    E25 TREATMENT WAS SAFE AND WELL TOLERATED. In this and in the previous
       trials, no antibodies against E25 were detected and no serum sickness,
       immune complex disease, severe allergic reactions or other
       allergy-related side effects were reported. Less than two percent of
       patients experienced side effects of headache (1.8%) and upper
       respiratory infection (1.2%). Three subjects reported urticaria (skin
       itching and hives) following E25 injections (0.5% of all E25 injections).
       The incidence of adverse events was similar for the E25 and placebo
       groups.

The difference between placebo and E25 in all instances was statistically
significant. In addition, Novartis has announced the initiation of a Phase IV
evaluation in perennial (year-round) allergic rhinitis in the third quarter of
1999.

ALLERGIC ASTHMA.  Two Phase III clinical trials in allergic asthma have been
completed in the United States in adults (12-75 years) and children (6-12
years). The two randomized, placebo-controlled, multicenter clinical trials
included 525 patients in the adult study and 334 patients in the pediatric
study. Clinicians who participated in the Phase III clinical trials presented
the results at the American Academy of Allergy Asthma & Immunology meeting in
San Diego, California in March 2000.

In both trials, patients who were experiencing asthma symptoms, despite taking
inhaled corticosteroid therapy, were given either E25 or placebo via
subcutaneous injection every two or four weeks. Patients were monitored for
asthma exacerbations, which were defined as symptoms requiring a doubling of
inhaled corticosteroids or initiation of oral corticosteroids to maintain
adequate asthma control. These trials were conducted over 28 weeks in two
phases, followed by the following treatment extensions:

  o    a 16-week stable treatment period that monitored patients taking either
       E25 or placebo in addition to ongoing treatment with inhaled
       corticosteroids and rescue beta-agonists;

  o    a 12-week steroid reduction period (immediately following the stable
       treatment period), where the dosage of inhaled corticosteroids was
       gradually reduced in both the E25 and placebo groups; and

  o    a treatment extension so that long term safety could be evaluated for a
       one year period.

In patients receiving E25 versus placebo, the reduction in steroid dosage was
greater in both adults (p<0.001) and children (p=0.001).

In the 525 patient adult trial, steroid dosage was reduced at least 75% in half
of the patients receiving E25 compared to at least 50% in half of the patients
receiving placebo. The percentage of E25 patients experiencing asthma
exacerbations was reduced in both the stable treatment period and the steroid
reduction period. Additionally, the average daily dose of rescue medication
during this period was less in both treatment phases for the E25 group than for
the placebo group. During the stable treatment period, 14.6% (39 of 268
patients) of patients receiving E25 demonstrated asthma exacerbations compared
to 23.3% (60 of 257) of patients receiving placebo (p=0.009). During the steroid
reduction period, 21.3% (57 of 268) of patients receiving E25 experienced asthma
exacerbations compared to 32.3% (83 of 257) of patients receiving placebo
(p=0.026). Additionally, 40% (107 of 268) of patients receiving E25 completely
withdrew from inhaled corticosteroids during this period compared to 19% (49 of
257) of patients receiving placebo.

                                       34
<PAGE>
In the 334 patient pediatric trial, steroid dosage was reduced by 100% in more
than half of the patients receiving E25, compared to at least 71% in half of the
patients receiving placebo. The percentage of E25 patients experiencing asthma
exacerbations also was reduced during both the stable treatment period and the
steroid reduction period and the average daily dose of rescue medication was
less in both treatment phases for the E25 group than in the placebo group.
During the stable treatment period, 16% (35 of 225 patients) of patients
receiving E25 demonstrated asthma exacerbations compared to 23% (25 of 109) of
patients receiving placebo (p=0.095). During the steroid reduction period, 18%
(41 of 225) of patients receiving E25 experienced asthma exacerbations compared
to 39% (42 of 109) of patients receiving placebo (p<0.001). 55% (124 of 225) of
patients receiving E25 completely withdrew from inhaled corticosteroids during
this phase compared to 39% (43 of 109) of patients receiving placebo.

Results from the two trials showed that despite decreasing dosages of
conventional therapies, E25 treatment reduced the number of serious asthma
exacerbations. These studies corroborated results from an earlier Phase II
clinical trial in allergic asthma recently reported in THE NEW ENGLAND JOURNAL
OF MEDICINE. Headache and upper respiratory tract infection were the most
frequently reported adverse events. The incidence of adverse events during the
Phase III trials was similar in both the E25 and placebo groups. Safety data
from the five-month follow-up phase of the trials are pending.

Novartis and Genentech intend to file a BLA for E25 in the United States and to
concurrently file for registration in Europe in mid-2000 for both allergic
asthma and seasonal allergic rhinitis.

We and our collaboration partners have begun clinical development of E26, a
humanized anti-IgE monoclonal antibody with improved binding to IgE. Although
E26 may be several years behind the development of E25, we believe the product
may require lower doses to achieve the same clinical benefits as E25.

ANTI-IGE DEVELOPMENT -- HU-901

Hu-901 is a humanized anti-IgE monoclonal antibody that we are developing to
prevent symptoms of peanut induced anaphylaxis, a severe, potentially
life-threatening allergic reaction. Hu-901 binds IgE in a way similar to E25,
and is designed to prevent allergic reactions. At the initiation of our
collaboration with Novartis and Genentech in 1996, Novartis and we were
developing Hu-901, and Genentech was developing E25. We agreed with our
collaboration partners to select E25 for joint development primarily because
commercial-scale manufacturing capability existed for E25.

In July 1999, we initiated our first independent clinical trial with Hu-901. As
discussed in this prospectus under the heading "Business -- Pending Legal
Proceedings," Novartis and Genentech are contesting our right to independently
develop Hu-901. Regardless of the outcome, we believe that our development
program will highlight the potential for additional indications for the use of
anti-IgE antibodies and will encourage our partners to expand the development of
anti-IgE more rapidly into additional indications. If we lose the litigation, we
will terminate independent development of Hu-901.

MARKET OPPORTUNITY.  We believe anti-IgE antibodies, such as Hu-901, have
potential applications beyond asthma and allergic rhinitis in treating other
allergic reactions and diseases, including peanut and other food allergies. For
example, patients with severe peanut allergy suffer gastrointestinal, skin and
respiratory symptoms, and may also suffer potentially life-threatening
anaphylaxis in response to ingesting peanuts. According to a recently published
survey, peanut or tree nut (e.g., walnut, almond and cashew) allergy affects
about 3 million people in the United States, 1.1% of the U.S. population.
Current treatment is avoiding peanuts and peanut oil, which is used in preparing
many food products. Complete avoidance requires constant vigilance and is
difficult because prepared food labeling does not always identify peanut-derived
ingredients. Accidental exposures can result in serious allergic reactions and
sometimes death. Patients with severe peanut allergy take antihistamines for
accidental exposure and epinephrine for severe anaphylactic reactions.

                                       35
<PAGE>
Approximately 2 to 4% of children and 1 to 2% of adults in the United States
suffer from food allergies. If Hu-901 effectively reduces sensitivity to
peanuts, we may also investigate its use in other food allergies. There is no
approved preventive therapeutic for food allergies.

Another indication for possible treatment with our anti-IgE product is atopic
dermatitis, or eczema, a disease resulting in itching, blisters, redness,
swelling and scaling or hardness of the skin. Eczema correlates with higher IgE
levels and is prevalent in asthma patients. Severe eczema causes much distress
to patients and greatly impairs their quality of life. Eczema is usually treated
with skin hydration and topical steroids, and sometimes treated with
antihistamines. Some individuals resist conventional therapies or develop
unacceptable side effects. Eczema is the most common skin condition in children
under the age of eleven. The percentage of children diagnosed with eczema has
increased in the United States from 3% in the 1960s to 10% in the 1990s.

DEVELOPMENT STATUS.  We recently initiated a randomized, placebo-controlled,
multicenter Phase I/II trial with Hu-901. We designed the trial to determine the
extent to which Hu-901 treatment of patients with histories of severe reactions
to peanut products decreases sensitivity to eating small amounts of a peanut
preparation.

ANTI-CD40 DEVELOPMENT -- 5D12

5D12 is an anti-CD40 monoclonal antibody that we are developing for treatment of
autoimmune diseases. 5D12 blocks the CD40 pathway. The CD40 pathway enables B
cells to produce antibodies and regulates cellular immune responses, including
activation of macrophages and killer T cells. T and B cells sometimes recognize
a part of the body as "non-self," triggering an immune response against the
body that results in an autoimmune disease and associated tissue destruction. We
believe that 5D12 is the only antibody in clinical development that binds to
CD40 and inhibits cellular activation. We have exclusive rights to 5D12 in
Europe and Japan under a license from Chiron.

Preclinical studies have shown that interfering with the CD40 pathway may be
beneficial in treating autoimmune diseases, including multiple sclerosis and
lupus, and in preventing grafted organ rejection. 5D12 has potently inhibited
activation of B cells and macrophages in tissue culture systems. 5D12 also was
biologically active in preventing or delaying the appearance of clinical signs
and symptoms in a primate model for multiple sclerosis.

MARKET OPPORTUNITY.  Based on our research and preclinical studies with 5D12, we
believe the product could reduce production of antibodies and the activation of
cellular immune responses that cause autoimmune diseases. Examples of such
diseases and estimated potential market sizes in Europe and Japan include:

  o    Crohn's disease, an inflammatory disease of the bowel (over 165,000
       people);

  o    rheumatoid arthritis (approximately 3 million people);

  o    multiple sclerosis (approximately 200,000 people);

  o    lupus (approximately 320,000 people); and

  o    psoriasis (approximately 1 million people).

DEVELOPMENT STATUS.  We have initiated a 20 patient Phase I/II clinical study
with 5D12 in Crohn's disease in Europe. The trial is a single dose,
dose-escalating study designed to provide data regarding the safety of the
product, its behavior, including half-life and clearance characteristics, and
its biological activity using histological examination of biopsy tissue. We
expect the results of this study to play an important role in determining
clinical indications that we will pursue with 5D12.

                                       36
<PAGE>
ANTI-CD4 DEVELOPMENT -- 5A8

5A8 is a humanized anti-CD4 monoclonal antibody that is in preclinical
development to treat human immunodeficiency virus, or HIV. The virus enters the
host cell by binding to the CD4 receptors on these cells. In lab studies, our
5A8 antibody binds to the CD4 receptor on the cell surface and prevents viral
entry into the cell, thereby blocking infection. We have exclusive worldwide
rights to 5A8 through a license with Biogen.

MARKET OPPORTUNITY.  According to the World Health Organization, HIV infects
approximately 1.4 million people in North America and Western Europe. A number
of drugs targeting viral replication are being used, often in combination. About
30% of the patients treated with drug combinations, however, no longer respond
since HIV has become drug resistant. In addition, many drug combinations produce
a variety of undesirable toxic side effects.

DEVELOPMENT STATUS.  5A8 is now in preclinical development to determine its
usefulness to treat HIV-infected patients. In preliminary preclinical testing,
5A8 has potently blocked infections in all twenty-five strains of primary HIV
isolates tested in cell culture. In a primate model for HIV infection, 5A8
showed robust antiviral activity. Preclinical tests with our 5A8 antibody showed
no reduction in CD4-positive cell numbers, no evidence that any function of the
immune system was suppressed and no toxic effects.

OTHER PRODUCT CANDIDATES

ANTI-FACTOR D DEVELOPMENT.  166-32 is a monoclonal antibody that binds to Factor
D, a component of the complement system, and is in research to treat acute
inflammation. The complement system is the body's first line of defense against
infection. 166-32 binds to Factor D and inhibits complement activation.

While the complement system generally functions to protect the body, complement
system activation can become excessive and uncontrolled resulting in
inflammation and tissue damage. This can occur in cases of acute tissue injury
or surgical procedures that reduce blood flow into a tissue. In addition, during
heart surgery involving cardiopulmonary bypass (CPB), the shunting of blood
outside the body for circulation through mechanical devices has been shown to
activate complement and result in tissue injury. Research studies with 166-32 in
laboratory models for heart injury showed that low levels of 166-32 prevented
heart damage, and that 166-32 inhibited complement activation in a model for
CPB.

ANTI-G-CSF RECEPTOR DEVELOPMENT.  163-93 is a monoclonal antibody that binds to
the receptor for granulocyte colony stimulating factor (G-CSF) to treat a
condition known as neutropenia, which often afflicts cancer patients who have
undergone chemotherapy. Neutropenia is a deficiency of a type of granulocyte (a
specialized white blood cell that contains granules filled with potent
chemicals) called neutrophils, which results in a compromised immune system and
susceptibility to infection. Granulocytes engulf and destroy bacteria and other
microbial pathogens. G-CSF binds specific receptors on the surface of
granulocytes and stimulates their proliferation and controls their activities.
Recombinant G-CSF is sold by Amgen as Neupogen and has been used in cancer
patients to help restore their immune protection. Amgen reported 1999 sales of
$1.3 billion for Neupogen.

We are developing 163-93 to stimulate proliferation and activity of granulocytes
just as does G-CSF. 163-93 activates the same intracellular signaling pathway as
G-CSF and supports the production of granulocytes from human bone marrow as does
G-CSF. In a preliminary study, injecting 163-93 into primates stimulated
granulocyte production without affecting any other blood cells or causing any
toxicity. We believe that 163-93 could provide an alternative to G-CSF for
therapeutic use in cancer patients during chemotherapy and may have the
advantage of less frequent dosing.

ADDITIONAL PRODUCTS IN RESEARCH AND DEVELOPMENT.  We have additional discovery
research projects directed towards developing new products and technologies to
treat immunological diseases and cancer.

                                       37
<PAGE>
COLLABORATION AND LICENSING AGREEMENTS

COLLABORATION WITH NOVARTIS AND GENENTECH.  We are developing our lead product,
E25, in collaboration with Novartis and Genentech. In 1990, we established a
collaboration with Novartis to jointly develop anti-IgE antibodies to treat
allergic diseases. In 1996, Genentech joined our collaboration with Novartis and
we agreed to combine our respective anti-IgE development programs in a
three-party collaboration. We and our collaboration partners selected E25 as the
lead product for development and commercialization.

Currently, under the terms of the collaboration agreements:

  o    DEVELOPMENT. Novartis and Genentech are responsible for completing the
       development of and obtaining the regulatory approval for E25 and the
       other anti-IgE products developed through the collaboration. Novartis and
       Genentech share all development costs relating to E25 and other anti-IgE
       products that the collaboration may select for development in the United
       States and Europe. We and Novartis equally share development costs
       relating to China, Hong Kong, Korea, Singapore and Taiwan. Novartis is
       responsible for development costs in the rest of the world.

  o    MANUFACTURING. Novartis and Genentech are responsible for manufacturing
       E25 and other selected anti-IgE products worldwide, subject to our right
       to manufacture up to 50% of the worldwide requirements of those products.

  o    MARKETING. Novartis and Genentech share U.S. marketing rights, and
       Novartis has marketing rights in Europe (with Roche retaining the option
       to participate in Europe) to products developed through the
       collaboration. Novartis is responsible for marketing these products in
       the rest of the world, including China, Hong Kong, Korea, Singapore and
       Taiwan.

  o    PAYMENTS. We may receive payments of up to $63.5 million based on
       completing development and marketing objectives for E25, $6.5 million of
       which we have already received. We may also receive payments of up to
       $14.0 million based on completing development objectives for E26, $1.0
       million of which we have already received. Our next payments totaling $12
       million are due on filing the E25 BLA.

  o    ROYALTIES AND PROFIT SHARING. We may receive royalties based on net sales
       of E25 and other selected anti-IgE products in the United States and a
       share of Novartis' profits on these sales. We also may receive royalties
       on net sales of E25 and other selected anti-IgE products in Europe and
       the rest of the world (except for China, Hong Kong, Korea, Singapore and
       Taiwan) and an equal share of Novartis' profits from sales of E25 and
       other selected anti-IgE products in China, Hong Kong, Korea, Singapore
       and Taiwan.

Our rights to the full amount of the payments, royalties and profits that we
receive could be affected by the on-going legal proceedings with our former
attorneys described under "Business -- Pending Legal Proceedings."

The collaboration agreements provide that we may independently develop, without
our collaboration partners, any anti-IgE product that the partners are not
developing through the collaboration. If we choose to independently develop a
product, Novartis has a right of first refusal on the licensing of that anti-IgE
product. As described in this prospectus under the heading "Business -- Pending
Legal Proceedings," we are currently involved in a dispute with our
collaboration partners regarding our rights to independently develop Hu-901 and
our right to use certain know-how and other information in our independent
development efforts.

Roche has an option to participate in commercializing E25 and other anti-IgE
products which the collaboration selects for development in Japan and Europe.
Roche may exercise this option if specified events relating to commercializing
the product occur. Roche has waived this option for E25 in Japan. In addition,
Roche has an option to assume Genentech's position in the collaboration if
Genentech withdraws from the collaboration, as described below.

Either Novartis or Genentech may withdraw from the collaboration on short
notice. If either Novartis or Genentech withdraws, rights to E25 and any other
products developed by the collaboration (including by

                                       38
<PAGE>
the withdrawing partner) revert to us and the remaining collaborator and, if
Genentech is the withdrawing party, to Roche if Roche exercises the option
described above. If the collaboration is dissolved in its entirety, we would
continue to retain rights to develop anti-IgE antibodies under the terms of
separate agreements with Novartis and Genentech.

In addition to the collaboration agreements, we and Genentech entered into a
cross-license agreement under which each party has an option to license the
other party's patents relating to the development of anti-IgE antibodies for use
in developing specific products. This option may be exercised at any time if
either party chooses to independently develop a product as permitted under the
collaboration agreements, if our collaboration with Novartis and Genentech
terminates or if we and Genentech may mutually agree.

OTHER COLLABORATIONS AND LICENSE AGREEMENTS

CHIRON LICENSE.  In 1998, our European subsidiary Tanox Pharma, B.V. entered
into an agreement to license from Chiron exclusive research and development
rights (except as to Chiron) to Chiron's murine monoclonal antibodies against
CD40. Subject to our obligations to develop an anti-CD40 product and, under
certain circumstances, to pay maintenance fees, we have an option to obtain a
commercial license to Chiron's anti-CD40 antibodies, patents and technology for
Europe and Japan. Chiron retains its commercial rights in the United States and
the rest of the world. Additionally, Chiron has an option to obtain a commercial
license for the United States and the rest of the world outside Europe and Japan
to use anti-CD40 patents and technology that Tanox Pharma develops. Chiron has
two awarded U.S. patents and has patents pending in Europe, Japan and Canada.

Upon registering a product in Japan, the United Kingdom, France or Germany,
Tanox Pharma has agreed to pay Chiron a registration fee and royalties based on
its European and Japanese sales. Tanox Pharma has also agreed to pay Chiron a
milestone payment if Tanox Pharma develops and commercializes a product. Chiron
has agreed to pay us royalties based on its sales in the United States and the
rest of the world. We may make a $1.0 million product development milestone
payment, in addition to royalty payments under this agreement. The license
terminates on the later of the expiration of 10 years following the first
commercial product sale or the expiration of the last to expire of licensed
patents. The currently licensed patent expires in 2013.

BIOGEN.  In 1998, we entered into an agreement to license from Biogen its
anti-CD4 monoclonal antibody and intellectual property on an exclusive worldwide
basis with limited sublicense rights. Biogen owns issued U.S. and European
patents and has pending applications in Australia, Canada and Japan. We paid
Biogen a license fee and agreed to make additional development milestone
payments and royalty payments to Biogen based on annual net sales revenue
levels. Additionally, we agreed to make milestone payments to Biogen that
increase as product development continues and if specified corporate development
events occur. In addition to royalty payments, we may make up to an aggregate of
$10.4 million in product development milestone payments under this agreement.
The license terminates on a country-by-country basis on the later of the
expiration of 12 years following the first commercial product sale or the
expiration or invalidity of applicable patents. The licensed patents expire in
Europe in 2011 and in the United States in 2016.

BIOVATION.  We entered into an agreement in 1999 with Biovation Limited of
Aberdeen, United Kingdom, to apply Biovation's proprietary deimmunization
technology to certain of our monoclonal antibodies and protein products.
Biovation also licensed the patents needed to develop and commercialize any
deimmunized monoclonal antibodies it developed, and if the deimmunized
monoclonal antibodies meet certain criteria, we will pay royalties to Biovation.
Additionally, Tanox Pharma and Biovation have agreed to jointly develop their
respective protein engineering technologies. We paid Biovation a license fee
that will decrease if Biovation products transferred to us under the agreement
do not achieve certain specifications. In addition to royalty payments, we may
make up to an aggregate of $1.3 million in product development milestone
payments under this agreement. The license terminates on the earlier of 10 years
from the first commercial product sale, a formal determination that any licensed
patents are invalid or unenforceable or such patents have expired. Biovation has
filed a patent application for the licensed technology; if a patent issues under
the application, it will expire in 2018.

                                       39
<PAGE>
PATENTS AND PROPRIETARY RIGHTS

We pursue patent protection for our proprietary technology and products. We
typically file U.S. patent applications, then international treaty applications,
usually followed by filing foreign patent applications on our technology and
products in those regions or countries where business considerations warrant
filings. These countries include Japan, Canada, Australia, countries of the
European Union, other European countries, and certain other Asian countries.

We have five U.S. patents that cover and/or relate to the use of anti-IgE and
other allergy/asthma products. We also hold patents in Europe, Canada, Japan,
Singapore, Hong Kong and Australia covering such products. We have additional
anti-IgE patents pending in the United States and internationally. Some of our
patents are co-owned with Novartis. We also cross license Genentech's patents
covering anti-IgE products.

We have filed U.S. and international patent applications relating to anti-Factor
D antibodies and anti-G-CSF receptor antibodies. We anticipate filing
corresponding national phase applications in selected jurisdictions at the
appropriate time. We have a number of other U.S. and foreign patents covering
certain other proprietary technology and products, with over forty U.S. patents
granted to date. Our issued patents expire between 2008 and 2014. We cannot
assure you that one or more of the patents noted above would not be rescinded,
held invalid, successfully opposed or revoked or narrowed or held unenforceable.

Patenting biotechnology-related products and processes can involve uncertain and
complex legal and factual questions and, to date, policies regarding the breadth
of claims allowed in biotechnology patents are not necessarily consistent.
Patents, if issued, may be challenged, invalidated, limited in their scope of
coverage, circumvented or held unenforceable. Thus, any patents that we own or
license from third parties may not provide any protection against competitors.
Our pending patent applications, those we may file in the future, or those we
may license from third parties, may not result in patents being issued. Also,
patent rights may not provide us with proprietary protection or competitive
advantages against competitors with similar technology or different technology.
Furthermore, others may independently develop similar technologies or duplicate
any technology that we have developed. Moreover, the laws of certain foreign
countries do not protect our intellectual property rights to the same extent as
do the laws of the United States.

Litigation may be necessary to enforce any patents issued or licensed to us or
to determine the scope and validity of these patents. We could incur substantial
costs and divert technical and management personnel's time and attention if we
must participate in litigation or if we must defend ourselves against patent
suits against us. If the outcome of litigation is adverse to us, third parties
may be able to use our patented invention without paying us. Moreover, we cannot
assure you that our patents will not be infringed or successfully avoided
through design innovation. Any of these events may materially and adversely
affect our business.

In addition, other companies, some of which may be our competitors, have filed
applications for or have been issued patents, and may obtain additional patents
and proprietary rights, relating to products or processes used in, necessary to,
competitive with or otherwise related to our patents and products. These
products and processes include, among other items, patents covering technology
relating to the type of humanized monoclonal antibodies that we anticipate
developing. Protein Design Labs, Inc. owns certain patents and patent
applications relating to these humanized antibodies. We have recently acquired
the right to take non-exclusive licenses to these patents and patent
applications for up to four of our products. We have agreed to pay license fees
of $2.5 million in addition to $1.5 million that we paid Protein Design Labs
under a previous agreement. In addition, we will pay approximately $4.0 million
if we exercise our option to license all four antibodies. We do not know if
licenses from Protein Design Labs will be available for our other antibody
products. The Medical Research Council also owns patents relating to humanized
antibodies, for which we hold a non-exclusive license. Our license permits us to
humanize our murine monoclonal antibodies. In addition to our obligation to pay
royalties on net sales of our products incorporating licensed technology, we
paid a license fee of approximately $.05 million. Our Medical Research Council
license also includes a sublicense to the Boss patent relating to antibody
co-expression owned by Celltech, Ltd. Genentech has a pending application (the
Cabilly Application) that is involved in an interference before the U.S. Patent
& Trademark Office with the Celltech Boss patent.

                                       40
<PAGE>
We may also develop products that are chimeric antibodies. Genentech owns a
patent (the Cabilly Patent) relating to chimeric antibodies and instituted suit
against us in 1994 claiming that we infringed this patent. We settled the
lawsuit and, pursuant to the settlement, we acquired a non-exclusive license to
the Cabilly Patent, the Cabilly Application and other Genentech patents (or
patents to which Genentech has a license and is free to grant a sublicense)
relating to our anti-IgE antibody products. We also have certain rights to
acquire a non-exclusive license from Genentech for the Cabilly Patent, the
Cabilly Application and certain other Genentech patents for products not
exclusively or co-exclusively licensed by Genentech to a third party and for
certain products that do not compete with those of Genentech or its affiliates.
In addition, other parties also own patents covering chimeric and/or deimmunized
antibodies and/or processes applicable to making these antibodies.

In addition, we hold a non-exclusive license to certain patents and patent
applications, including two U.S. patents, owned by Immunex Corporation, relating
to the G-CSF receptor. The patents and applications cover certain reagents that
may be involved in making our anti-G-CSF receptor antibodies and other products
we are developing, under which we must pay license execution and maintenance
fees and milestone payments for developed product aggregating up to $2.2 million
in addition to continuing royalties on net sales of the products.

The scope, enforceability and validity of these patents, the extent to which we
must obtain licenses under these patents or under other proprietary rights and
the cost and availability of licenses are unknown, but these factors may limit
our ability to market our products. Moreover, even if a license were available,
the payments that would be required could render uneconomic our efforts to
market certain of our products. If we elect to manufacture or market these
products without either a license or a favorable result in litigation, damages
could be assessed that could be materially adverse to us. Further, failure to
obtain a license could result in an injunction prohibiting us from manufacturing
or selling the affected lines of products.

In addition to patents, we rely on trade secrets and proprietary know-how. We
seek protection, in part, through confidentiality and proprietary information
agreements. These agreements may not provide meaningful protection or adequate
remedies for our technology if unauthorized use or disclosure of this
information occurs. The parties to these agreements may breach them.
Furthermore, our trade secrets may otherwise become known to, or be
independently developed by, our competitors.

We require our employees, directors, consultants, advisors, outside scientific
collaborators and sponsored researchers and other advisors to execute
confidentiality agreements on commencing an employment, consulting or other
contractual relationships with us. These agreements provide that all
confidential information developed or made known to the individual during the
course of the relationship is to be kept confidential and not disclosed to third
parties except in specific circumstances. In the case of employees and certain
other parties, the agreements provide that all inventions conceived by the
individual shall be our exclusive property. We cannot assure you, however, that
these agreements will provide meaningful protection for our confidential
information or trade secrets against or in the event of unauthorized use or
disclosure of such information.

GOVERNMENT REGULATION

Producing and marketing our products and our research and development activities
are subject to regulations relating to product safety and efficacy by numerous
governmental authorities in the United States and other countries. In the United
States, drugs are subject to rigorous FDA regulation. The Federal Food, Drug and
Cosmetic Act and other federal and state statutes and regulations govern, among
other things, the testing, manufacture, safety, effectiveness, labeling,
storage, record keeping, approval, advertising and promotion of our products.

Before we may market a pharmaceutical product in the United States, the FDA
requires us to complete the following steps:

  o    preclinical laboratory and animal tests;

  o    submission to the FDA of an investigational new drug application, or IND,
       which must become effective before human clinical trials may commence;

                                       41
<PAGE>
  o    adequate and well controlled human clinical trials conforming with good
       laboratory and clinical practices to establish the safety and efficacy of
       the product;

  o    submission to the FDA of a New Drug Application, or NDA, with respect to
       drugs, and a BLA with respect to biological products; and

  o    FDA approval of the NDA or BLA before any commercial sale or shipment of
       the product.

In addition, the FDA requires the registration of each drug and approval of each
manufacturing establishment. For our monoclonal antibody products we are subject
to the simplified, interim procedure for well-characterized biologicals.
Domestic manufacturing establishments are subject to FDA inspection and must
comply with current good manufacturing practices, or cGMP, for pharmaceutical
products. To supply products for use in the United States, foreign manufacturing
establishments must comply with cGMP and are subject to periodic FDA or other
regulatory authority inspection under reciprocal agreements with the FDA.

Preclinical tests include laboratory evaluation and animal studies to assess the
potential safety and efficacy of the product and its formulation. To comply with
FDA regulations, laboratories must conduct these preclinical safety tests
according to Good Laboratory Practices. The results of the preclinical tests are
submitted to the FDA as part of an IND, and the FDA reviews the results before
the commencement of human clinical trials. Unless the FDA objects, the IND will
become effective 30 days following its receipt. There is no certainty that
submission of an IND will result in FDA authorization to commence clinical
trials. If we will ship a biological product produced within the United States
to a foreign country for clinical trials, the product must comply with export
regulations promulgated by the FDA before shipment.

Human clinical trials involve the administration of the investigational compound
to patients or other volunteers under the supervision of a qualified principal
investigator. Clinical trials are conducted in accordance with protocols that
detail the objectives of the study, the parameters to be used to monitor safety
and the efficacy criteria to be evaluated. Each protocol must be submitted to
the FDA as part of the IND. Further, each clinical study must be conducted under
the auspices of an independent institutional review board, or IRB, at the
institution where the study will be conducted. The IRB will consider, among
other things, ethical factors, the safety of human subjects and the possible
liability of the institution.

Clinical trials are typically conducted in four sequential phases, which may
overlap. In Phase I, the initial introduction of the product into human
subjects, the product is tested for safety (adverse effects), dosage tolerance,
metabolism, distribution, excretion and clinical pharmacology. Phase II involves
studies in a limited patient population:

  o    to determine the efficacy of the product for specific, targeted
       indications;

  o    to determine dosage tolerance and optimal dosage; and

  o    to identify possible adverse effects and safety risks.

When a product is found to be effective and to have an acceptable safety profile
in Phase II evaluations, Phase III trials are undertaken:

  o    to continue to evaluate clinical efficacy; and

  o    to test further for safety within an expanded patient population at
       geographically dispersed clinical study sites.

We cannot assure you that we will successfully complete clinical testing of our
products within any specified time period, if at all. Furthermore, the FDA or we
may suspend clinical trials at any time if it is felt that the subjects or
patients are being exposed to an unacceptable health risk. Phase IV studies are
typically done post-FDA approval to address safety issues not addressed in the
Phase I/II/III programs, for example, chronic use of the product.

In the case of agents for life-threatening diseases, the initial human testing
is generally done in patients rather than in healthy volunteers. Since these
patients already are afflicted with the target disease, it is possible that
these studies may provide results traditionally obtained in Phase II trials,
potentially expediting the approval process. These trials are frequently
referred to as "Phase I/II" trials.

                                       42
<PAGE>
The results of the pharmaceutical development, preclinical studies and clinical
studies are submitted to the FDA in the form of an NDA or BLA to approve
marketing and commercial shipment of the product. The testing and approval
process frequently requires substantial time and effort and we cannot assure you
that any approval will be granted on a timely basis, if at all. The FDA may deny
an NDA or BLA if applicable regulatory criteria are not satisfied, require
additional testing or information or require postmarketing testing and
surveillance to monitor the safety and efficacy of the product. Notwithstanding
the submission of this data, the FDA may ultimately decide that the application
does not satisfy its regulatory criteria for approval. Finally, product
approvals may be withdrawn if compliance with regulatory standards is not
maintained or if problems occur following initial marketing.

Among the conditions for NDA or BLA approval is that the prospective
manufacturer's quality control and manufacturing procedures conform to cGMP. In
complying with standards set forth in these regulations, manufacturers must
continue to expend time, monies and effort in the area of production and quality
control to ensure full compliance.

In addition to FDA regulations, we are subject to regulation under the
Occupational Safety and Health Act, the Environmental Protection Act, the Toxic
Substances Control Act, the Resource Conservation and Recovery Act and other
present and future federal, state or local regulations.

For marketing outside the United States, we also are subject to foreign
regulatory requirements governing human clinical trials and marketing approval
for pharmaceutical products. The requirements governing the conduct of clinical
trials, product licensing, pricing and reimbursement vary widely from country to
country. Whether or not we obtain FDA approval,we must obtain approval of a
product by the comparable regulatory authorities of foreign countries before
manufacturing or marketing the product in those countries. The approval process
varies from country to country and the time required for these approvals may
differ substantially from that required for FDA approval. We cannot assure you
that clinical trials conducted in one country will be accepted by other
countries or that approval in one country will result in approval in any other
country. For clinical trials conducted outside the United States, the clinical
stages are comparable to the phases of clinical development established by the
FDA.

COMPETITION

The pharmaceutical and biotechnology industries are characterized by rapidly
evolving technology and intense competition. Many companies, including major
pharmaceutical and chemical companies, as well as specialized biotechnology
companies, perform activities similar to ours. Many of these companies have
substantially greater financial and other resources, larger research and
development staffs and more extensive marketing and manufacturing organizations
than ours. Many of these companies have significant experience in preclinical
testing, human clinical trials and other regulatory approval procedures.
Consequently, we chose to enter into the collaboration agreements with Novartis
and Genentech, in part to secure the benefit of their experience in these areas,
as well as the contribution of their greater financial resources. In addition,
colleges, universities, governmental agencies and other public and private
research organizations conduct research and may market commercial products on
their own or through joint ventures. These institutions are becoming more active
in seeking patent protection and licensing arrangements to collect royalties for
using technology that they have developed. We compete with these institutions in
recruiting and retaining highly qualified scientific personnel.

The diseases that we have targeted, including allergic diseases, autoimmune
diseases, transplantation, cancer, inflammation, and HIV infection, are
intensely competitive areas targeted by both pharmaceutical companies and other
biotechnology companies, including our collaborators, Novartis and Genentech.
All of these companies may have competitive products on the market, may be
testing their products in clinical trials or may be focusing on product
approaches that could prove to be superior to our approaches. For instance, we
are aware that some of these companies, which may be our competitors, have filed
applications for or have been issued patents and may obtain additional patent
and proprietary rights relating to products or processes used in, necessary to,
competitive with or otherwise related to, our products or processes. These
patents include, among other items, patents relating to humanized monoclonal
antibodies.

                                       43
<PAGE>
Additionally, our competition will be determined in part by the potential
indications for which our antibodies are developed and ultimately approved by
regulatory authorities. For some of our potential products, an important factor
in competition may be the timing of market introduction of our products or
competitive products. Accordingly, we expect the relative speed with which we
develop our products, complete the necessary approval processes and are able to
generate and market commercial quantities of the products to be important
competitive factors. We expect that competition among products approved for sale
will also be based, among other factors, on product efficacy and safety, timing
and scope of regulatory approval, product availability, advantages over
alternative treatment methods, price and cost-effectiveness, development,
distribution and marketing capabilities, third-party reimbursement and patent
position.

We are aware that several companies, including Novartis, have existing products
that will compete with E25, if it is approved for sale, including
corticosteriods, beta-agonists, antihistamines, leukotriene inhibitors and
allergen immunotherapy. In addition, several companies have products in
development that may compete with E25. These companies include, but are not
limited to, IDEC (Anti-CD23), Immunex (sIL-4R), CellTech/Schering-Plough
(Anti-IL5), Merck/Biogen (VLA-4 inhibitors), Magainin/Genentech (anti-IL-9) and
Protein Design Labs (Anti-IL4).

Our competitive position also depends upon our ability to:

  o    attract and retain qualified personnel;

  o    obtain patent protection or otherwise develop proprietary products or
       processes;

  o    discover new therapeutic products that successfully treat human diseases;

  o    secure sufficient capital resources to complete product development and
       regulatory processes;

  o    build or obtain manufacturing facilities; and

  o    build or obtain a sales organization.

MANUFACTURING

We have a small-scale production and purification facility in which we have
produced our products in compliance with cGMP standards for use in Phase I
and/or Phase II clinical trials. With funding from Novartis, we recently
completed construction of a pilot manufacturing facility that we may use for
larger-scale process development and cGMP production of animal cell culture
derived products. The facility includes a 1500L bioreactor and occupies
approximately 14,000 square feet of space now under lease to us in Houston,
Texas. The new manufacturing facility is not yet operational, and the Company is
pursuing required cGMP validation. While the facility is not yet operational, we
are not obligated to repay our $10.0 million loan from Novartis, and Novartis
has agreed to forgive our accrued interest obligations under the loan. If the
facility becomes operational within a five year period, we will make interest
and principal payments on the loan in amounts equal to 75% of net cash flow from
the plant. The facility is available to both us and other companies for
production of monoclonal antibodies and other biologic products for large-scale
clinical trials and initial market launch.

Under our agreements with Novartis and Genentech, Novartis and Genentech must
manufacture E25 and any other anti-IgE products selected by us and our
collaboration partners for development, although we have retained the right to
manufacture and supply up to 50% of the worldwide requirements for E25 and the
other selected products. Genentech will supply the initial quantities of E25 for
product launch. Novartis has announced that it intends to supply E25 from a
facility now under construction that has a capacity of more than one ton of
active substance per year.

Our current facility will not be adequate for commercial scale manufacturing
requirements if we successfully develop our products. If we decide to establish
a full-scale manufacturing facility, we will require substantial additional
funds and must hire and train significant numbers of employees and comply with
the extensive FDA regulations applicable to that facility.

                                       44
<PAGE>
MARKETING AND SALES

Novartis and Genentech will market E25 and the other products selected for
development by the collaboration. Novartis and Genentech share U.S. marketing
rights, and Novartis has marketing rights in Europe (with Roche retaining the
option to participate in Europe). Novartis can market these products in the rest
of the world, including China, Hong Kong, Korea, Singapore and Taiwan, where we
will share costs and profits with Novartis.

To effectively serve the worldwide markets, we intend to continue to collaborate
with major pharmaceutical companies or prominent pharmaceutical sales and
distribution organizations that can successfully market our products on a
worldwide basis or within specific geographic territories. As we pursue
strategic collaborations, we intend to reserve marketing rights for our
products, to the extent commercially reasonable, including rights in the United
States and selected Asian countries. We will focus initially on markets for
which our products have a clear advantage over other therapies or which we may
target using a relatively small sales force. We currently do not have an
internal sales and marketing capability. If we elect to retain marketing rights,
we will have to build a sales and marketing infrastructure.

FACILITIES

We currently lease 35,624 square feet of laboratory and office space in Houston,
Texas, under a lease which expires in March 2002, subject to a five-year renewal
option. This space includes a biological product manufacturing facility
occupying approximately 14,000 square feet of space. We lease approximately
2,690 square feet of temporary laboratory and office space in the Amsterdam
Science Park in The Netherlands and intend to lease approximately 10,760 square
feet of space there when it becomes available in 2001. We also lease
approximately 6,500 square feet of space in the Hsinchu Science Based Industrial
Park in Taiwan.

We plan to obtain temporary additional space, before the end of 2000, to expand
our research, clinical development and production capabilities. We are exploring
alternatives to meet our longer term facility requirements for our U.S.
operations. We do not foresee any significant difficulties in obtaining
additional facilities.

HUMAN RESOURCES

Including the employees of our subsidiaries, we have 70 full-time employees, 59
of whom are based in the United States, 10 of whom are based in The Netherlands
and one of whom is based in Taiwan. Approximately 55 of our employees are
involved in research and product development activities. Thirty of our employees
hold Ph.D., M.D. or Sc.D. degrees and ten employees hold other advanced degrees.
We consider our relations with our employees to be good. None of our employees
are covered by collective bargaining agreements. We enter into confidentiality
agreements with all of our employees, directors and consultants. We do not
maintain, and do not currently intend to obtain, key employee life insurance on
any of our personnel.

PENDING LEGAL PROCEEDINGS

TANOX BIOSYSTEMS, INC. VS. AKIN, GUMP, STRAUSS, HAUER AND FELD, L.L.P., THE
ROBINSON LAW FIRM AND WILLIAMS, BIRNBERG & ANDERSON, AMERICAN ARBITRATION
ASSOCIATION NO. 70-199-0167-96.  We are arbitrating a fee dispute with the law
firms that represented us in connection with a lawsuit involving Genentech and
Roche relating to, among other things, the intellectual property rights of the
parties surrounding the development of anti-IgE technology. We settled the
litigation contemporaneously with the formation of our collaboration with
Genentech.

We initiated the arbitration proceeding after we and our attorneys could not
reach agreement on the fee owed pursuant to the terms of our written fee
agreement. The arbitration panel issued an award entitling the attorneys to
receive approximately $3.5 million, including interest, payments ranging from
33 1/3% to 40% of the future milestone payments received by us from Genentech
under the collaboration following product approval and 10% of the royalties that
we receive on sales of anti-IgE products.

                                       45
<PAGE>
We sought a court order vacating the arbitration award on the grounds that the
arbitration decision exceeds the scope of the fee agreement in dispute, deviates
materially from the evidence presented and is unsupportable as a matter of law.
However, a judgment was entered confirming the award. We intend to pursue all
available remedies, including appealing the decision.

TANOX, INC. VS. NOVARTIS PHARMA AG, AMERICAN ARBITRATION ASSOCIATION NO. 50 T
153 00119 99; GENENTECH, INC., GENENTECH INTERNATIONAL LIMITED AND NOVARTIS
PHARMA AG VS. TANOX, INC., CASE NO. C 99-2060; AND TANOX, INC. VS. GENENTECH,
INC. AND GENENTECH INTERNATIONAL LIMITED, AMERICAN ARBITRATION ASSOCIATION NO.
74 Y 181 1113 99.  We are currently pursuing clinical development of Hu-901 to
determine its potential in treating peanut induced anaphylaxis independently of
Novartis and Genentech. Novartis and Genentech have disputed our right to pursue
development of Hu-901 independently and have claimed that we are using
unspecified confidential and proprietary information of Novartis and Genentech
that we have no right to use. We believe our agreements with Novartis and
Genentech allow us to pursue the development of Hu-901.

In an effort to resolve this dispute, we initiated an arbitration with Novartis
in March 1999 pursuant to our agreement with Novartis. In the arbitration, we
are seeking to confirm our rights to independently develop certain anti-IgE
products, including Hu-901, and to use know-how we received from Novartis.
Novartis has claimed that the dispute does not constitute a dispute which we
must arbitrate under our agreements and that our claimed rights to independently
develop Hu-901 do not exist. Novartis has also claimed damages arising from our
action.

In response to the arbitration initiated by us against Novartis, Novartis and
Genentech jointly filed suit against us in April 1999 in the United States
District Court for the Northern District of California. In the lawsuit, Novartis
and Genentech seek declarations that we cannot develop Hu-901 independently,
that we cannot use confidential and proprietary information obtained from
Novartis or Genentech for independent product development, and that we cannot
pursue separate arbitrations on these matters against both Novartis and
Genentech. Novartis and Genentech also claim undetermined actual and punitive
damages resulting from our independent development of Hu-901, and they also seek
a permanent injunction stopping our Hu-901 development and preventing us from
continuing with our arbitrations on these matters.

At the time the lawsuit was filed, Novartis also asked the Federal court for an
emergency temporary stay of the arbitration requested by us. The United States
District Court Judge denied Novartis' request and ordered Novartis to proceed
with the arbitration.

In July 1999, we initiated an arbitration proceeding against Genentech. In this
arbitration, we are seeking to confirm that Genentech expressly acknowledged our
independent development rights in our agreement with them and that Genentech
agreed to allow us to use and disclose their confidential and proprietary
information for purposes contemplated by our separate agreement with Novartis.
We also are seeking to confirm that we have not used any of their confidential
and proprietary information and that Genentech's lawsuit claims are
unsupportable and made in bad faith, have impaired our ability to exercise our
rights under our agreements with Novartis, violate our agreed dispute resolution
procedures and violate their agreement not to interfere in our separate disputes
with Novartis. In response, Genentech asserts that their disputes with us are
not subject to arbitration, and should remain in Federal court. Additionally,
Genentech asserts that our arbitration with Novartis should be joined with
Genentech's arbitration.

In September 1999, the United States District Court Judge issued an order
staying all proceedings in the lawsuit and both arbitrations, except for the
parties' opportunity to engage in limited written discovery in the form of
requests for production of documents and written questions to each other. The
Judge's order required the parties, with their respective chief executive
officers present, to undertake to mediate all matters in dispute between them.
The mediation took place on November 2 and 3, 1999 in San Francisco, California,
and concluded unsuccessfully. To continue our arbitration proceedings, we must
ask the court to allow our respective arbitrations with Novartis and Genentech
to proceed.

We intend to continue to pursue independent development of Hu-901 during the
pendency of the above-described actions. If we are unsuccessful in these
actions, we may not independently develop Hu-901 and other anti-IgE products
covered by the collaboration with Novartis and Genentech and could be required
to pay damages that could be significant.

                                       46

<PAGE>
                                   MANAGEMENT

DIRECTORS, EXECUTIVE OFFICERS AND KEY EMPLOYEES

Our directors, executive officers and key employees, and their ages and
positions as of March 31, 2000 are:

NAME                                  AGE            POSITION
- -----------------------------------   --- ------------------------------
Nancy T. Chang, Ph.D...............   50  Chairman of the Board,
                                          President and Chief Executive
                                            Officer
John C. Morris.....................   56  Senior Vice President of
                                            Operations
David W. Thomas, Ph.D. ............   52  Senior Vice President of
                                            Research and Development
David Duncan, Jr...................   51  Vice President of Finance and
                                            Chief Financial Officer
John Blickenstaff..................   46  Vice President of
                                            Administration, Secretary and
                                            Treasurer
George Y. Wang, Sc.D...............   46  Vice President of Process
                                            Development and Production
Eric P. Mirabel, J.D., LL.M. ......   44  Vice President of Intellectual
                                            Property
Tse Wen Chang, Ph.D.(1)(2).........   52  Director
Osama I. Mikhail, Ph.D.(1)(2)......   52  Director
William J. Jenkins, M.D.(2)........   52  Director

- ---------------------------

(1)  Member of the compensation committee.

(2)  Member of the audit committee.

NANCY T. CHANG, PH.D. is one of our co-founders and has served as our President
and Chairman of the Board of Directors since our organization in March 1986. Dr.
Chang has served as our Chief Executive Officer since June 1990. From 1986 to
1992, Dr. Chang served as an Associate Professor at Baylor College of Medicine
in the Division of Molecular Virology. Between 1981 and 1986, Dr. Chang was
employed by Centocor, Inc., serving as the Director of Research, Molecular
Biology Group, from 1984 to 1986. From 1980 to 1981, she was employed by Roche
Institute of Molecular Biology. Dr. Chang received her Ph.D. in biological
chemistry from Harvard University.

JOHN C. MORRIS has served as our Senior Vice President of Operations since
September 1997. From September 1996 to September 1997, he served as our Vice
President of Quality Assurance. Prior to coming to us, Mr. Morris served as
President at Oread Laboratories, Inc. from 1995 to 1996. From 1992 to 1995, Mr.
Morris served as Vice President of Production Development, Regulatory Affairs
and Quality Assurance at Sanofi Animal Health Inc. Mr. Morris received an M.S.
in microbial biochemistry from the University of Missouri.

DAVID W. THOMAS, PH.D. has served as our Senior Vice President of Research and
Development since November 1997. Prior to joining us, Dr. Thomas served as Vice
President of Biological Research at Hybridon, Inc. in 1997. From 1988 to 1997,
he served as Director of Cell Biology and Immunology at Biogen, Inc. Prior to
his positions at Biogen and Hybridon, Dr. Thomas held professorships at the
University of Michigan Medical School and Washington University in St. Louis,
Missouri. He received his Ph.D. degree in microbiology and immunology from the
University of Colorado Health Sciences Center, followed by a postdoctoral
fellowship in the Laboratory of Immunology of the National Institute of Allergy
and Infectious Disease at the National Institutes of Health.

DAVID DUNCAN, JR. has served as our Vice President of Finance and Chief
Financial Officer since August 1998. Prior to joining us, from 1994 to March
1998, he served as Chief Financial Officer at Neuromedical Systems, Inc., which
filed a voluntary petition for bankruptcy under Chapter 11 of the U.S.
bankruptcy code on March 26, 1999. From 1988 to 1994, Mr. Duncan served as Chief
Financial Officer at Telios

                                       47
<PAGE>
Pharmaceuticals, Inc. From 1983 to 1988, he served as the Controller at
Hybritech Incorporated. Mr. Duncan received an MBA from Indiana University.

JOHN BLICKENSTAFF has served as our Vice President of Administration since April
1989 and has also served as Vice President of Finance from that time until March
1996. Mr. Blickenstaff also served as our Chief Financial Officer from June 1990
until March 1996. He joined us in March 1987 as Director of Finance and
Administration, becoming our Secretary and Treasurer in September 1987. Between
1984 and 1987, Mr. Blickenstaff served as Operations Manager at Montgomery
Engineering Company. Mr. Blickenstaff holds a B.S. in health sciences and an MBA
from Brigham Young University.

GEORGE Y. WANG, SC.D. has served as our Vice President of Process Development
and Production since October 1994. He joined us in 1991 as our Assistant
Director, BioProcessing Development. Prior to joining us, Dr. Wang held various
engineering and management positions at IDEC Pharmaceuticals Corp., BP Amoco
Corporation and MGI Pharmaceuticals, Inc. Dr. Wang received his Sc.D. in
biochemical engineering from Massachusetts Institute of Technology.

ERIC MIRABEL has served as our Vice President of Intellectual Property since
1994. He joined us in 1990 as our Patent Counsel. From 1986 to 1990 Mr. Mirabel
practiced intellectual property law with the Houston firm of Butler and Binion.
Mr. Mirabel received a B.S. in biochemistry from the University of British
Columbia, a J.D. from Northwestern School of Law at Lewis and Clark College, and
an LL.M. in patent and trade regulation law from the National Law Center at
George Washington University.

TSE WEN CHANG, PH.D. is one of our co-founders and has served as a member of our
board of directors since our organization in March 1986. Dr. Chang served as our
Vice President of Research and Development and Chief Scientific Officer from
March 1986 until January 1997 when he resigned that position to assume the
position of Dean of the College of Life Sciences at National Tsing Hua
University in Hsinchu, Taiwan. Dr. Chang is currently a professor there. Dr.
Chang was a professor at Baylor College of Medicine in the Division of Molecular
Virology from 1986 to 1991. From 1984 to 1986, Dr. Chang served as Vice
President of Research at Centocor, Inc. Dr. Chang obtained his Ph.D. from
Harvard University in cell and developmental biology.

OSAMA MIKHAIL, PH.D. has served as a member of our board of directors since
1994, and also has served as a consultant to us since 1993. Dr. Mikhail is
currently Senior Vice President and Chief Strategic Officer at St. Luke's
Episcopal Health System and Professor of Management and Policy Sciences at the
University of Texas, School of Public Health, both in the Texas Medical Center,
Houston, Texas. Dr. Mikhail has been associated with St. Luke's and the
University of Texas School of Public Health since 1989. Dr. Mikhail received an
MBA from the University of Pennsylvania's Wharton School and an M.S. and Ph.D.
from the Graduate School of Industrial Administration, Carnegie-Mellon
University.

WILLIAM J. JENKINS, M.D. has served as a member of our board of directors since
November 1999. Since the beginning of 1999, Dr. Jenkins has been a strategic
consultant to the pharmaceutical industry, primarily at Hoffman-La Roche Inc.
Prior to that, he served as Head of Clinical Development & Regulatory Affairs
and a member of the board of directors of Novartis Pharma AG in Basel,
Switzerland since 1992. Dr. Jenkins served as Head of Clinical Research for the
Glaxo Group from 1988 to 1992. Dr. Jenkins received his medical degrees from the
University of Cambridge.

                                       48
<PAGE>
SCIENTIFIC ADVISORS

An important component of our scientific strategy is to establish collaborative
relationships with leading researchers in our fields of interest. Certain of our
scientific advisors attend periodic meetings and provide us with specific
expertise in both research and clinical development. In addition, we have
collaborative research relationships with certain individual advisors. We do not
employ our scientific advisors, and they may have commitments to or consulting
or advisory agreements with other entities that may limit their availability to
us. These companies may also compete with us. Several of our advisors have, from
time to time, devoted significant time and energy to our affairs. In general,
our scientific advisors may hold stock options, own our stock and/or receive
financial remuneration for their services.

Our scientific advisors include:

NAME                                        TITLE AND AFFILIATION
- ----                                        ---------------------
K. Frank Austen, M.D................ Director, Inflammation and Allergic
                                     Diseases
                                     Brigham and Women's Hospital, Boston,
                                     Massachusetts
James Larrick, M.D., Ph.D........... Managing Director and Founder,
                                     Panorama Research, Inc.
Ethan M. Shevach, M.D............... Chief, Cellular Immunology Section,
                                     National Institutes of Health

COMPOSITION OF THE BOARD OF DIRECTORS

Our amended and restated certificate of incorporation and bylaws divide our
board of directors into three classes of equal number: Classes I, II and III.
Our stockholders elected directors comprising Class I to a term of office to
expire at the 2001 annual meeting of stockholders; directors comprising Class II
to a term of office to expire at the 2002 annual meeting of stockholders; and
directors comprising Class III to a term of office to expire at the 2003 annual
meeting of stockholders. At each annual meeting of stockholders beginning in
2001, the stockholders will elect the successors to directors whose terms will
then expire. These directors will serve from the time of election and
qualification until the third annual meeting of stockholders following election
and until a successor is duly elected and qualified.

Our bylaws also authorize the board of directors to fix the number of directors
at not less than one nor more than nine. The board of directors currently has
four members. The board of directors is considering an increase in the number of
directors. Currently, Osama Mikhail is designated as a Class I director, whose
term expires at the 2001 annual meeting of stockholders; Tse Wen Chang is
designated as a Class II director, whose term expires at the 2002 annual meeting
of stockholders; and Nancy T. Chang and William J. Jenkins are designated as
Class III directors, whose terms expire at the 2003 annual meeting of
stockholders. Each officer serves at the discretion of the board of directors.

There are no family relationships among any of our directors, executive officers
or key employees, although Drs. Nancy T. Chang and Tse Wen Chang previously were
married.

Our bylaws also require the affirmative vote of holders of at least two-thirds
of the issued and outstanding shares of common stock to remove any director or
the entire board of directors. Directors can only be removed for "cause."

DIRECTOR COMPENSATION

As compensation for serving on the board of directors, we granted Dr. Mikhail
options to acquire 108,000 shares of common stock, 96,000 of which were granted
at an exercise price per share of $1.04 and are all currently exercisable, 8,000
of which were granted at an exercise price per share of $4.06, none of which are
currently exercisable, and 4,000 of which were granted at an exercise price per
share of $12.50, none of which are currently exercisable. All of his options
vest over a three-year period. On February 17, 2000, we granted Dr. Jenkins
options to acquire 24,000 shares of common stock at an exercise price per share
of $12.50, none of which are currently exercisable, and all of which vest over a
two-year period. Outside directors also receive $1,000 for each board meeting
attended and $500 for each committee meeting attended, except for Dr. Tse Wen
Chang, who is compensated under a consulting agreement with us. Other

                                       49
<PAGE>
than the foregoing, the directors receive no other compensation for their
services as directors. We reimburse our outside directors, on request, for
reasonable out-of-pocket expenses incurred in attending board meetings.

COMMITTEES OF THE BOARD OF DIRECTORS

Our board of directors currently has two committees: an audit committee and a
compensation committee.

The audit committee makes recommendations to our board of directors regarding
the selection of independent auditors, reviews the results and scope of audit
and other services provided by our independent auditors and reviews the
accounting principles and auditing practices and procedures to be used for our
financial statements.

The compensation committee reviews and makes recommendations to our board of
directors regarding the compensation of officers and other managerial employees.
The compensation committee also considers and recommends grants of stock options
under our stock option plans.

COMPENSATION COMMITTEE INTERLOCKS AND INSIDER PARTICIPATION

The compensation committee made decisions concerning the compensation of our
executive officers for the years ended December 31, 1997, 1998 and 1999, during
which time Nancy T. Chang, our Chairman of the Board, President and Chief
Executive Officer has been a member of the committee. No interlocking
relationship exists between any member of our board of directors or our
compensation committee and any member of the board of directors or compensation
committee of any other company.

EXECUTIVE COMPENSATION

                           SUMMARY COMPENSATION TABLE

The following table sets forth the annual compensation we paid during the year
1999 to our chief executive officer and the four highest paid executive officers
whose total annual salary and bonus exceeded $100,000. These individuals are
referred to as the "named executive officers" here and elsewhere in this
prospectus.

                                                    ANNUAL COMPENSATION
                                        ---------------------------------------
                                                                  OTHER ANNUAL
NAME AND PRINCIPAL POSITION               SALARY        BONUS     COMPENSATION
- -------------------------------------   -----------  -----------  -------------
Nancy T. Chang.......................    $ 368,622     $58,000       $12,132(1)
  Chairman of the Board, President
  and Chief Executive Officer
John C. Morris.......................      154,587      10,000        --
  Senior Vice President of Operations
David W. Thomas......................      199,548      10,000        --
  Senior Vice President of Research
  and Development
David Duncan, Jr.....................      164,221       5,000        10,569(2)
  Vice President of Finance and
  Chief Financial Officer
George Y. Wang.......................      134,359      --            --
  Vice President of Process
  Development and Production

- ---------------------------

(1)  Dr. Chang's other annual compensation includes $7,549 of taxable income
     associated with a company car, $4,000 associated with 401(k) matching and
     $583 relating to group term life insurance.

(2)  Mr. Duncan's other annual compensation includes $8,800 related to housing
     expenses, $1,054 associated with 401(k) matching and $715 relating to group
     term life insurance.

                                       50
<PAGE>
                               1999 OPTION GRANTS

The following table sets forth information regarding options granted to each of
our named executive officers during the year 1999. The exercise prices of the
options we granted were the fair market value of our common stock on the date of
grant, as determined by the compensation committee of our board of directors. In
determining the fair market value, the compensation committee considered
information contained in a then current valuation report made for tax purposes,
market conditions, business prospects, and the absence of a market for our
common stock.

The potential realizable value is calculated based on the ten-year term of the
option at the time of grant. Stock price appreciation of 5% and 10% is assumed
pursuant to rules promulgated by the Securities and Exchange Commission and does
not represent our prediction of our stock price performance. The potential
realizable values at 5% and 10% appreciation are calculated by:

  o    multiplying the number of shares of common stock under the option by
       $28.50 per share;

  o    assuming that the aggregate stock value derived from that calculation
       compounds at the annual 5% or 10% rate shown in the table until the
       expiration of the options; and

  o    subtracting from that result the aggregate option exercise price.

The options in this table were granted under our 1997 Stock Plan, have 10-year
terms, will terminate before their expiration dates if the optionee leaves his
employment with us, and, unless otherwise noted, vest over a period of five
years. We have not granted any stock appreciation rights.

The percentage shown below of options granted is based on an aggregate of
117,120 options we granted to employees during 1999.

<TABLE>
<CAPTION>
                                                                                                               POTENTIAL REALIZABLE
                                                                                                                VALUES AT ASSUMED
                                         NUMBER OF      PERCENT OF TOTAL                                      ANNUAL RATES OF STOCK
                                         SECURITIES     OPTIONS GRANTED                                       PRICE APPRECIATION FOR
                                         UNDERLYING       TO EMPLOYEES                                             OPTION TERM
                                          OPTIONS          IN FISCAL         EXERCISE PRICE      EXPIRATION   ----------------------
                NAME                      GRANTED          YEAR 1999           PER SHARE            DATE         5%          10%
- -------------------------------------   ------------    ----------------    ----------------    ------------  ---------  -----------
<S>                                     <C>             <C>                 <C>                 <C>           <C>        <C>
Nancy T. Chang.......................          --           --                  --                   --          --          --
John C. Morris(1)....................      16,000             13.7%              $ 8.13           01/25/09    $ 612,696  $ 1,052,667
                                            8,000              6.8                12.50           12/01/09      271,388      491,373
David W. Thomas(2)...................      16,000             13.7                 8.13           01/25/09      612,696    1,052,667
                                           16,000             13.7                12.50           12/01/09      542,776      982,747
David Duncan, Jr.....................          --           --                  --                   --          --          --
George Y. Wang(3)....................       4,000              3.4                12.50           12/01/09      135,694      245,687
</TABLE>

- ---------------------------

(1)  The vesting start date for the options to purchase 16,000 shares of common
     stock granted to Mr. Morris is January 25, 1999. 9,600 of these options
     vest over a period of three years and the remaining 6,400 of these options
     vest over a period of five years. The vesting start date for the options to
     purchase 8,000 shares of common stock granted to Mr. Morris is December 1,
     1999. 4,800 of these options vest over a period of three years and the
     remaining 3,200 of these options vest over a period of five years.

(2)  The vesting start date for the options to purchase 16,000 shares of common
     stock granted to Mr. Thomas is January 25, 1999. The vesting start date for
     the options to purchase an additional 16,000 shares of common stock granted
     to Mr. Thomas is December 1, 1999.

(3)  The vesting start date for these options is December 1, 1999.

                                       51
<PAGE>
                               1999 OPTION VALUES

The following table describes for the named executive officers the exercisable
and unexercisable options held by them as of December 31, 1999. No options were
exercised by the named executive officers during the fiscal year ended December
31, 1999. The "Value of Unexercised In-the-Money Options at December 31, 1999"
shown in the table is based on an initial public offering price of $28.50 per
share, less the per share exercise price, multiplied by the number of shares
issued upon exercise of the option.

<TABLE>
<CAPTION>

                                             NUMBER OF SECURITIES              VALUE OF UNEXERCISED
                                        UNDERLYING UNEXERCISED OPTIONS       IN-THE-MONEY OPTIONS AT
                                             AT DECEMBER 31, 1999               DECEMBER 31, 1999
                                        ------------------------------    ------------------------------
NAME                                    EXERCISABLE     UNEXERCISABLE     EXERCISABLE     UNEXERCISABLE
- -------------------------------------   ------------    --------------    ------------    --------------
<S>                                     <C>             <C>               <C>             <C>
Nancy T. Chang.......................      260,800          391,200        $ 5,476,800      $8,215,200
John C. Morris.......................       51,199          100,801          1,075,179       2,066,821
David W. Thomas......................       80,000          152,000          1,980,000       3,552,000
David Duncan, Jr.....................       38,399          153,601            782,380       3,129,620
George Y. Wang.......................      201,600            4,000          5,523,171          64,000
</TABLE>

EMPLOYMENT AGREEMENTS

We do not have employment agreements with our executive officers, other than
agreements that we maintain with all of our employees and option agreements
under which we issue incentive and non-qualified stock options to employees.

EMPLOYEE BENEFIT PLANS

1987 STOCK OPTION PLAN

Our 1987 Stock Option Plan expired on June 24, 1997. This plan provided for the
grant of incentive stock options, which were intended to qualify for favorable
tax treatment, and non-qualified stock options to eligible parties who were
employees. Our board of directors adopted and our stockholders approved the plan
on June 25, 1987. Under the terms of the plan, as amended in April 1989, we
could issue options on 4,320,000 shares of our common stock.

Special provisions applied to incentive stock options granted under the plan,
including requirements that the exercise price of incentive stock options be at
least equal to the fair market value of the common stock on the date of the
grant. There was also a $100,000 limit on the value of stock, determined at the
time of grant, covered by incentive stock options that first become exercisable
by a holder in any calendar year.

No person could receive an incentive stock option under the plan if, at the time
of grant, the person owned directly or indirectly more than 10% of our total
combined voting power. This restriction did not apply, however, if the option
price was at least 110% of the fair market value of the common stock, and the
exercise period was limited to five years.

If a reorganization, recapitalization, stock dividend, merger, consolidation or
other change in corporate structure affecting the number of issued shares of our
common stock occurred, then our board of directors could make equitable
adjustments to the terms of this plan. In particular, the board could make an
equitable adjustment in the number and type of shares authorized by this plan,
the number and type of shares covered by outstanding awards under this plan and
the exercise prices of these awards. After the adjustments, any incentive stock
options granted under the plan must have continued to constitute incentive stock
options under applicable tax laws. Our board of directors could amend or
terminate this plan at any time, although certain amendments required
stockholder approval and an amendment or termination could not adversely affect
any rights under outstanding stock options without the holder's consent.

                                       52
<PAGE>

For the year ended December 31, 1999, we granted no options, we cancelled
options to purchase 32,000 shares of common stock and the holders of options to
purchase 1,738,320 shares of common stock exercised those options. As of
December 31, 1999, options to purchase an aggregate of 2,242,800 shares of
common stock held by 26 employees were outstanding under the plan at exercise
prices ranging from $0.28 to $7.50 per share with a weighted average exercise
price of $4.03 per share. These options consist of incentive stock options to
purchase 856,264 shares at a weighted average exercise price of $3.78 per share
and non-qualified options to purchase 1,386,536 shares at a weighted average
exercise price of $4.19 per share. At December 31, 1999, no shares were
available for future option grants under the plan. After December 31, 1999,
employees exercised options to purchase 566,740 shares of common stock.

1997 STOCK PLAN

The board of directors adopted our 1997 Stock Plan on September 19, 1997, and
our stockholders approved the plan to be effective as of November 1, 1997. This
plan provides for the grant of incentive stock options to our employees and the
grant of non-qualified stock options, awards of stock, stock appreciation
rights, purchase rights and performance units to all types of eligible parties.
The board of directors or, in the discretion of the board, the compensation
committee or other committee appointed by the board of directors, consisting of
at least two members of the board of directors administers the plan. We may
grant options or other rights under the plan to some of our and our
subsidiaries' directors, employees, consultants and advisors. We may also, with
the consent of the holder, convert a holder's incentive stock options into
non-qualified stock options. We have reserved 8,000,000 shares of authorized but
unissued common stock for issuance under the plan. The plan extends for a
10-year period, beginning November 1, 1997.

Special provisions apply to incentive stock options granted under the plan in a
manner that is similar to those granted under the 1987 Stock Option Plan. The
1997 Stock Plan also contains adjustment provisions that are similar to those in
the 1987 Stock Option Plan.

For the year ended December 31, 1999, we granted options to purchase an
aggregate of 125,120 shares of common stock under the 1997 Stock Plan at a
weighted average exercise price of $10.60 per share. This includes incentive
stock options to purchase 102,720 shares at a weighted average exercise price of
$10.59 per share and non-qualified options to purchase 22,400 shares at a
weighted average exercise price of $10.63 per share. In 1999, options to
purchase 3,200 shares of common stock were exercised and options to purchase
8,000 shares were cancelled.

As of December 31, 1999, 39 individuals held options to purchase a total of
636,320 shares of common stock under the plan at exercise prices ranging from
$3.75 to $12.50 per share with a weighted average exercise price of $7.05 per
share. These options consist of incentive stock options to purchase 206,656
shares at a weighted average exercise price of $9.71 per share and non-qualified
options to purchase 429,664 shares at a weighted average exercise price of $5.77
per share. At December 31, 1999, there were 7,360,480 shares available for
future option grants under the plan. After December 31, 1999 we granted options
to purchase 35,500 shares of common stock, and option holders exercised options
to purchase 15,287 shares of common stock.

1992 NON-EMPLOYEE DIRECTORS STOCK OPTION PLAN

Under our 1992 Non-Employee Directors Stock Option Plan, we may grant
non-qualified stock options to certain directors who are not also our employees.
The plan was adopted by the board of directors and approved by our stockholders
on January 10, 1992. The number of shares of common stock eligible for issuance
under the plan is 480,000. The compensation committee administers the plan. We
may issue options under the plan at any exercise price determined by the
compensation committee. Generally, options granted under the plan expire upon
voluntary resignation of the holder from the board of directors. Upon
termination of a holder's tenure as a director for any other reason, the holder
must exercise the options within 60 days thereafter or within 180 days after the
holder's death or disability, but in no event later than the originally
prescribed term of the option. Unless otherwise determined by the compensation
committee,

                                       53
<PAGE>
options granted under the plan vest over a three-year period. The plan
terminates on January 10, 2002, unless earlier terminated by the board of
directors.

For the year ended December 31, 1999, we granted options to purchase a total of
12,000 shares of common stock under the plan at a weighted average exercise
price of $6.88 per share. As of December 31, 1999, one director held options to
purchase an aggregate of 108,000 shares of common stock under the plan at
exercise prices ranging from $1.04 to $12.50 per share with a weighted average
of $1.69 per share. At December 31, 1999, 372,000 shares were available for
future option grants under the plan. After December 31, 1999, we granted options
to purchase 24,000 shares of common stock to one of our directors at an exercise
price per share of $12.50 that vest over a two-year period. No options issued
under the plan have been exercised.

2000 NON-EMPLOYEE DIRECTORS' STOCK OPTION PLAN

Our board of directors adopted, and our stockholders approved, the 2000
Non-Employee Directors' Stock Option Plan on February 17, 2000. The plan
automatically grants options to purchase shares of our common stock to our
non-employee directors. The board of directors administers the plan. We have
reserved a total of 500,000 shares of our common stock for issuance under the
plan. We have not issued any options under this plan.

After this offering, we will automatically issue options to our non-employee
directors under this plan as follows:

  o    each person who is elected or appointed to be a non-employee director for
       the first time will automatically receive an initial grant to purchase
       15,000 shares; and

  o    each person who is re-elected or re-appointed as a non-employee director
       will automatically receive a grant to purchase 5,000 shares.

Directors serving on the board as of February 17, 2000 may not receive any
options under this plan.

The options are exercisable immediately but vest 1/36th per month for each month
after the date of the grant over three years. As long as the option holder
continues to serve with us or with an affiliate of ours, whether in the capacity
of a director, an employee or a consultant, the option will continue to vest and
be exercisable during its term.

The options have an exercise price equal to 100% of the fair market value of our
common stock on the grant date.

The option term is ten years. Options terminate on the earlier of normal option
termination or three months after the option holder's service terminates. If
this termination is due to the option holder's disability, the post-termination
exercise period is extended to the earlier of normal option termination or 12
months. If termination is due to the option holder's death or if the option
holder dies within three months of the date on which his or her service
terminates, the post-termination exercise period is extended to the earlier of
normal option termination or 18 months following death.

The option holder may transfer the option by gift to immediate family members or
for estate planning purposes. The option holder may also designate a beneficiary
to exercise the option if the option holder dies. If the option holder does not
designate a beneficiary, the option exercise rights will pass by the option
holder's will or by the laws of descent and distribution.

If an option holder does not purchase the shares subject to his or her option
before the option expires or otherwise terminates, the shares that are not
purchased will again become available for issuance under the plan.

Transactions that do not involve our receiving consideration, including a
merger, consolidation, reorganization, stock dividend and stock split, may
trigger a change in the class and number of shares subject to this plan and to
outstanding options. If any of these events occurs, the board of directors will
appropriately adjust the plan as to the class and the maximum number of shares
subject to the plan and the

                                       54
<PAGE>
automatic option grants. It will also adjust outstanding options as to the
class, number and price of shares subject to these options.

If we dissolve or liquidate, outstanding options will terminate immediately
before this event. However, we treat outstanding options differently in the
following situations:

  o    a sale, lease or other disposition of all or substantially all of our
       assets;

  o    a merger or consolidation in which we are not the surviving corporation;
       and

  o    a reverse merger in which we are the surviving corporation but the shares
       of our common stock outstanding immediately before the merger are
       converted by virtue of the merger into other property.

In these situations, any surviving entity will either assume or replace all
outstanding options under the plan. Otherwise, the vesting of the options will
accelerate.

The board of directors may suspend or terminate the plan at any time.

GENERAL

We intend to file a registration statement on Form S-8 upon the completion of
this offering to register the sale of common stock issuable upon exercise of
stock options issued under our stock option plans.

401(K) PLAN

Effective January 1, 1992, we adopted a qualified retirement plan, or 401(k)
plan, covering all of our employees who are at least 21 years of age and have
completed at least one year of service with us. Under the plan, employees may
elect to reduce their current compensation by up to the statutorily prescribed
annual limit ($10,500 in 2000) and have the amount of the reduction contributed
to the plan. The plan is covered by the Employee Retirement Income Security Act
of 1974. We also intend for the plan to satisfy certain federal income tax law
requirements so that the contributions by employees or by us to the plan, and
income earned on plan contributions, are not taxable to employees until they
withdraw from the plan. We also intend for any contributions we make to the plan
to be deductible by us for federal income tax purposes.

The trustee of the plan, at the direction of each participant, invests the
assets of the plan in any of nine investment options. The plan permits, but does
not require, us to make additional matching contributions on behalf of all
participants in the plan. For the year ended December 31, 1998, we contributed
matching contributions of approximately $66,000 to the plan. Our matching
contribution for the year ending December 31, 1999 was 50% of employee
contributions up to a maximum employer contribution of 2.5% of each
participant's total compensation. Our matching contribution for the year ending
December 31, 2000 will be 50% of employee contributions up to a maximum employer
contribution of 2.5% of each participant's total compensation. The compensation
committee of the board of directors administers the plan.

OTHER OPTIONS

We have granted non-qualified stock options not covered by the 1987 Stock Option
Plan, the 1997 Stock Plan or the 1992 Non-Employee Directors Stock Option Plan
to an outside, non-affiliated director and to key advisors and consultants to
purchase an aggregate of 196,800 shares of common stock, net of cancellations,
as of December 31, 1999, at a weighted average exercise price of $1.31 per
share. All of these options are currently exercisable. After December 31, 1999,
consultants exercised options to purchase 74,400 shares of common stock.

                                       55
<PAGE>
                             PRINCIPAL STOCKHOLDERS

The following table sets forth information regarding beneficial ownership of our
common stock as of March 31, 2000 by:

  o    each stockholder known by us to be the beneficial owner of more than 5%
       of the outstanding shares of common stock;

  o    each of our directors;

  o    each of our named executive officers; and

  o    all directors and officers as a group.

Beneficial ownership is determined according to the rules of the Securities and
Exchange Commission, and generally means that person has beneficial ownership of
a security if he or she possesses sole or shared voting or investment power of
that security, and includes options that are currently exercisable or
exercisable within 60 days. Each director, officer or 5% or more stockholder, as
the case may be, has furnished us information with respect to beneficial
ownership. Except as otherwise indicated, we believe that the beneficial owners
of the common stock listed below, based on the information each of them has
given to us, have sole investment and voting power with respect to their shares,
except where community property laws may apply.

This table lists applicable percentage ownership based on 33,973,123 shares of
common stock outstanding as of March 31, 2000, and also lists applicable
percentage ownership based on 40,973,123 shares of common stock outstanding
after completion of this offering. Options to purchase shares of our common
stock that are exercisable within 60 days of March 31, 2000, are deemed to be
beneficially owned by the persons holding these options for the purpose of
computing percentage ownership of that person, but are not treated as
outstanding for the purpose of computing any other person's ownership
percentage. Shares underlying options that are deemed beneficially owned are
listed in this table separately in the column labeled "Shares Subject to
Options." These shares are included in the number of shares listed in the
column labeled "Total Number."

Unless otherwise indicated, the principal address of each stockholder below is:
c/o Tanox, Inc., 10301 Stella Link, Houston, Texas 77025.

<TABLE>
<CAPTION>
                                                          SHARES BENEFICIALLY OWNED
                                        --------------------------------------------------------------
                                          TOTAL      SHARES SUBJECT    PERCENT BEFORE    PERCENT AFTER
NAME AND ADDRESS OF BENEFICIAL OWNER     NUMBER        TO OPTIONS         OFFERING         OFFERING
- -------------------------------------   ---------    --------------    --------------    -------------
<S>                                     <C>          <C>               <C>               <C>
DIRECTORS AND NAMED OFFICERS
Nancy T. Chang(1)....................   6,977,643        260,800            20.4%             16.9%
Tse Wen Chang(2).....................   6,564,239             --            19.3              16.0
George Y. Wang.......................     209,925        142,000             *                 *
Osama I. Mikhail(3)..................     103,467        103,467             *                 *
David W. Thomas(4)...................      86,400         83,200             *                 *
John C. Morris.......................      54,399         54,399             *                 *
David Duncan, Jr. ...................      38,399         26,092             *                 *
William J. Jenkins(5)................          --             --            --                --
All directors and officers as a group
  (10 persons)(6)....................  15,018,760        791,858            43.2              36.0

5% STOCKHOLDERS
Novartis AG(7).......................   6,373,732             --            18.8%             15.6%
Alafi Capital Company(8).............   2,514,724             --             7.4               6.1
</TABLE>

(FOOTNOTES ON FOLLOWING PAGE)

                                       56
<PAGE>
- ---------------------------

  *   Less than 1%

 (1)  Includes 6,429,318 shares of common stock owned by Robinhood Ventures,
      L.P. and 34,816 shares of common stock owned by AMC Ventures, L.P. Apex
      Enterprises, Inc., a corporation wholly-owned by Dr. Chang, is the sole
      general partner of Robinhood Ventures, L.P. and AMC Ventures, L.P. and has
      voting and investment control over the common stock owned by them.
      Includes 248,847 shares held in trust by Dr. Chang for her children.
      Includes 3,862 shares held by Dr. Chang's minor daughter, with respect to
      which Dr. Chang disclaims beneficial ownership.

 (2)  Includes 247,705 shares held in trust by Dr. Chang for his children. Dr.
      Chang's address is College of Life Sciences, National Tsing Hua
      University, Hsinchu, Taiwan, Republic of China.

 (3)  Dr. Mikhail's address is 6720 Bertner Ave., Suite B111, Houston, Texas
      77030.

 (4)  Includes 2,400 shares held by Dr. Thomas' spouse and children, with
      respect to which Dr. Thomas disclaims beneficial ownership.

 (5)  Dr. Jenkins' address is Gelham, Church Road, Waxham, Norfolk NR12 0DY,
      United Kingdom.

 (6)  See footnotes 1, 2 and 4 above. Includes 862,388 shares of common stock
      and 121,900 shares subject to options held by officers not shown in the
      table above.

 (7)  The address of Novartis AG is S-202.502, CH-4002, Basel, Switzerland.

 (8)  Includes 216,000 shares of common stock held by the Alafi Family
      Foundation, a non-profit organization, with respect to which Mr. Alafi
      disclaims beneficial ownership. Mr. Alafi is the General Partner of Alafi
      Capital Company. Alafi Capital Company's address is P.O. Box 7338,
      Berkeley, California 94707.

                                       57
<PAGE>
                              CERTAIN TRANSACTIONS

REGISTRATION RIGHTS

Some of our stockholders, including Nancy T. Chang, our Chairman, President and
Chief Executive Officer, and Novartis and Tse Wen Chang, each of whom owns more
than 10% of our common stock, have certain registration rights, which they may
exercise after this offering. They may request that we register their shares for
sale with the Securities and Exchange Commission, and, if all of the conditions
that are contained in our agreements with them are met, we must register their
shares. We must bear all the expenses of a registration. There are some
restrictions on their rights, including that we are not obligated to effect more
than one registration for their shares, except that we may be required, in
certain circumstances, to register their shares up to three times using a
short-form registration. For a more detailed description see also "Description
of Capital Stock -- Registration Rights."

NOVARTIS NOTE PAYABLE

We have a loan agreement with Novartis, which, prior to this offering, held
18.9% of our common stock. Under the agreement, Novartis loaned us $10.0
million, bearing interest at a rate equal to LIBOR plus two percent (8.1% at
December 31, 1999). Novartis has agreed to forgive interest on the loan through
December 31, 1999. The loan is due December 31, 2005. Tanox and Novartis have
agreed in principle that Novartis may partially or totally forgive the principal
and future interest payments based on our future use of the facility.

COLLABORATION AGREEMENTS WITH NOVARTIS

We also have agreements with Novartis to jointly develop anti-IgE antibody
products. For a more detailed description see "Business -- Collaboration and
License Agreements."

TRANSACTIONS WITH DIRECTORS

In addition to being one of our directors, Tse Wen Chang is a consultant to us.
In 1999, we paid $48,000 to Dr. Chang under the terms of his consulting
agreement. Our Taiwan subsidiary, TanAsia Pharma, Ltd., also entered into a
collaboration agreement, which expired in June 1999, with Dr. Chang and the
National Tsing Hua University. Dr. Chang is a professor, and was formerly Dean
of the College of Life Sciences, at National Tsing Hua University. Under the
agreement with the university, Dr. Chang and other scientists at the university
participated in certain research and development activities for our benefit. In
1999, we paid the university $20,250 under the terms of that agreement.

LOANS TO MANAGEMENT

In April 1999, we loaned John Blickenstaff, our Vice President of
Administration, Secretary and Treasurer, $161,250 to enable him to purchase
258,000 shares of our common stock, pursuant to stock options he held that were
soon to expire. This full recourse loan is secured by shares of our common stock
owned by Mr. Blickenstaff, bears interest at a rate of 8.5% and is due and
payable in full in September 2001.

In October 1999, we loaned David W. Thomas, our Senior Vice President of
Research and Development, $150,000 to enable him to purchase a residence in
Houston. The loan is unsecured, bears interest at a rate of 8.5% per annum and
is due and payable in full on the first to occur of the sale of his
Massachusetts residence or July 15, 2000.

                                       58
<PAGE>
                          DESCRIPTION OF CAPITAL STOCK

We may issue up to 120,000,000 shares of common stock, par value $.01 per share,
and 10,000,000 shares of preferred stock, par value $.01 per share. As of March
31, 2000, there were 33,973,123 shares of common stock outstanding held by 196
stockholders of record, and no shares of preferred stock were outstanding.

We do not intend the following summary description of our capital stock to be
complete and we qualify the description by referring to the provisions of
applicable law and to our amended and restated certificate of incorporation and
our bylaws, filed as exhibits to the registration statement of which this
prospectus is a part.

COMMON STOCK

Based on the number of shares outstanding as of March 31, 2000 and giving effect
to the issuance of the 7,000,000 shares of common stock offered pursuant to this
prospectus there will be 40,973,123 shares of common stock outstanding upon the
completion of this offering. In addition, as of March 31, 2000, there were
outstanding stock options to purchase 2,586,993 shares of common stock.

Each share of common stock entitles the holder to one vote on all matters
submitted to a vote of stockholders, including the election of directors.
Holders of common stock may receive ratably the dividends, if any, declared from
time to time by the board of directors out of legally available funds. Holders
of common stock have no conversion, redemption or preemptive rights to subscribe
to any of our securities. If any liquidation, dissolution or winding-up of our
affairs occurs, holders of common stock may share ratably in our assets
remaining after provision for payment of liabilities to creditors. The rights,
preferences and privileges of holders of common stock are subject to the rights
of the holders of any shares of preferred stock that we may issue in the future.

PREFERRED STOCK

We have no present plans to issue any shares of preferred stock. However, the
board of directors may, without action by the stockholders, designate and issue
preferred stock in one or more series and designate the rights, preferences and
privileges of each series, which may be greater than the rights of the common
stock.

REGISTRATION RIGHTS

After the completion of this offering, the holders of 21,539,756 shares of
common stock will be entitled to rights with respect to the registration of
these shares under the Securities Act. These rights include demand registration
rights.

Under the terms of the agreements providing registration rights, the holders of
a specified minimum number of shares can demand that we register their shares.
We must use our best efforts to effect a registration, subject to conditions and
limitations. We are not required to effect more than three of these
registrations pursuant to these demand registration rights. Under the terms of
the agreements providing registration rights, if we propose to register any of
our securities under the Securities Act, either for our own account or for the
account of other security holders exercising registration rights, these holders
are entitled to notice of the registration and may include shares of common
stock in the registration. The rights are subject to conditions and limitations,
among them the right of the underwriters of an offering subject to the
registration to limit the number of shares included in the registration. These
registration rights have been waived with respect to this offering. Furthermore,
stockholders with demand registration rights may require us to file additional
registration statements on Form S-3, subject to conditions and limitations. We
generally must bear all of the expenses of all of these registrations, except
underwriting discounts and selling commissions. We also have agreed to indemnify
stockholders who include shares in a registration statement from losses arising
from violations by us of applicable securities laws in connection with the
registration. Registration of any of the shares of common stock held by
stockholders with registration rights would

                                       59
<PAGE>
result in shares becoming freely tradable without restriction under the
Securities Act immediately upon effectiveness of the registration.

ANTI-TAKEOVER EFFECTS OF VARIOUS PROVISIONS OF DELAWARE LAW AND OUR AMENDED AND
RESTATED CERTIFICATE OF INCORPORATION AND BYLAWS

SECTION 203 OF THE DELAWARE GENERAL CORPORATION LAW.  We are subject to the
provisions of Section 203 of the Delaware General Corporation Law, which
regulates corporate takeovers. Subject to some exceptions, Section 203 prohibits
a publicly held Delaware corporation from engaging in a "business combination"
with an "interested stockholder" for a period of three years after the date of
the transaction in which the person became an interested stockholder, unless:

  o    before the date of the business combination, the board of directors of
       the corporation approves the transaction;

  o    upon consummation of the transaction that resulted in the stockholder
       becoming an interested stockholder, the interested stockholder owns at
       least 85% of the outstanding stock; or

  o    the board of directors and at least 66 2/3% of the outstanding voting
       stock that is not owned by the interested stockholder approve the
       business combination.

A "business combination" includes mergers, asset sales and other transactions
resulting in a financial benefit to the interested stockholder. Subject to
various exceptions, an "interested stockholder" is a person who, together with
affiliates and associates, owns, or within three years did own, 15% or more of
the corporation's voting stock. This statute could prohibit or delay mergers or
other takeover or change in control attempts with respect to us and,
accordingly, may discourage attempts to acquire us.

In addition, various provisions of our amended and restated certificate of
incorporation and our bylaws, which are summarized in the following paragraphs,
may be deemed to have an anti-takeover effect and may delay, defer or prevent a
tender offer or takeover attempt that a stockholder might consider in its best
interest, including those attempts that might result in a premium over the
market price for the shares held by stockholders.

REMOVAL OF DIRECTORS; VACANCIES.  Our bylaws provide that directors may be
removed from office only for cause and only by the affirmative vote of the
holders of at least two-thirds of our total outstanding voting stock. Vacancies
on our board of directors, including those resulting from an increase in the
number of directors, may be filled only by the remaining directors, not by
stockholders.

CLASSIFIED BOARD OF DIRECTORS.  Our bylaws divide our board into three classes
of directors serving staggered, three year terms. The classification of the
board has the effect of requiring at least two annual stockholder meetings,
instead of one, to replace a majority of the members of the board of directors.

ADVANCE NOTICE REQUIREMENTS FOR STOCKHOLDER PROPOSALS AND DIRECTOR
NOMINATIONS.  Our bylaws provide that stockholders seeking to bring business
before an annual meeting of stockholders must provide timely notice thereof in
writing. To be timely, a stockholder's notice must be delivered to or mailed and
received at our principal executive offices not less than 30 nor more than 60
days prior to the annual meeting. If less than 40 days notice has been given to
the stockholders for the meeting, notice by the stockholder, to be timely, must
be received not later than the close of business on the 10th day following the
date on which notice of the meeting is given to stockholders.

Our bylaws also specify certain requirements as to the form and content of a
stockholder's notice. These provisions may preclude stockholders from bringing
matters before an annual meeting.

SPECIAL MEETINGS OF STOCKHOLDERS.  Our bylaws provide that only a majority of
the board of directors, the chairman of our board of directors or our president
or chief executive officer may call a special meeting of our stockholders.

PREFERRED STOCK.  The board of directors may, without action by the
stockholders, designate and issue preferred stock in one or more series and
designate the rights, preferences and privileges of each series, which may be
greater than the rights of the common stock. We cannot predict the effect of the
issuance of any shares of preferred stock upon the rights of holders of our
common stock until the board of directors

                                       60
<PAGE>
determines the specific rights of the holders of our preferred stock. However,
the effects could include one or more of the following:

  o    restricting dividends on our common stock;

  o    diluting the voting power of our common stock;

  o    impairing the liquidation rights of our common stock; or

  o    discouraging or preventing a change in our control.

LIMITATION OF LIABILITY AND INDEMNIFICATION MATTERS

Section 145 of the Delaware General Corporation Law authorizes a corporation's
board of directors to indemnify directors and officers in terms sufficiently
broad to permit indemnification under certain circumstances for liabilities,
including reimbursement for expenses incurred, arising under the Securities Act.

As permitted by Delaware law, our amended and restated certificate of
incorporation includes a provision that eliminates the personal liability of our
directors for monetary damages for breach of fiduciary duty as a director,
except for liability:

  o    for any breach of the director's duty of loyalty to us or our
       stockholders;

  o    for acts or omissions not in good faith or that involve intentional
       misconduct or a knowing violation of law;

  o    under Section 174 of the Delaware General Corporation Law regarding
       unlawful dividends and stock purchases; or

  o    for any transaction from which the director derived an improper personal
       benefit.

As permitted by Delaware law, our bylaws provide that:

  o    we must indemnify our directors and officers to the fullest extent
       permitted by Delaware law;

  o    we must advance expenses, as incurred, to our directors and officers in
       connection with a legal proceeding, subject to certain limited
       exceptions; and

  o    the rights conferred in the bylaws are not exclusive.

We have entered into indemnification agreements with each of our officers and
directors to give them additional contractual assurances regarding the scope of
the indemnification provided in our amended and restated certificate of
incorporation and bylaws and to provide additional procedural protections. These
agreements, among other things, require us to indemnify each director and
officer to the fullest extent permitted by Delaware law, including
indemnification for expenses such as attorneys' fees, judgments, fines and
settlement amounts incurred by the director or officer in any action or
proceeding, including any action by or in the right of us, arising out of the
person's services as a director or officer of us, any subsidiary of ours or any
other company or enterprise to which the person provides services at our
request. At present, we are not aware of any pending or threatened litigation or
proceeding involving any of our directors, officers, employees or agents where
indemnification would be required or permitted. We believe that the provisions
of our amended and restated articles of incorporation, bylaws and these
indemnification agreements are necessary to attract and retain qualified persons
as directors and officers.

TRANSFER AGENT AND REGISTRAR

The transfer agent and registrar for our common stock is American Stock Transfer
and Trust Company, New York, New York.

LISTING

We have applied for quotation of the common stock on the Nasdaq National Market
under the symbol "TNOX."

                                       61
<PAGE>
                        SHARES ELIGIBLE FOR FUTURE SALE

Immediately prior to this offering, there was no public market for our common
stock. Future sales of substantial amounts of common stock in the public market
or the perception that sales could occur, could adversely affect the market
price of our common stock and our ability to sell equity securities.

When we complete this offering, we will have a total of 40,973,123 shares of
common stock outstanding. The 7,000,000 shares offered by this prospectus will
be freely tradeable unless they are purchased by our "affiliates," as defined
in Rule 144 under the Securities Act. Shares purchased by affiliates may
generally only be sold pursuant to an effective registration statement under the
Securities Act or in compliance with Rule 144 as described below. The remaining
shares are "restricted," which means they were originally sold in offerings
that were not subject to a registration statement filed with the Securities and
Exchange Commission. These restricted shares may be resold only through
registration under the Securities Act or under an available exemption from
registration, such as provided through Rule 144.

Directors and officers and stockholders who together own 32,338,553 shares of
common stock will be subject to lock-up agreements providing that they will not
offer, sell or otherwise dispose of common stock owned by them, other than
shares of common stock acquired in this offering, for a period of 180 days after
the date of this prospectus. CIBC World Markets Corp., however, may in its sole
discretion, at any time, without notice, release all or any portion of the
shares subject to lock-up agreements. Upon expiration of the lock-up agreements,
7,355,466 shares will become eligible for sale pursuant to Rule 144(k),
21,655,760 shares will become eligible for sale under Rule 144 and 2,064,372
shares will become eligible for sale under Rule 701.

RULE 144

Generally, Rule 144 as currently in effect provides that, beginning 90 days
after the first date of this prospectus, a person who has beneficially owned
shares of our common stock for at least one year may sell within any three-month
period, a number of shares that does not exceed the greater of:

  o    1% of the number of shares of common stock then outstanding, which, based
       on the shares outstanding as of March 31, 2000 will equal approximately
       339,731 shares; or

  o    the average weekly trading volume of the common stock on the Nasdaq
       National Market during the four calendar weeks preceding the filing of
       the notice on Form 144 with respect to the sale.

Rule 144 provides limitations on the manner of sales and imposes requirements as
to notice and the availability of current public information about us.

RULE 144(K)

Under Rule 144(k), a person who has not been one of our affiliates at any time
during the 90 days preceding a sale, and who has beneficially owned the shares
proposed to be sold for at least two years, may sell his or her shares without
complying with the manner of sale, public information, volume limitation or
notice provisions of Rule 144. Therefore, unless otherwise restricted, a person
who has been a non-affiliate for at least two years may sell his or her shares
in the open market immediately after the lock-up agreements expire.

RULE 701

Rule 701 permits any of our employees, officers, directors, or consultants who
purchased their shares under a compensatory stock or option plan or other
written agreement pursuant to options granted prior to the effective date of
this offering and who are not an affiliate to sell these shares under Rule 144
without complying with the holding period, public information, volume limitation
or notice requirements of Rule 144. Rule 701 permits these persons who are our
affiliates to sell these shares without complying with the holding period
requirement of Rule 144. All holders of Rule 701 shares may not sell their Rule
701 shares

                                       62
<PAGE>
until 90 days after the date of this prospectus. However, substantially all
shares of our common stock issued under Rule 701 are subject to lock-up
agreements described above.

Shortly following the date of this prospectus, we intend to file a registration
statement on Form S-8 under the Securities Act covering shares of common stock
reserved for issuance under our stock option plans. Shares registered under this
registration statement will, subject to Rule 144 volume limitations applicable
to our affiliates, be available for sale in the open market immediately after
the lock-up agreements expire. As of March 31, 2000, an aggregate of 2,586,993
shares of common stock were subject to outstanding options.

REGISTRATION RIGHTS

As of March 31, 2000, holders of 21,539,756 shares of common stock will be
entitled to certain rights with respect to the registration of those shares
under the Securities Act. After we register these shares, they will be freely
tradeable. For a description of these rights, see "Description of Capital
Stock."

                                       63
<PAGE>
                                  UNDERWRITING

We have entered into an underwriting agreement with the underwriters named
below. CIBC World Markets Corp., FleetBoston Robertson Stephens Inc., Warburg
Dillon Read LLC, Adams, Harkness & Hill, Inc. and KBC Securities Inc. are acting
as representatives of the underwriters.

The underwriting agreement provides for the purchase of a specific number of
shares of common stock by each of the underwriters. The underwriters'
obligations are several, which means that each underwriter is required to
purchase a specified number of shares, but is not responsible for the commitment
of any other underwriter to purchase shares. Subject to the terms and conditions
of the underwriting agreement, each underwriter has severally agreed to purchase
the number of shares of common stock set forth opposite its name below:

UNDERWRITER                             NUMBER OF SHARES
- -------------------------------------   -----------------
CIBC World Markets Corp..............
FleetBoston Robertson Stephens
Inc..................................
Warburg Dillon Read LLC..............
Adams, Harkness & Hill, Inc..........
KBC Securities Inc...................
                                        -----------------
  Total..............................         7,000,000
                                        =================

The underwriters have agreed to purchase all of the shares offered by this
prospectus (other than those covered by the over-allotment option described
below) if any are purchased. Under the underwriting agreement, if an underwriter
defaults in its commitment to purchase shares, the commitments of non-defaulting
underwriters may be increased or the underwriting agreement may be terminated,
depending on the circumstances.

The shares should be ready for delivery on or about             , 2000, against
payment in immediately available funds. The representatives have advised us that
the underwriters propose to offer the shares directly to the public at the
public offering price that appears on the cover page of this prospectus. In
addition, the representatives may offer some of the shares to other securities
dealers at such price less a concession of $   per share. The underwriters may
also allow, and such dealers may reallow, a concession not in excess of $   per
share to other dealers. After the shares are released for sale to the public,
the representatives may change the offering price and other selling terms at
various times.

We have granted the underwriters an over-allotment option. This option, which is
exercisable for up to 30 days after the date of this prospectus, permits the
underwriters to purchase a maximum of 1,050,000 additional shares from us to
cover over-allotments. If the underwriters exercise all or part of this option,
they will purchase shares covered by the option at the initial public offering
price that appears on the cover page of this prospectus, less the underwriting
discount. If this option is exercised in full, the total price to the public
will be $     , and the total proceeds to us will be $            . The
underwriters have severally agreed that, to the extent the over-allotment option
is exercised, they will each purchase a number of additional shares
proportionate to the underwriter's initial amount reflected in the above table.

The following table provides information regarding the amount of the discount to
be paid to the underwriters by us:

                         TOTAL WITHOUT EXERCISE OF   TOTAL WITH FULL EXERCISE OF
              PER SHARE    OVER-ALLOTMENT OPTION        OVER-ALLOTMENT OPTION
              ---------  -------------------------   ---------------------------
Tanox......   $               $                            $

We estimate that our total expenses of the offering, excluding the underwriting
discount, will be approximately $          .

We have agreed to indemnify the underwriters against certain liabilities,
including liabilities under the Securities Act.

                                       64
<PAGE>
KBC Bank, N.V., an affiliate of KBC Securities, Inc., one of our underwriters,
has agreed with John Blickenstaff, our Vice President of Administration,
Secretary and Treasurer, and one of our other employees, to purchase, at the
option of Mr. Blickenstaff and our other employee, shares of common stock having
a value of up to $3.7 million at the initial public offering price or, if the
offering is not completed by May 16, 2000, at $28.50 per share, less a discount
of seven percent. KBC will not resell any shares acquired under the agreement in
this offering. KBC has also agreed not to resell these shares except in limited
circumstances where the resale would be registered with the Securities and
Exchange Commission under the Securities Act or subject to an exemption
therefrom.

We and our officers and directors and substantially all other stockholders have
agreed to a 180-day "lock up" with respect to 33,338,553 shares of common
stock that they beneficially own, including securities that are convertible into
shares of common stock and securities that are exchangeable or exercisable for
shares of common stock. This means that, subject to certain exceptions, for a
period of 180 days following the date of this prospectus, we and such persons
may not offer, sell, pledge or otherwise dispose of these securities without the
prior written consent of CIBC World Markets Corp.

The representatives have informed us that they do not expect discretionary sales
by the underwriters to exceed 5% of the shares offered by this prospectus.

There is no established trading market for the shares. The offering price for
the shares has been determined by us and the representatives, based on the
following factors:

  o    prevailing market and general economic conditions;

  o    our financial information;

  o    our history and prospects;

  o    Tanox and the industry in which we compete;

  o    an assessment of our management, its past and present operations, and the
       prospects for, and timing of, our future revenues; and

  o    the present stage of our development and the above factors in relation to
       the market values and various valuation measures of other companies
       engaged in activities similar to ours.

Rules of the Securities and Exchange Commission may limit the ability of the
underwriters to bid for or purchase shares before the distribution of the shares
is completed. However, the underwriters may engage in the following activities
in accordance with the rules:

  o    Stabilizing transactions -- The representatives may make bids or
       purchases for the purpose of pegging, fixing or maintaining the price of
       the shares, so long as stabilizing bids do not exceed a specified
       maximum.

  o    Over-allotment and syndicate covering transactions -- The underwriters
       may create a short position in the shares by selling more shares than are
       set forth on the cover page of this prospectus. If a short position is
       created in connection with the offering, the representatives may engage
       in syndicate covering transactions by purchasing shares in the open
       market. The representatives may also elect to reduce any short position
       by exercising all or part of the over-allotment option.

  o    Penalty bids -- If the representatives purchase shares in the open market
       in a stabilizing transaction or syndicate covering transaction, they may
       reclaim a selling concession from the underwriters and selling group
       members who sold those shares as part of this offering.

Stabilization and syndicate covering transactions may cause the price of the
shares to be higher than it would be in the absence of such transactions. The
imposition of a penalty bid might also have an effect on the price of the shares
if it discourages resales of the shares.

Neither we nor the underwriters make any representation or prediction as to the
effect that the transactions described above may have on the price of the
shares. These transactions may occur on the Nasdaq National Market or otherwise.
If such transactions are commenced, they may be discontinued without notice at
any time.

                                       65
<PAGE>
                                 LEGAL MATTERS

Chamberlain, Hrdlicka, White, Williams & Martin, Houston, Texas will pass upon
certain legal matters with respect to the legality of the issuance of the shares
of common stock offered by this prospectus. Skadden, Arps, Slate, Meagher & Flom
(Illinois), Chicago, Illinois will pass upon certain legal matters in connection
with this offering for the underwriters.

Wilburn O. McDonald, Jr., and seven other shareholders of Chamberlain, Hrdlicka,
White, Williams & Martin, hold an aggregate of 9,266 shares of our common stock.

                                    EXPERTS

The financial statements as of December 31, 1998 and 1999, and for each of the
three years in the period ended December 31, 1999 included in this prospectus
and elsewhere in the Registration Statement have been audited by Arthur Andersen
LLP, independent public accountants, as indicated in their report with respect
thereto, and are included herein in reliance upon the authority of said firm as
experts in giving said report.

Certain legal matters with respect to the statements in this prospectus under
the captions "Risk Factors -- We depend on our patents and proprietary rights.
The validity, enforceability and commercial value of these rights are highly
uncertain," and "Business -- Patents and Proprietary Rights" have been
reviewed and approved by Chamberlain, Hrdlicka, White, Williams & Martin,
Houston, Texas, our patent counsel who are experts in these matters and are
subject to an opinion to be rendered to the underwriters. We are including this
information relying on their review and approval.

                      WHERE YOU CAN FIND MORE INFORMATION

We have filed a registration statement on Form S-1 with the Securities and
Exchange Commission in connection with this offering. In addition, upon
completion of the offering, we must file annual, quarterly and current reports,
proxy statements and other information with the Securities and Exchange
Commission.

You may read and copy the registration statement and any other documents filed
by us at the Securities and Exchange Commission's Public Reference Room at 450
Fifth Street, N.W., Washington, D.C. 20549. Please call the Securities and
Exchange Commission at 1-800-SEC-0330 for further information on the Public
Reference Room. Our Securities and Exchange Commission filings are also
available to the public at the Securities and Exchange Commission's Internet
site at "http://www.sec.gov."

This prospectus is part of the registration statement and does not contain all
of the information included in the registration statement. Whenever a reference
is made in this prospectus to any contract or other document of ours, the
reference may not be complete and you should refer to the exhibits that are a
part of the registration statement for a copy of the contract or document.

After the offering, we intend to provide annual reports to our stockholders that
include financial information examined and reported on by an independent public
accounting firm.

                                       66

<PAGE>
                                  TANOX, INC.
                   INDEX TO CONSOLIDATED FINANCIAL STATEMENTS

                                                                            PAGE
                                                                            ----
Report of Independent Public Accountants .................................   F-2
Consolidated Balance Sheets as of December 31, 1998 and 1999 .............   F-3
Consolidated Statements of Operations and Comprehensive
  Income (Loss) for the years ended December 31, 1997,
  1998 and 1999 ..........................................................   F-4
Consolidated Statements of Stockholders' Equity for the years
  ended December 31, 1997, 1998 and 1999 .................................   F-5
Consolidated Statements of Cash Flows for the years ended
  December 31, 1997, 1998 and 1999 .......................................   F-6
Notes to Consolidated Financial Statements ...............................   F-7

                                      F-1
<PAGE>
                    REPORT OF INDEPENDENT PUBLIC ACCOUNTANTS

To the Board of Directors of
Tanox, Inc.:

We have audited the accompanying consolidated balance sheets of Tanox, Inc., a
Delaware corporation, and subsidiaries as of December 31, 1998 and 1999, and the
related consolidated statements of operations and comprehensive income (loss),
stockholders' equity and cash flows for each of the three years in the period
ended December 31, 1999. These consolidated financial statements are the
responsibility of the Company's management. Our responsibility is to express an
opinion on these consolidated financial statements based on our audits.

We conducted our audits in accordance with generally accepted auditing
standards. Those standards require that we plan and perform the audit to obtain
reasonable assurance about whether the consolidated financial statements are
free of material misstatement. An audit includes examining, on a test basis,
evidence supporting the amounts and disclosures in the consolidated financial
statements. An audit also includes assessing the accounting principles used and
significant estimates made by management, as well as evaluating the overall
financial statement presentation. We believe that our audits provide a
reasonable basis for our opinion.

In our opinion, the consolidated financial statements referred to above present
fairly, in all material respects, the financial position of Tanox, Inc., and
subsidiaries as of December 31, 1998 and 1999, and the results of their
operations and their cash flows for each of the three years in the period
December 31, 1999, in conformity with generally accepted accounting principles.

ARTHUR ANDERSEN LLP

Houston, Texas
February 1, 2000

                                      F-2
<PAGE>
                                  TANOX, INC.
                          CONSOLIDATED BALANCE SHEETS

                                               DECEMBER 31,
                                       ----------------------------
                                           1998           1999
                                       -------------  -------------
               ASSETS
CURRENT ASSETS:
     Cash and cash equivalents.......  $  28,352,000  $  44,242,000
     Short-term investments..........      5,383,000      3,012,000
     Accounts receivable.............         74,000        125,000
     Interest receivable.............        253,000        414,000
     Income taxes receivable.........      2,052,000        132,000
     Prepaid expenses................         91,000        114,000
                                       -------------  -------------
          Total current assets.......     36,205,000     48,039,000
PROPERTY AND EQUIPMENT:
     Laboratory and office
      equipment......................      8,709,000      9,369,000
     Leasehold improvements..........      1,902,000      2,102,000
     Furniture and fixtures..........         92,000        119,000
                                       -------------  -------------
                                          10,703,000     11,590,000
     Less -- Accumulated depreciation
      and amortization...............     (3,577,000)    (4,577,000)
                                       -------------  -------------
          Net property and
             equipment...............      7,126,000      7,013,000
OTHER ASSETS, net of accumulated
     amortization of $25,000 and
     $59,000, respectively...........         91,000        276,000
                                       -------------  -------------
          Total assets...............  $  43,422,000  $  55,328,000
                                       =============  =============

LIABILITIES AND STOCKHOLDERS' EQUITY
CURRENT LIABILITIES:
     Accounts payable................  $     802,000  $     874,000
     Accrued liabilities.............      1,080,000        947,000
     Accrued arbitration award.......       --            3,500,000
                                       -------------  -------------
          Total current
             liabilities.............      1,882,000      5,321,000
NOTE PAYABLE TO RELATED PARTY........     10,000,000     10,000,000
COMMITMENTS AND CONTINGENCIES
STOCKHOLDERS' EQUITY:
     Preferred stock, $.01 par value;
      10,000,000 shares authorized;
      none outstanding...............       --             --
     Common stock, $.01 par value;
      120,000,000 shares authorized;
      29,310,175 shares in 1998 and
      33,324,402 shares in 1999
      issued and outstanding.........        293,000        333,000
     Additional paid-in capital......     39,266,000     71,701,000
     Deferred compensation...........       (902,000)      (651,000)
     Loans receivable from
      employees......................       --           (1,086,000)
     Other comprehensive income,
      cumulative translation
      adjustment.....................         (2,000)       171,000
     Retained earnings (deficit).....     (7,115,000)   (30,461,000)
                                       -------------  -------------
          Total stockholders'
             equity..................     31,540,000     40,007,000
                                       -------------  -------------
          Total liabilities and
             stockholders' equity....  $  43,422,000     55,328,000
                                       =============  =============

  The accompanying notes are an integral part of these consolidated financial
                                  statements.

                                      F-3
<PAGE>
                                  TANOX, INC.
                     CONSOLIDATED STATEMENTS OF OPERATIONS
                        AND COMPREHENSIVE INCOME (LOSS)

<TABLE>
<CAPTION>
                                             FOR THE YEAR ENDED DECEMBER 31,
                                       --------------------------------------------
                                           1997           1998            1999
                                       ------------  --------------  --------------
<S>                                    <C>           <C>             <C>
REVENUES:
     Development agreement with
       related party.................  $  1,271,000  $    2,369,000  $    1,063,000
     Other development agreements and
       licensing fees................     7,668,000          53,000         342,000
                                       ------------  --------------  --------------
               Total revenues........     8,939,000       2,422,000       1,405,000
OPERATING COSTS AND EXPENSES:
     Research and development........     6,926,000      11,933,000      17,163,000
     General and administrative......     2,230,000       3,431,000       8,582,000
                                       ------------  --------------  --------------
               Total operating costs
                 and expenses........     9,156,000      15,364,000      25,745,000
                                       ------------  --------------  --------------
LOSS FROM OPERATIONS.................      (217,000)    (12,942,000)    (24,340,000)
OTHER INCOME (EXPENSE):
     Interest income.................     1,684,000       2,061,000       1,884,000
     Interest expense................      (639,000)       (825,000)       (741,000)
     Other...........................       --                4,000        (115,000)
                                       ------------  --------------  --------------
               Total other income....     1,045,000       1,240,000       1,028,000
                                       ------------  --------------  --------------
INCOME (LOSS) BEFORE INCOME TAXES....       828,000     (11,702,000)    (23,312,000)
               (Provision) benefit of
                 income taxes........      (198,000)      1,533,000         (34,000)
                                       ------------  --------------  --------------
NET INCOME (LOSS)....................  $    630,000  $  (10,169,000) $  (23,346,000)
                                       ============  ==============  ==============
EARNINGS (LOSS) PER SHARE:
     Basic...........................  $       0.02  $        (0.35) $        (0.75)
                                       ============  ==============  ==============
     Diluted.........................  $       0.02  $        (0.35) $        (0.75)
                                       ============  ==============  ==============
SHARES USED IN COMPUTING EARNINGS
  (LOSS) PER SHARE:
     Basic...........................    27,909,000      29,105,000      31,113,000
                                       ============  ==============  ==============
     Diluted.........................    31,190,000      29,105,000      31,113,000
                                       ============  ==============  ==============
COMPREHENSIVE NET INCOME (LOSS):
     Net income (loss)...............  $    630,000  $  (10,169,000) $  (23,346,000)
     Foreign currency translation
       adjustment....................       --               (2,000)        173,000
                                       ------------  --------------  --------------
TOTAL COMPREHENSIVE NET INCOME
  (LOSS).............................  $    630,000  $  (10,171,000) $  (23,173,000)
                                       ============  ==============  ==============
</TABLE>

  The accompanying notes are an integral part of these consolidated financial
                                  statements.

                                      F-4
<PAGE>
                                  TANOX, INC.
                CONSOLIDATED STATEMENTS OF STOCKHOLDERS' EQUITY
              FOR THE YEARS ENDED DECEMBER 31, 1997, 1998 AND 1999
<TABLE>
<CAPTION>
                                                                                                                LOANS
                                           COMMON STOCK                                                       RECEIVABLE
                                       ---------------------      ADDITIONAL         DEFERRED      TREASURY      FROM
                                        SHARES     PAR VALUE    PAID-IN CAPITAL    COMPENSATION     STOCK     EMPLOYEES
                                       ---------   ---------    ---------------    ------------    --------   ----------
<S>                                    <C>         <C>          <C>                <C>             <C>        <C>
BALANCES, December 31, 1996..........  26,215,004  $262,000       $13,125,000       $  --          $ --       $   --
    Issuance of common stock for
      cash, $7.50 per share, net of
      issuance costs.................   2,331,262    23,000        17,308,000          --            --           --
    Purchase of treasury stock,
      10,425 shares..................     --          --             --                --          (78,000)       --
    Issuance of common stock upon
      exercise of stock options......      36,614     1,000            (9,000)         --           78,000        --
    Capital contribution from
      forgiveness of interest by
      related party..................     --          --              639,000          --            --           --
    Deferred compensation related to
      stock options..................     --          --              750,000         (750,000)      --           --
    Amortization of deferred
      compensation related to stock
      options........................     --          --             --                 25,000       --           --
    Net income.......................     --          --             --                --            --           --
                                       ----------  --------       -----------       ----------     --------   -----------
BALANCES, December 31, 1997..........  28,582,880   286,000        31,813,000         (725,000)      --           --
    Issuance of common stock for
      cash, $11.25 per share, net of
      issuance costs.................     273,686     3,000         3,046,000          --            --           --
    Issuance of common stock upon
      exercise of stock options......     230,400     2,000           223,000          --            --           --
    Exchange of mature common stock
      to exercise stock options......      (3,200)    --              (36,000)         --            --           --
    Issuance of common stock to
      acquire foreign subsidiary.....     226,409     2,000         2,545,000          --            --           --
    Income tax benefit from stock
      options exercised..............     --          --              400,000          --            --           --
    Capital contribution from
      forgiveness of interest by
      related party..................     --          --              825,000          --            --           --
    Deferred compensation related to
      stock options..................     --          --              450,000         (450,000)      --           --
    Amortization of deferred
      compensation related to stock
      options........................     --          --             --                273,000       --           --
    Exchange translation
      adjustment.....................     --          --             --                --            --           --
    Net loss.........................     --          --             --                --            --           --
                                       ----------  --------       -----------       ----------     --------   -----------
BALANCES, December 31, 1998..........  29,310,175   293,000        39,266,000         (902,000)      --           --
    Issuance of common stock for
      cash, $12.50 per share, net of
      issuance costs.................   1,896,000    19,000        22,907,000          --            --           --
    Issuance of common stock upon
      exercise of stock options......   1,789,520    18,000         1,131,000          --            --           --
    Issuance of common stock on a net
      issuance basis upon exercise of
      warrants.......................      86,632     --             --                --            --           --
    Issuance of common stock to
      acquire foreign subsidiary.....     242,075     3,000         3,023,000          --            --           --
    Capital contribution from
      forgiveness of interest by
      related party..................     --          --              738,000          --            --           --
    Deferred compensation related to
      stock options..................     --          --            4,636,000          (60,000)      --           --
    Amortization of deferred
      compensation related to stock
      options........................     --          --             --                311,000       --           --
    Loans receivable from
      employees......................     --          --             --                --            --       (1,086,000)
    Exchange translation
      adjustment.....................     --          --             --                --            --           --
    Net loss.........................     --          --             --                --            --           --
                                       ----------  --------       -----------       ----------     --------   -----------
BALANCES, December 31, 1999..........  33,324,402  $333,000       $71,701,000       $ (651,000)    $ --       $(1,086,000)
                                       ==========  ========       ===========       ==========     ========   ===========

                                           OTHER
                                       COMPREHENSIVE
                                          INCOME-
                                        CUMULATIVE      RETAINED         TOTAL
                                        TRANSLATION     EARNINGS     STOCKHOLDERS'
                                        ADJUSTMENT      (DEFICIT)       EQUITY
                                       -------------   -----------   -------------
BALANCES, December 31, 1996..........    $ --          $ 2,424,000    $15,811,000
    Issuance of common stock for
      cash, $7.50 per share, net of
      issuance costs.................      --              --          17,331,000
    Purchase of treasury stock,
      10,425 shares..................      --              --             (78,000)
    Issuance of common stock upon
      exercise of stock options......      --              --              70,000
    Capital contribution from
      forgiveness of interest by
      related party..................      --              --             639,000
    Deferred compensation related to
      stock options..................      --              --             --
    Amortization of deferred
      compensation related to stock
      options........................      --              --              25,000
    Net income.......................      --              630,000        630,000
                                       -------------   ------------   -----------
BALANCES, December 31, 1997..........      --            3,054,000     34,428,000
    Issuance of common stock for
      cash, $11.25 per share, net of
      issuance costs.................      --              --           3,049,000
    Issuance of common stock upon
      exercise of stock options......      --              --             225,000
    Exchange of mature common stock
      to exercise stock options......      --              --             (36,000)
    Issuance of common stock to
      acquire foreign subsidiary.....      --              --           2,547,000
    Income tax benefit from stock
      options exercised..............      --              --             400,000
    Capital contribution from
      forgiveness of interest by
      related party..................      --              --             825,000
    Deferred compensation related to
      stock options..................      --              --             --
    Amortization of deferred
      compensation related to stock
      options........................      --              --             273,000
    Exchange translation
      adjustment.....................       (2,000)        --              (2,000)
    Net loss.........................      --          (10,169,000)   (10,169,000)
                                       -------------   ------------   -----------
BALANCES, December 31, 1998..........       (2,000)     (7,115,000)    31,540,000
    Issuance of common stock for
      cash, $12.50 per share, net of
      issuance costs.................      --              --          22,926,000
    Issuance of common stock upon
      exercise of stock options......      --              --           1,149,000
    Issuance of common stock on a net
      issuance basis upon exercise of
      warrants.......................      --              --             --
    Issuance of common stock to
      acquire foreign subsidiary.....      --              --           3,026,000
    Capital contribution from
      forgiveness of interest by
      related party..................      --              --             738,000
    Deferred compensation related to
      stock options..................      --              --           4,576,000
    Amortization of deferred
      compensation related to stock
      options........................      --              --             311,000
    Loans receivable from
      employees......................      --              --          (1,086,000)
    Exchange translation
      adjustment.....................      173,000         --             173,000
    Net loss.........................      --          (23,346,000)   (23,346,000)
                                       -------------   ------------   -----------
BALANCES, December 31, 1999..........    $ 171,000     $(30,461,000)  $40,007,000
                                       =============   ============   ===========
</TABLE>

  The accompanying notes are an integral part of these consolidated financial
                                  statements.

                                      F-5
<PAGE>
                                  TANOX, INC.
                     CONSOLIDATED STATEMENTS OF CASH FLOWS


                                             FOR THE YEAR ENDED DECEMBER 31,
                                       ----------------------------------------
                                           1997           1998           1999
                                       -----------  --------------  -----------
CASH FLOWS FROM OPERATING ACTIVITIES:
     Net income (loss)...............  $   630,000  $ (10,169,000) $23,346,000)
     Adjustments to reconcile net
       income (loss) to net cash used
       in operating activities --
          Depreciation and
            amortization.............      199,000        934,000    1,034,000
          Interest expense forgiven
            by related party.........      639,000        825,000      738,000
          Amortization of deferred
            compensation related to
            stock options............       25,000        273,000    4,887,000
          In-process research and
            development..............     --            2,798,000    3,359,000
     Changes in operating assets and
       liabilities --
          Increase in accounts and
            interest receivables and
            prepaid expenses.........      (17,000)       (15,000)    (235,000)
          Change in taxes receivable
            or payable...............     (463,000)    (1,576,000)   1,920,000
          (Decrease) increase in
            accounts payable and
            accrued liabilities......     (694,000)       391,000    3,439,000
          Decrease in collaboration
            advances.................     (500,000)      --           --
                                       -----------  -------------  -----------
               Net cash used in
                 operating
                 activities..........     (181,000)    (6,539,000)  (8,204,000)
                                       -----------  -------------  -----------
CASH FLOWS FROM INVESTING ACTIVITIES:
     Purchase of short-term
       investments...................      --          (9,517,000) (12,082,000)
     Maturity of short-term
       investments...................      --           4,134,000   14,453,000
     Purchases of property and
       equipment.....................     (520,000)     (455,000)     (887,000)
     Increase in other assets........     --            --            (219,000)
     Purchase of wholly owned
       subsidiary (net of cash
       acquired).....................     --            (364,000)     (333,000)
                                       -----------  ------------  ------------
               Net cash provided by
                 (used in) investing
                 activities..........     (520,000)   (6,202,000)      932,000
                                       -----------  ------------  ------------
CASH FLOWS FROM FINANCING ACTIVITIES:
     Proceeds of note payable to
       related party.................    2,000,000     1,000,000      --
     Issuance of employee loans in
       connection with the exercise
       of stock options..............     --            --          (1,086,000)
     Proceeds from issuance of common
       stock.........................   17,401,000     3,238,000    24,075,000
     Purchases of treasury stock.....      (78,000)     --            --
                                       -----------  ------------  ------------
          Net cash provided by
            financing activities.....   19,323,000     4,238,000    22,989,000
IMPACT OF EXCHANGE RATES ON CASH.....     --              (2,000)      173,000
                                       -----------  ------------  ------------
INCREASE (DECREASE) IN CASH AND CASH
  EQUIVALENTS........................   18,622,000    (8,505,000)   15,890,000
CASH AND CASH EQUIVALENTS, beginning
  of year............................   18,235,000    36,857,000    28,352,000
                                       -----------  ------------  ------------
CASH AND CASH EQUIVALENTS, end of
  year...............................  $36,857,000  $ 28,352,000  $ 44,242,000
                                       ============ ============  ============
SUPPLEMENTAL DISCLOSURE OF CASH FLOW
  INFORMATION:
     Cash paid during the year for
       taxes.........................  $    661,000 $     37,000  $    137,000
     Noncash investing and financing
       activities --
          Capital contribution from
            forgiveness of interest
            by a related party.......       639,000      825,000       738,000
          Receivable related to
            income tax benefit from
            stock options
            exercised................      --            400,000          --


  The accompanying notes are an integral part of these consolidated financial
                                  statements.

                                      F-6

<PAGE>
                                  TANOX, INC.
                   NOTES TO CONSOLIDATED FINANCIAL STATEMENTS

1.  ORGANIZATION, BUSINESS AND RISK FACTORS:

Tanox, Inc. (Tanox), was formerly known as Tanox Biosystems, Inc. and was
originally incorporated as a Texas corporation on March 19, 1986. Tanox was
reincorporated in Delaware in January 2000. Tanox is engaged in the discovery
and development of therapeutic products that beneficially influence or are
derived from the immune system. Tanox is focusing its product development
efforts on therapeutics in three broad areas: immunology (asthma/allergy,
autoimmune diseases and inflammation), infectious diseases and oncology.

Tanox has not yet generated any significant revenues from product sales, nor is
there any assurance of significant future revenues from product sales. The
research and development activities engaged in by Tanox involve a high degree of
risk and uncertainty. The ability of Tanox to successfully develop, manufacture
and market its proprietary products is dependent upon many factors. These
factors could include, but are not limited to, the need for additional
financing, the reliance on collaborative arrangements for research and
development, marketing and product commercialization and the ability to develop
or obtain manufacturing, sales and marketing capabilities. Additional factors
could include resolution of ongoing contingencies, including legal proceedings,
changes in the level of sponsored research revenue, uncertainties as to patents
and proprietary technologies, technological change and risk of obsolescence,
development of its products, competition, government regulations and regulatory
approval, and product liability exposure. As a result of the aforementioned
factors and related uncertainties, there can be no assurance of Tanox's future
success.

Tanox entered into a development and licensing agreement with Novartis Pharma AG
(Novartis) in May 1990. Under this agreement, Tanox and Novartis agreed to
jointly develop certain products for IgE-mediated diseases, including asthma and
allergies. Tanox received a contract payment upon signing the agreement and has
received additional contract payments and reimbursement payments upon the
occurrence of specified events. Under a separate agreement (the Stock
Agreement), Tanox and Novartis also agreed to the sale and purchase of shares of
Tanox's common stock. Sales of these shares were completed in May 1990, May 1992
and June 1994. Tanox notified Novartis of the termination of the Stock Agreement
as provided therein, and the termination was effective as of May 10, 1997.
Novartis owned approximately 19.1 percent of Tanox's outstanding common stock at
December 31, 1999.

On December 22, 1993, Tanox sued Genentech, Inc. (Genentech), F. Hoffman-La
Roche, Ltd., Roche Holdings, Inc., Roche Holding Ltd. and Hoffman-La Roche, Inc.
(collectively referred to as "Roche"), in Harris County District Court in
Houston, Texas. The action arose from collaboration discussions between Tanox
and Genentech in 1989 and 1990 relating to Tanox's anti-IgE product as a
treatment for IgE-mediated diseases, including allergy and asthma. In response,
Genentech filed suit against Tanox for patent infringement and subsequently
named Novartis in the suit. Tanox's litigation against Genentech and Roche and
Genentech's litigation against Tanox and Novartis were settled in July 1996.
Contemporaneously with the settlement, Genentech, Novartis and Tanox also
entered into a binding agreement in principle to combine their existing anti-IgE
antibody programs into a cooperative effort to develop and commercialize
selected anti-IgE antibodies (the Three-Party Collaboration). Tanox also entered
into additional licensing arrangements with Genentech. Tanox received an initial
payment upon entering into the Three-Party Collaboration and settling the
litigation. Tanox received and will receive additional milestone and royalty
payments upon the accomplishment of specified subsequent events. Novartis or
Genentech may terminate their participation in the Three-Party Collaboration on
short notice, subject to reversion of product rights to Tanox and the remaining
collaborator.

                                      F-7
<PAGE>
                                  TANOX, INC.
           NOTES TO CONSOLIDATED FINANCIAL STATEMENTS -- (CONTINUED)

2.  ACQUISITION OF PANGENETICS B.V.:

In March 1998, Tanox acquired the common stock of Tanox Pharma B.V. (formerly
PanGenetics), a biotechnology company located in Amsterdam, The Netherlands.
Tanox recorded the transaction for accounting purposes as a purchase, and the
consolidated financial statements include the operations of Tanox Pharma
subsequent to the acquisition date. Under the terms of the agreement, Tanox
purchased Tanox Pharma for an initial cash payment of $508,000 and 226,409
shares of common stock, valued at $11.25 per share, for a total initial
consideration of $3,055,000. In addition, Tanox agreed to pay future
consideration, in two installments, totaling up to $667,000 in cash and 484,147
shares of common stock upon occurrence of specified future events. These events
include originating at least three additional reseach projects within a three
year period, retaining the services of two individuals for 36 months and
maintaining a certain level of government grants and subsidies. Any additional
consideration will be paid to all shareholders in proportion to their ownership
at the acquisition date. In September 1999, Tanox made the second installment
payments of $333,000 in cash and 242,075 shares of common stock valued at $12.50
per share, for a total additional consideration of $3,359,000. If the specified
future events take place and the final future payment is made in March 2001,
Tanox will record an additional purchase price amount based on the cash paid and
fair value of the common stock issued at the time of payment.

Tanox engaged an independent firm to perform an appraisal of the assets acquired
in the transaction. The appraisal was completed and the report issued in 1998.
The acquisition of Tanox Pharma was accounted for under the purchase method of
accounting in which the aggregate purchase price was allocated to tangible and
intangible assets acquired based on their relative fair values as of the date of
the transactions. At the time of the acquisition, the total current and future
consideration of the acquisition was valued for accounting purposes at $9.2
million, based on the total of the cash and then fair value of common stock paid
to Tanox Pharma shareholders. Of this amount, we allocated approximately $0.2
million to tangible fixed assets, $0.1 million to intangible assets, $7.2
million to in-process research and development and $1.7 million to goodwill.

The valuation of acquired in-process research and development considered:

  o    the current technological feasibility, scientific and development states
       of the anti-CD40 research project;

  o    the expected amount of time and resources required to complete the
       projects;

  o    the alternative future use of the acquired research and development; and

  o    valuation and allocation approaches.

Tanox's ability to commercialize the acquired anti-CD40 research project is
affected by several risks. These risks include:

  o    Tanox's ability to construct low cost versions of the antibody;

  o    successful preclinical testing;

  o    successful completion of Phase I, II and III clinical testing;

  o    successful filing and acceptance of European and Japanese regulatory
       submissions;

  o    Tanox's ability to successfully commercialize the anti-CD40 monoclonal
       antibody by itself or in connection with a collaborative partner; and

  o    Tanox's ability to manufacture the anti-CD40 monoclonal antibody at a
       competitive cost.

                                      F-8
<PAGE>
                                  TANOX, INC.
           NOTES TO CONSOLIDATED FINANCIAL STATEMENTS -- (CONTINUED)

At the time of the acquisition, the anti-CD40 monoclonal antibody required
additional development work and preclinical testing to enter clinical trials. In
order for anti-CD40 to become a marketable product, it was necessary to conduct
several clinical trials and to improve the manufacturing of the product. Tanox
estimated at the time of the acquisition that it would take from seven to nine
years and cost at least $50 million to complete the development of the anti-CD40
product.

The initial purchase price installment was allocated as follows:

      In-process research and
        development........................  $  2,798,000
      Net working capital..................       125,000
      Intangible assets....................       100,000
      Tangible fixed assets................        22,000
      Noncurrent financial assets..........        10,000
                                             ------------
           Total...........................  $  3,055,000
                                             ============

The allocation of the second installment payment of $3,359,000 was assigned to
in-process research and development based on the appraisal. Accordingly, Tanox's
financial statements for the years ended December 31, 1998 and 1999 include a
charge of $2,798,000 in 1998 and $3,359,000 in 1999 for expensing the cost of
the in-process research and development. If the final purchase price payments
are made to the former shareholders of Tanox Pharma in 2001, Tanox anticipates
that the cost of such additional payments will be allocated to acquired
in-process research and development and goodwill based upon the appraisal
obtained as of the date of the acquisition.

If Tanox had acquired PanGenetics prior to January 1, 1997, the unaudited pro
forma financial results would have been as follows:

                                         1997          1998          1999
                                     -----------   -----------   ------------
Total assets.......................  $44,984,000   $43,422,000   $ 55,328,000
Total revenues.....................    9,384,000     2,439,000      1,405,000
Net income (loss)..................      557,000    (7,473,000)   (19,988,000)
Basic earnings (loss) per share....         0.02         (0.25)         (0.64)
Diluted earnings (loss) per share..         0.02         (0.25)         (0.64)

3.  SUMMARY OF SIGNIFICANT ACCOUNTING POLICIES:

  PRINCIPLES OF CONSOLIDATION

The accompanying consolidated financial statements include the accounts of Tanox
and its wholly owned subsidiaries, Tanox Pharma International, Inc., Tanox
Pharma B.V. and TanAsia Pharma, Ltd. Intercompany transactions and balances are
eliminated in consolidation.

  USE OF ESTIMATES

The preparation of consolidated financial statements in conformity with
generally accepted accounting principles requires management to make estimates
and assumptions that affect the reported amounts of assets and liabilities and
disclosure of contingent assets and liabilities at the date of the consolidated
financial statements and the reported amounts of expenses during the reporting
period. Actual results could differ from those estimates.

                                      F-9
<PAGE>
                                  TANOX, INC.
           NOTES TO CONSOLIDATED FINANCIAL STATEMENTS -- (CONTINUED)

  REVENUE RECOGNITION

Revenues associated with development agreements which include rights to license
or sublicense Tanox's technology or product rights are recognized when payments
are earned. Revenues earned under development agreements include payments for
milestone achievements and payments for sponsored research. Milestone payments
are received under best efforts contracts, and such revenues are not refundable.
Any revenue from milestones is recognized when the milestones are achieved and
there are no remaining performance obligations. Revenues earned in connection
with sponsored research are recognized as Tanox performs its obligations related
to such research. Any revenue contingent upon future performance by Tanox is
deferred and recognized as the performance is completed.

Tanox recognized revenues of $6.3 million, $2.4 million and $1.1 million during
1997, 1998 and 1999, respectively, under the Three-Party Collaboration described
in Note 1. Included in these revenues are milestone payments of $5.0 million,
$1.5 million and $1.0 million, respectively. The remainder of the revenues
related to sponsored research. Expenses incurred related to these agreements
were approximately $1.3 million, $0.2 million and $0.1 million in 1997, 1998 and
1999, respectively. Revenues from collaborative agreements with Novartis
accounted for 15 percent of 1997 revenues, 98 percent of 1998 revenues and 76
percent of 1999 revenues. Revenues from collaborative agreements with Genentech
accounted for 56 percent of 1997 revenues and none of 1998 and 1999 revenues. At
December 31, 1998, Tanox had accounts receivable of approximately $14,000 for
estimated costs reimbursable under the Three-Party Collaboration. There were no
receivables under the Three-Party Collaboration at December 31, 1999.

Tanox recognized revenues of $2.5 million in 1997 from advances for sponsored
research made to Tanox in 1996 and 1997 under a development and licensing
agreement (the Takara Agreement) with Takara Shuzo, Ltd.. The Takara Agreement
was concluded effective November 30, 1997. The Takara Agreement accounted for 28
percent of 1997 revenues.

  CASH EQUIVALENTS

Cash equivalents consist of highly liquid investments with an original maturity
of three months or less when purchased.

  SHORT-TERM INVESTMENTS

Short-term investments consist of U.S. Government agency debt obligations and
investment grade commercial paper with an original maturity greater than three
months but less than one year. Tanox's policy is to hold short-term investments
until maturity. Short-term investments are recorded at cost, which approximates
fair value. Tanox has no available-for-sale or trading securities.

  PROPERTY AND EQUIPMENT

Property and equipment is carried at cost and depreciated on a straight-line
basis over the estimated useful economic lives of the assets or, in the case of
leasehold improvements, over the remaining term of the lease. The estimated
useful lives employed in computing depreciation are three to seven years for
laboratory and office equipment, five to seven years for furniture and fixtures,
and the lesser of nine years or the remaining lease term for leasehold
improvements. When property is retired or otherwise disposed of, the cost and
accumulated depreciation are removed from the accounts and any resulting gain or
loss is included in income. Maintenance and repairs are charged to expense when
incurred.

                                      F-10
<PAGE>
                                  TANOX, INC.
           NOTES TO CONSOLIDATED FINANCIAL STATEMENTS -- (CONTINUED)

Tanox has adopted Statement of Financial Accounting Standards (SFAS) No. 121,
"Accounting for the Impairment of Long-Lived Assets and for Long-Lived Assets
to Be Disposed Of." Management periodically reviews long-lived assets and
certain identifiable intangibles whenever events or changes in circumstances
indicate that the carrying amount of an asset may not be recoverable. If factors
indicate that an asset should be evaluated for possible impairment, management
compares estimated undiscounted future operating cash flow from the related
asset to the carrying amount of the asset. If the carrying amount of the asset
were greater than undiscounted future operation cash flow, an impairment loss
would be recognized. Any impairment loss would be computed as the excess of the
carrying amount of the asset over the estimated fair value of the asset
(calculated based on discounting estimated future operating cash flows). The
application of SFAS No. 121 has had no material impact on Tanox's financial
position or results of operations.

  RESEARCH AND DEVELOPMENT

Research and development costs, including incidental patent costs, are expensed
as incurred.

  ACCRUED LIABILITIES

Accrued liabilities at December 31, 1998 and 1999, consist of the following:

                                                 1998         1999
                                             ------------  ----------
      Accrued payroll......................  $    413,000  $  282,000
      Accrued vacation.....................       178,000     153,000
      Accrued taxes........................       122,000      55,000
      Accrued rent.........................         7,000      24,000
      Accrued professional fees............       270,000     264,000
      Other................................        90,000     169,000
                                             ------------  ----------
                                             $  1,080,000  $  947,000
                                             ============  ==========

See Note 9 for discussion of accrued arbitration award as of December 31, 1999.

  INCOME TAXES

Tanox accounts for income taxes using the liability method prescribed by SFAS
No. 109, "Accounting for Income Taxes." Under this method, deferred income tax
assets and liabilities reflect the impact of temporary differences between the
financial accounting and tax bases of assets and liabilities and are measured
using the enacted tax rates and laws that will be in effect when the differences
are expected to reverse.

  FOREIGN CURRENCY TRANSACTIONS AND TRANSLATIONS

The balance sheet accounts of Tanox are translated into U.S. dollars at exchange
rates in effect on reporting dates. These amounts are reflected in other
comprehensive income. Income statement items are translated at average exchange
rates in effect during the financial statement period. Gains and losses
resulting from foreign currency transactions denominated in currency other than
the functional currency are classified as other income (expense).

                                      F-11
<PAGE>
                                  TANOX, INC.
           NOTES TO CONSOLIDATED FINANCIAL STATEMENTS -- (CONTINUED)

  EARNINGS PER SHARE

SFAS No. 128, "Earnings Per Share," requires dual presentation of basic and
diluted earnings per share (EPS). Basic EPS is computed by dividing net income
by the weighted average number of shares of common stock outstanding during the
year. Diluted EPS is computed in the same manner as basic EPS, except that
diluted EPS reflects the potential dilution that would occur if outstanding
options and warrants were exercised.

The following table reconciles basic and diluted EPS for the year ended December
31, 1997. Since Tanox incurred net losses for the years ended December 31, 1998
and 1999, basic and diluted EPS are the same.

                                          NET                     PER SHARE
                                         INCOME       SHARES       AMOUNT
                                       ----------  ------------   ---------
For the year ended December 31,
  1997 --
     Basic EPS.......................  $  630,000    27,909,000     $0.02
                                                                  =========
     Effect of dilutive securities --
       Options and warrants
       outstanding...................      --         3,281,000
                                       ----------  ------------
     Diluted EPS.....................  $  630,000    31,190,000     $0.02
                                       ==========  ============   =========

  OTHER COMPREHENSIVE INCOME (LOSS)

SFAS No. 130, "Reporting Comprehensive Income," establishes standards for
reporting and displaying comprehensive income and its components in an entity's
financial statements, and is effective for fiscal years beginning after December
15, 1997. The standard requires that all items that meet the definition of
components of comprehensive income be reported in Tanox's financial statements.
Tanox has included comprehensive income in its consolidated statements of
operations and comprehensive income (loss).

  CONCENTRATION OF CREDIT RISK

Tanox's receivables are primarily associated with research collaborations with
pharmaceutical and biotechnology companies and grants from foreign government
entities. Tanox does not believe this concentration of credit risk presents a
material risk to Tanox. Tanox does not require collateral from these entities.
Tanox has invested its excess cash generally in high-quality commercial paper
and U.S. Government agency debt obligations. As of December 31, 1999, these
investments mature within 68 days of year-end and, therefore, management
believes that they bear minimal risk. Tanox has not experienced any losses on
its investments.

                                      F-12
<PAGE>
                                  TANOX, INC.
           NOTES TO CONSOLIDATED FINANCIAL STATEMENTS -- (CONTINUED)

4.  GEOGRAPHIC AREAS:

Tanox operates in a single business segment. Tanox's operations by geographic
area for the years ended December 31, 1997, 1998 and 1999, are presented below:

                                        TOTAL      NET INCOME     IDENTIFIABLE
                                      REVENUES       (LOSS)          ASSETS
                                      ---------    -----------    -------------
Year ended December 31, 1997 --
     North America.................   $8,939,000   $    630,000    $ 43,330,000
     Asia..........................       --             --           1,501,000
                                      ----------   ------------    ------------
                                      $8,939,000   $    630,000    $ 44,831,000
                                      ==========   ============    ============
Year ended December 31, 1998 --
     North America.................   $3,089,000    $(8,983,000)   $ 42,794,000
     Europe........................      39,000      (1,192,000)        282,000
     Asia..........................       --              6,000       1,507,000
     Interarea eliminations........     (706,000)        --          (1,161,000)
                                      ----------   ------------    ------------
                                      $2,422,000   $(10,169,000)   $ 43,422,000
                                      ==========   ============    ============
Year ended December 31, 1999 --
     North America.................   $3,865,000   $(19,242,000)   $ 58,522,000
     Europe........................      244,000     (4,039,000)        754,000
     Asia..........................       --            (65,000)      1,534,000
     Interarea eliminations........   (2,704,000)        --          (5,482,000)
                                      ----------   ------------    ------------
                                      $1,405,000   $(23,346,000)   $ 55,328,000
                                      ==========   ============    ============

5.  NOTE PAYABLE TO RELATED PARTY:

Novartis has advanced Tanox $10.0 million pursuant to a loan agreement to
finance a new clinical manufacturing facility. The loan bears interest at LIBOR
plus two percent (7.3 percent and 8.1 percent at December 31, 1998 and 1999,
respectively). Through December 31, 1999, Novartis has agreed to forgive
interest on the loan. For the years ended December 31, 1997, 1998 and 1999, the
interest forgiven by Novartis has been reflected as interest expense and a
capital contribution. These amounts totalled $639,000, $825,000 and $738,000,
respectively for the years 1997 through 1999. The loan is due December 31, 2005.
Subject to modifications agreed to in principle concurrent with completion of
the Three-Party Collaboration, the principal and future interest payments may be
partially or totally forgiven by Novartis based on the future use of the
facility.

6.  INCOME TAXES:

Tanox's pretax income (loss) consists of the following:

                                 1997           1998            1999
                             ------------  --------------  --------------
U.S. ......................  $  1,253,000  $   (7,973,000) $  (16,505,000)
Foreign....................      (425,000)     (3,729,000)     (6,807,000)
                             ------------  --------------  --------------
                             $    828,000  $  (11,702,000) $  (23,312,000)
                             ============  ==============  ==============

                                      F-13
<PAGE>
                                  TANOX, INC.
           NOTES TO CONSOLIDATED FINANCIAL STATEMENTS -- (CONTINUED)

The components of the provision (benefit) for income taxes are as follows:

                                          1997         1998         1999
                                       ----------  -------------  ---------
Current..............................  $  198,000  $  (1,533,000) $  34,000
Deferred.............................      --           --           --
                                       ----------  -------------  ---------
                                       $  198,000  $  (1,533,000) $  34,000
                                       ==========  =============  =========

Tanox's effective income tax rate for 1997 was less than the statutory federal
income tax rate of 35 percent primarily due to benefits from franchise tax
adjustments and research and developments tax credits that were partially offset
by increases in the valuation allowance. For 1998 and 1999, the benefit was less
than that computed at the statutory rate primarily due to an increase in the
valuation allowance and nondeductible foreign losses. At December 31, 1998,
Tanox recorded a $2.1 million income tax receivable related to the carryback of
1998 losses to prior periods. Of this receivable $2.0 million was collected in
1999 and the remaining $0.1 million will be received in 2000.

Significant components of Tanox's deferred tax assets are as follows:

                                           1998            1999
                                       -------------  --------------
Federal net operating loss
  carryforward.......................  $    --        $    1,821,000
In-process research and
  development........................        979,000       2,038,000
Foreign net operating loss
  carryforwards......................        417,000       1,831,000
Deferred compensation related to
  stock options......................        360,000       1,909,000
Research and development tax
  credits............................        278,000       1,019,000
Alternative minimum tax credit.......        171,000         248,000
Differences in book and tax
  depreciation.......................        211,000        --
Capitalized interest.................        308,000         300,000
Accruals not currently deductible....        157,000       1,291,000
Other, net...........................          4,000          28,000
                                       -------------  --------------
     Total deferred tax assets.......      2,885,000      10,485,000
Differences in book and tax
  depreciation.......................       --              (130,000)
Deferred tax valuation allowance.....     (2,885,000)    (10,355,000)
                                       -------------  --------------
     Net deferred taxes..............  $    --        $     --
                                       =============  ==============

At December 31, 1999, Tanox has a net operating loss of approximately $6,560,000
for federal income tax reporting purposes. Tanox's intent is to carry back
approximately $1,360,000 of the net operating loss to prior years to obtain a
refund of approximately $132,000. The remaining net operating loss will begin to
expire in 2019. Tanox also has a foreign net operating loss carryforward of
approximately $5,230,000 which will be available to offset the separate company
taxable incomes of certain foreign subsidiaries. Additionally, Tanox has an
unused U.S. research and development tax credit carryforward at December 31,
1999, of approximately $1,019,000 which will begin to expire in 2011. Tanox also
has alternative minimum tax credit carryforwards of approximately $248,000 as of
December 31, 1999. As Tanox has incurred cumulative losses to date and there is
no assurance of future taxable income, a valuation allowance has been
established to fully offset the deferred tax asset at December 31, 1998 and
1999. Tanox's valuation allowance increased from $2,885,000 at December 31,
1998, to $10,355,000 at December 31, 1999, primarily due to Tanox's increase in
net operating loss carryforwards, tax credit carryforwards and deferred
compensation.

                                      F-14
<PAGE>
                                  TANOX, INC.
           NOTES TO CONSOLIDATED FINANCIAL STATEMENTS -- (CONTINUED)

7.  LEASE OBLIGATIONS:

Tanox leases its facilities pursuant to various operating leases that expire at
various dates through March 2002. Future minimum lease obligations under
noncancelable leases at December 31, 1999, are as follows:

      Year ending December 31 --
           2000............................  $  305,000
           2001............................     258,000
           2002............................      65,000
                                             ----------
                Total......................  $  628,000
                                             ==========

Tanox incurred rent expense of $287,000, $344,000 and $331,000 in 1997, 1998 and
1999, respectively. Certain of the facility leases include escalation clauses
for operating expenses and real estate taxes.

At December 31, 1999, Tanox had outstanding an unsecured, irrevocable letter of
credit for $20,000 related to a lease agreement.

8.  CAPITAL STOCK:

  PREFERRED STOCK

Tanox is authorized to issue up to 10,000,000 shares of $.01 par value preferred
stock. The board of directors has the authority to issue these shares in one or
more series and to establish the rights, preferences and dividends. No shares of
preferred stock have been issued.

  STOCK SPLIT

On March 31, 1997, Tanox declared a stock dividend to effect a stock split that
provided two shares of Tanox's common stock for every one share of Tanox's
common stock held by stockholders of record as of March 21, 1997. On February 1,
2000, Tanox declared a stock dividend to effect a stock split that provided 1.6
shares of Tanox's common stock for every one share of Tanox's common stock held
by stockholders of record as of January 31, 2000. In both cases the aggregate
par value of the dividend was transferred from additional paid-in capital to
common stock. The stock splits have been retroactively reflected in the
accompanying consolidated financial statements.

  STOCK OPTIONS

During 1987, Tanox established the 1987 Stock Option Plan (the 1987 Plan)
covering key employees, officers and directors of Tanox. Under the terms of the
1987 Plan, as amended, the number of shares of common stock eligible for
issuance was 4,320,000. Options issued under the 1987 Plan were generally
granted at a purchase price equal to the fair market value at the date of grant
and are generally exercisable beginning two years after the date of grant for 40
percent of the shares, with the balance to become exercisable cumulatively in
three installments of 20 percent each year thereafter. Options expire ten years
after the date of grant. At December 31, 1999, options to purchase 2,242,800
shares of Tanox's common stock were outstanding under the 1987 Plan. The 1987
Plan expired June 24, 1997, and no more shares may be granted under this plan.

Tanox established the 1997 Stock Plan (the 1997 Plan) in November 1997. Under
the terms of the 1997 Plan, Tanox may grant options to purchase up to 8,000,000
shares of Tanox's common stock to employees,

                                      F-15
<PAGE>
                                  TANOX, INC.
           NOTES TO CONSOLIDATED FINANCIAL STATEMENTS -- (CONTINUED)

directors, advisors and consultants. The 1997 Plan also provides for several
types of grants including incentive stock options, non-qualified stock options,
stock appreciation rights, stock awards, stock purchases and performance units.
Incentive stock options provide the right to purchase common stock at a price
not less than 100 percent of the fair value of common stock on the date of the
grant. Non-qualified stock options provide the right to purchase common stock at
a price not less than 50 percent of the fair value of the common stock on the
date of the grant. The options granted under the 1997 Plan generally expire ten
years after date of grant and are generally completely exercisable five years
after the grant date. At December 31, 1999, options to purchase 636,320 shares
of common stock were outstanding and 7,360,480 were available for future grants.
The 1997 Plan will expire on October 31, 2007.

In January 1992, Tanox established the 1992 Non-Employee Directors Stock Option
Plan (the Directors Plan) and reserved 480,000 shares of common stock for
issuance upon the exercise of options granted pursuant to the Directors Plan.
Unless otherwise provided, options granted under the Directors Plan will vest
one-third annually from the date of grant. The exercise price of the options
granted will be determined by a committee appointed by Tanox's board of
directors. At December 31, 1999, options to purchase 108,000 shares of Tanox's
common stock were outstanding under the Directors Plan and options to purchase
372,000 shares were available for future grants.

In addition to the plans discussed above, Tanox has entered into various stock
option agreements with certain outside consultants and advisors. At December 31,
1999, options to purchase 196,800 shares of Tanox's common stock were
outstanding under such agreements. All of the outstanding options issued under
these agreements were issued prior to 1996, are currently exercisable and expire
in either 2002 or 2003.

At December 31, 1999, options to purchase 3,183,920 shares were outstanding with
a weighted average exercise price of $4.39 per share, of which options to
purchase 2,106,318 shares were exercisable at a weighted average exercise price
of $2.79 per share. The following table summarizes stock option transactions
since December 31, 1996:

                                                                     WEIGHTED
                                     NUMBER OF      EXERCISE         AVERAGE
                                       SHARES         PRICE       EXERCISE PRICE
                                    ------------  -------------   --------------
Outstanding, December 31, 1996....     3,680,400  $  0.21- 5.28       $ 0.95
     Granted......................     1,337,600     3.75- 7.50         6.94
     Exercised....................       (47,040)    0.63- 2.50         1.50
     Canceled.....................       (54,240)    0.21- 3.02         1.47
                                    ------------  -------------   --------------
Outstanding, December 31, 1997....     4,916,720     0.21- 7.50         2.57
     Granted......................       322,400     5.63-11.25         7.81
     Exercised....................      (230,400)    0.21- 2.29         0.98
     Canceled.....................      (127,600)    2.29- 7.50         6.86
                                    ------------  -------------   --------------
Outstanding, December 31, 1998....     4,881,120     0.21-11.25         2.88
     Granted......................       137,120     4.06-12.50        10.27
     Exercised....................    (1,789,520)    0.63- 5.63         0.64
     Canceled.....................       (44,800)    2.29-11.25         7.61
                                    ------------  -------------   --------------
     Outstanding, December 31,
       1999.......................     3,183,920  $  0.21-12.50       $ 4.39
                                    ============  =============   ==============
     Exercisable, December 31,
       1999.......................     2,106,318  $  0.21-12.50       $ 2.79
                                    ============  =============   ==============

                                      F-16
<PAGE>
                                  TANOX, INC.
           NOTES TO CONSOLIDATED FINANCIAL STATEMENTS -- (CONTINUED)

Tanox follows SFAS No. 123 which permits one of two methods of accounting for
stock options. Tanox adopted Accounting Principles Board Opinion (APB) No. 25,
"Accounting for Stock Issued to Employees," and related interpretations in
accounting for its employee stock options. SFAS No. 123, however, requires Tanox
to disclose the income statement effect of the alternative fair value method
assuming Tanox was required to record compensation expense for stock options
equal to the assumed fair value on the grant date.

Under APB No. 25, Tanox recognizes as compensation expense the excess of the
estimated fair value of the common stock issuable upon exercise of such options
over the aggregate exercise price of such options on the date of grant. This
compensation expense is amortized ratably over the vesting period of each
option. The compensation expense of such options, net of reversals for
terminations, was $25,000, $273,000 and $311,000 during the years ended December
31, 1997, 1998 and 1999, respectively.

The fair value of each option grant is estimated using the Black-Scholes option
pricing model. The Black-Scholes model uses grant price, as stated in the option
agreements, market price as established by stock sales in 1997, 1998 and 1999
and deemed market prices established by the Compensation Committee of Tanox's
board of directors. The following assumptions were used for options granted in
1997: risk-free interest rate of six percent, expected option life of ten years,
no expected dividends, no expected turnover and a 20 percent volatility factor.
The following assumptions were used for options granted in 1998: risk-free
interest rate of five percent, expected option life of six years, no expected
dividends, expected turnover of 20 percent and a volatility factor of 20
percent. The assumptions used for options granted in 1999 were the same as those
used in 1998, with the exception of the risk-free interest rate which was six
percent and the volatility factor which was 42 percent.

Assuming the compensation cost for these plans had been determined pursuant to
the fair value method under SFAS No. 123, Tanox's pro forma net income (loss)
would have been as follows:

                                     1997          1998            1999
                                  ----------  --------------  --------------
Net income (loss) --
     As reported................  $  630,000  $  (10,169,000) $  (23,346,000)
     Pro forma..................     176,000     (11,260,000)    (24,551,000)
Basic EPS --
     As reported................        0.02           (0.35)          (0.75)
     Pro forma..................        0.01           (0.39)          (0.79)
Diluted EPS --
     As reported................        0.02           (0.35)          (0.75)
     Pro forma..................        0.01           (0.39)          (0.79)

Because the SFAS No. 123 method of accounting has not been applied to options
granted prior to January 1, 1996, the resulting pro forma compensation cost may
not be representative of that to be expected in future years.

                                      F-17
<PAGE>
                                  TANOX, INC.
           NOTES TO CONSOLIDATED FINANCIAL STATEMENTS -- (CONTINUED)

The number and weighted average fair value of options granted in 1997, 1998 and
1999 is as follows:

<TABLE>
<CAPTION>
                                                 1997                       1998                       1999
                                       ------------------------   ------------------------   ------------------------
                                                     WEIGHTED                   WEIGHTED                   WEIGHTED
                                                      AVERAGE                    AVERAGE                    AVERAGE
                                         SHARES     FAIR VALUE      SHARES     FAIR VALUE      SHARES     FAIR VALUE
                                       ----------   -----------   ----------   -----------   ----------   -----------
<S>                                    <C>          <C>           <C>          <C>           <C>          <C>
Option price equals fair market
  value..............................   1,137,600      $3.69         234,400      $2.71         129,120      $5.24
Option price greater than fair market
  value..............................      --          --              8,000       1.18          --          --
Option price less than fair market
  value..............................     200,000       5.46          80,000       5.63           8,000       5.65
</TABLE>

The following table summarizes information about fixed-price stock options
outstanding at December 31, 1999:

<TABLE>
<CAPTION>
                              OPTIONS OUTSTANDING
- ----------------------------------------------------------------------------
                                             WEIGHTED                                    OPTIONS EXERCISABLE
                                              AVERAGE                             ---------------------------------
                         OUTSTANDING         REMAINING                            EXERCISABLE
                            AS OF           CONTRACTUAL         WEIGHTED             AS OF             WEIGHTED
    RANGE OF             DECEMBER 31,          LIFE              AVERAGE          DECEMBER 31,          AVERAGE
 EXERCISE PRICES             1999           (IN YEARS)       EXERCISE PRICE           1999          EXERCISE PRICE
- -----------------        ------------      -------------     ---------------      ------------      ---------------
<S>                      <C>               <C>               <C>                  <C>               <C>
$ 0.21 - $ 2.50           1,386,000             2.3              $  1.06           1,386,000            $  1.06
  2.50 -   5.00             354,400             5.7                 3.46             226,400               3.28
  5.00 -   7.50           1,080,000             7.1                 7.35             443,839               7.30
  7.50 -  10.00             264,800             8.8                 8.13              42,079               8.13
 10.00 -  12.50              98,720             8.9                12.20               8,000              12.50
                         ------------                                             ------------
$ 0.21 -  12.50           3,183,920             5.0              $  4.39           2,106,318            $  2.79
                         ============                                             ============
</TABLE>

In April 1999, Tanox loaned 12 employees approximately $1,086,000 to enable the
employees to exercise 1,738,320 options to purchase shares of Tanox's common
stock, pursuant to stock options held by such employees. All of the loans are
full-recourse, secured by shares of Tanox's common stock owned by the employees,
bear interest at a rate of 8.5 percent, and are due and payable in full in
September 2001. The loans have been reflected as a contra equity in the
accompanying financial statements.

Also during 1999, Tanox agreed to extend, for an additional three-year period,
the term of 524,400 stock options held by certain employees and consultants that
were scheduled to expire. In connection with this extension, Tanox expensed, for
accounting purposes, approximately $4,576,000 of compensation expense
representing the fair value of the options as of the remeasurement date. For
employees, compensation expense was recorded for the difference between the fair
value of the underlying stock on the date of the extension and the exercise
price of the option. For consultants, compensation expense was calculated using
the Black-Scholes valuation model on the date of the extension.

  WARRANTS

In connection with the issuance of notes payable to an unrelated company for
equipment financing in 1989, Tanox issued warrants to purchase 93,053 shares of
Tanox's common stock at $0.86 per share. All of the

                                      F-18
<PAGE>
                                  TANOX, INC.
           NOTES TO CONSOLIDATED FINANCIAL STATEMENTS -- (CONTINUED)

warrants were exercised on a net issuance basis in 1999 and converted into
86,632 shares of common stock. As of December 31, 1999, there were no
outstanding warrants.

9.  COMMITMENTS AND CONTINGENCIES:

  ARBITRATIONS

Following settlement of Tanox's lawsuit against Genentech and Roche referred to
in Note 1, Tanox filed a demand for arbitration against the attorneys who
represented Tanox in the litigation in order to resolve a dispute over the
amount of attorneys' fees due by Tanox. On September 29, 1999, the arbitration
panel issued an award entitling the attorneys to receive approximately $3.5
million, including interest, payments ranging from 33 1/3 percent to 40 percent
of the future payments that Tanox may receive from Genentech following product
approval and ten percent of the royalties that Tanox may receive on sales of
anti-IgE products. At December 31, 1999, Tanox has reflected an accrued expense
of $3.5 million for the arbitration award in its consolidated financial
statements.

Tanox sought a court order vacating this arbitration award. However, a judgment
was entered confirming the award. Tanox intends to pursue all available
remedies, including appealing the decision. If Tanox is ultimately required to
pay all or part of the award to the attorneys, Tanox could be required to pay up
to $3.5 million, plus accrued interest would become due, and the award would
effectively reduce certain future milestone payments from Genentech by up to 40
percent and reduce future royalties from the Three-Party Collaboration by ten
percent. Tanox's future revenues, results of operations, cash flows and
financial condition could be materially adversely affected. During the appeals
process we will either post a bond or place cash in escrow to secure payment of
the award.

Tanox is also engaged in a dispute with Novartis and Genentech over its right to
independently develop certain of its anti-IgE monoclonal antibodies, which are
not being developed in connection with the Three-Party Collaboration. Tanox is
attempting to resolve the dispute in separate arbitrations with each of Novartis
and Genentech and they are attempting to resolve the dispute in federal court.
If Tanox ultimately loses its right to independently develop these anti-IgE
monoclonal antibodies, Tanox may be required to discontinue development of
Hu-901.

  LITIGATION

From time to time, Tanox is a defendant in lawsuits incidental to its business.
Management believes that the outcome of these lawsuits will not be material to
Tanox's financial statements.

  MILESTONES AND ROYALTIES

Tanox has agreements with several institutions that call for payments upon the
achievement of milestones by Tanox and royalty payments based upon a percentage
of product sales. No milestone or royalty expense has been incurred related to
these agreements.

  LOAN COMMITMENTS

Tanox has agreed that under certain conditions, it will lend certain of its
employees up to $1,500,000 in April 2000 for payment of their tax obligations
pursuant to the exercise of their stock options.

                                      F-19
<PAGE>
                                  TANOX, INC.
           NOTES TO CONSOLIDATED FINANCIAL STATEMENTS -- (CONTINUED)

  REGISTRATION RIGHTS

Some of Tanox's stockholders including founders, some early investors and
persons who hold 15 percent or more of our stock, have certain registration
rights.

  401(K) PLAN

Effective January 1, 1992, Tanox adopted a qualified retirement plan (the 401(k)
Plan) covering all of Tanox's employees who are at least 21 years of age and
have completed at least one year of service with Tanox. Pursuant to the 401(k)
Plan, employees may elect to reduce their current compensation by up to the
statutorily prescribed annual limit and have the amount of such reduction
contributed to the 401(k) Plan. The 401(k) Plan permits, but does not require,
additional matching contributions by Tanox on behalf of all participants in the
401(k) Plan. Tanox's contributions totaled approximately $81,000, $54,000 and
$66,000 in 1997, 1998 and 1999, respectively, representing matching 50 percent
of employee contributions, including those made by executive officers. Tanox's
matching contribution only applies to the first five percent of each employee's
total compensation.

                                      F-20

<PAGE>
                 (This page has been intentionally left blank)
<PAGE>
- --------------------------------------------------------------------------------

                                   [LOGO]

                                 TANOX, INC.
                              7,000,000 SHARES
                                COMMON STOCK

                       ------------------------------
                                 PROSPECTUS
                       ------------------------------

                                          , 2000

                             CIBC WORLD MARKETS
                             ROBERTSON STEPHENS
                           WARBURG DILLON READ LLC
                        ADAMS, HARKNESS & HILL, INC.
                               KBC SECURITIES

- --------------------------------------------------------------------------------

YOU SHOULD RELY ONLY ON THE INFORMATION CONTAINED IN THIS PROSPECTUS. NO DEALER,
SALESPERSON OR OTHER PERSON IS AUTHORIZED TO GIVE INFORMATION THAT IS NOT
CONTAINED IN THIS PROSPECTUS. THIS PROSPECTUS IS NOT AN OFFER TO SELL NOR IS IT
SEEKING AN OFFER TO BUY THESE SECURITIES IN ANY JURISDICTION WHERE THE OFFER OR
SALE IS NOT PERMITTED. THE INFORMATION CONTAINED IN THIS PROSPECTUS IS CORRECT
ONLY AS OF THE DATE OF THIS PROSPECTUS, REGARDLESS OF THE TIME OF THE DELIVERY
OF THIS PROSPECTUS OR ANY SALE OF THESE SECURITIES.

UNTIL                , 2000 (25 DAYS AFTER THE COMMENCEMENT OF THE OFFERING),
ALL DEALERS THAT EFFECT TRANSACTIONS IN THESE SECURITIES, WHETHER OR NOT
PARTICIPATING IN THIS OFFERING, MAY BE REQUIRED TO DELIVER A PROSPECTUS. THIS IS
IN ADDITION TO THE DEALERS' OBLIGATION TO DELIVER A PROSPECTUS WHEN ACTING AS
UNDERWRITERS AND WITH RESPECT TO THEIR UNSOLD ALLOTMENTS OR SUBSCRIPTIONS.

<PAGE>
                                    PART II
                     INFORMATION NOT REQUIRED IN PROSPECTUS

ITEM 13.  OTHER EXPENSES OF ISSUANCE AND DISTRIBUTION.

The following table sets forth all expenses, other than underwriting discounts
and commissions payable by the Registrant in connection with the sale of the
common stock being registered. All the amounts shown are estimates except for
the registration fee, NASD filing fee and the Nasdaq National Market listing
fee.

Registration fee.....................  $   63,756
NASD filing fee......................      24,650
Nasdaq National Market listing fee...      95,000
Printing and engraving expenses......     170,000*
Legal fees and expenses..............     300,000*
Accounting fees and expenses.........     200,000*
Blue Sky fees and expenses...........      15,000*
Transfer agent and registrar fees....      15,500*
Premium for directors and officers
  insurance..........................     150,000*
Miscellaneous........................      51,094*
                                       ----------
     Total...........................   1,085,000*
                                       ==========
- ---------------------------

*  Estimated

ITEM 14.  INDEMNIFICATION OF DIRECTORS AND OFFICERS.

Our amended and restated certificate of incorporation requires us to indemnify
our directors and officers against liabilities they may incur in these
capacities, including liabilities under the Securities Act, as amended, to the
fullest extent permitted by Section 145 of the Delaware General Corporation Law.

Our bylaws require that we indemnify each of our directors and officers for the
expenses, judgments, fines and amounts paid in settlement actually and
reasonably incurred in connection with any type of threatened, pending or
completed action, suit or proceeding (other than actions by us or on our behalf)
if he or she:

  o    acted in good faith and in a manner he or she reasonably believed to be
       in or not opposed to our best interests; and

  o    in the case of a criminal proceeding (including preliminary), had no
       reason to believe his or her conduct was unlawful.

Under our bylaws we also must indemnify a director and officer for expenses of
an action brought by us or on our behalf if he or she acted in good faith and in
a manner he or she reasonably believed to be in or not opposed to our best
interests. We may not indemnify a director or officer for expenses of an action
brought by us or on our behalf if the director or officer is adjudged liable to
the corporation, unless a court determines that, despite such adjudication but
in view of all of the circumstances, he or she is entitled to indemnification of
such expenses.

We have a duty to indemnify only if the director or officer has met the
applicable standard of conduct described above. This is determined by:

  o    a majority vote of the disinterested directors; or

  o    a majority vote of a committee of disinterested directors designated by a
       majority vote of the disinterested directors; or

                                      II-1
<PAGE>
  o    if there are no disinterested directors, or if the disinterested
       directors so direct, independent legal counsel in a written opinion; or

  o    the stockholders.

We must indemnify a director or officer for all expenses of litigation or other
legal proceedings actually and reasonably incurred when he or she is successful
on the merits or otherwise in defense of the litigation or proceeding or in
defense of any claim, issue or matter therein.

We must advance to a director or officer the actually and reasonably incurred
expenses incurred in defending an action before the action is finally disposed
if the director undertakes to repay these expenses if the director is ultimately
determined not entitled to be indemnified in connection with the action to which
the expenses relate. We may advance to an officer the expenses incurred in
defending an action before the action is finally disposed if the board of
directors authorizes the advance, and the officer undertakes to repay these
expenses if the officer is ultimately determined not entitled to be indemnified
in connection with the action to which the expenses relate. The board of
directors may not consider the officer's financial ability to repay these
advances in determining whether to authorize the advancement.

We may purchase and maintain insurance on behalf of any director and officer to
the extent permitted by Section 145. We intend to purchase liability insurance
policies covering our directors and officers in certain circumstances.

In addition to the indemnification rights described above, our amended and
restated certificate of incorporation eliminates, in certain circumstances, our
directors' liability for monetary damages for breach of fiduciary duty as a
director. These provisions do not eliminate a director's liability:

  o    for any breach of the director's duty of loyalty to us or our
       stockholders;

  o    for acts or omissions not in good faith or which involve intentional
       misconduct or a knowing violation of law;

  o    under Section 174 of the Delaware General Corporation Law, which relates
       to the declaration of dividends and purchase or redemption of shares in
       violation of this law; or

  o    for any transaction from which the director derived an improper personal
       benefit.

Prior to the completion of this offering, we have entered into indemnification
agreements with each of our directors and officers to give them additional
contractual assurances regarding the scope of the indemnification provided in
our amended and restated certificate of incorporation and bylaws and to provide
additional procedural protections.

The underwriting agreement (exhibit 1.1 to this Registration Statement) provides
that the underwriters must, under some circumstances, indemnify our directors,
officers and controlling persons against specified liabilities, including
liabilities under the Securities Act.

ITEM 15.  RECENT SALES OF UNREGISTERED SECURITIES.

Since January 1, 1997, the Registrant has sold and issued the following
unregistered securities:

(a)   Between February 21, 1997 and September 4, 1997, the Registrant issued and
      sold an aggregate of 2,331,260 shares of its common stock to 23 non-U.S.
      persons in reliance on Regulation S promulgated under the Securities Act
      for an aggregate consideration of $17,484,468.

(b)   Between February 16, 1998 and April 6, 1998, the Registrant issued and
      sold an aggregate of 273,684 shares of its common stock to 8 non-U.S.
      persons in reliance on Regulation S promulgated under the Securities Act
      for an aggregate consideration of $3,078,972.

(c)   Between August 31, 1999 and December 30, 1999, the Registrant issued and
      sold an aggregate of 880,000 shares of its common stock to 14 non-U.S.
      persons in reliance on Regulation S promulgated under the Securities Act
      for an aggregate consideration of $11,000,000. The placement agent was KBC
      Securities, NV. The Registrant paid to KBC Securities, N.V. a placement
      agent fee of $715,000.

                                      II-2
<PAGE>
(d)   Between October 25, 1999 and December 10, 1999, the Registrant issued and
      sold an aggregate of 1,016,000 shares of its common stock to 12 non-U.S.
      persons in reliance on Regulation S promulgated under the Securities Act
      for an aggregate consideration of $12,700,000.

(e)   Between March 12, 1998 and September 12, 1999, the Registrant issued
      468,484 shares of its common stock, at a price per share ranging from
      $11.25 to $12.50, with an aggregate value of $5,573,039, to 3 United
      States residents and 5 non-U.S. persons in connection with the
      Registrant's acquisition of Tanox Pharma, formerly PanGenetics B.V. The
      sale and issuance were exempt from registration under Section 4(2) of the
      Securities Act.

(f)   From time to time since January 1, 1997, the Registrant has granted stock
      options to purchase shares of its common stock to various employees,
      directors and consultants pursuant to its 1997 Stock Plan and its 1992
      Non-Employee Directors Stock Option Plan. With respect to all grants of
      options, exemption from registration was unnecessary in that the
      transactions did not involve a "sale" of securities as that term is used
      in Section 2(a)(3) of the Securities Act.

(g)   As of March 31, 2000, the Registrant had issued and sold, in the
      aggregate, 2,480,987 shares of its common stock for per share exercise
      prices ranging from $0.28 to $11.25 to employees and one consultant
      pursuant to their exercise of stock options granted under the Registrant's
      1987 Stock Option Plan and 1997 Stock Plan. The Registrant relied on the
      exemption provided by Rule 701 under the Securities Act.

(h)   Between April 27, 1998 and February 9, 2000, the Registrant issued and
      sold 242,400 shares of its common stock for per share exercise prices
      ranging from $0.21 to $2.29, to consultants of the Registrant, pursuant to
      their exercise of stock options. The Registrant relied on the exemption
      provided by Rule 701 under the Securities Act.

(i)   On October 25, 1999, the Registrant issued and sold to Phoenix Leasing
      Incorporated 86,632 shares of its common stock, on a net issuance basis,
      at a price per share of $0.86, for an aggregate consideration of 6,421
      shares of common stock, pursuant to the exercise by Phoenix Leasing
      Incorporated of warrants.

All sales of common stock made pursuant to the exercise of stock options were
made in reliance on Section 701 under the Securities Act or Section 4(2) of the
Securities Act. All other sales were made in reliance on Section 4(2) of the
Securities Act and Regulation S promulgated under the Securities Act. These
sales were made without general solicitation or advertising, to investors who
were sophisticated and had access to all relevant information necessary to
evaluate the investment, and who represented to the Registrant that they were
acquiring the securities for investment and appropriate legends were affixed to
the share certificates issued in such transactions.

ITEM 16.  EXHIBITS AND FINANCIAL STATEMENT SCHEDULES.

(a)  Exhibits

           1.1+      -- Form of Underwriting Agreement.
           3.1*      -- Amended and Restated Certificate of
                        Incorporation of the Registrant, as
                        amended, as currently in effect.
           3.2*      -- Bylaws of the Registrant, as
                        currently in effect.
           4.1*      -- Specimen of Common Stock Certificate,
                        $.01 par value, of the Registrant.
           4.2*      -- Warrant to Purchase 6,462 Shares of
                        Common Stock, dated November 1989, by
                        and between the Registrant and
                        Phoenix Venture Incorporated.
           5.1+      -- Opinion of Chamberlain, Hrdlicka,
                        White, Williams & Martin.
          10.1*      -- Form of Indemnification Agreement
                        between the Registrant and its
                        officers and directors.
          10.2*      -- 1987 Stock Option Plan of the
                        Registrant, as amended.
          10.3*      -- 1992 Non-employee Directors Stock
                        Option Plan of the Registrant.

                                      II-3
<PAGE>

          10.4*      -- 1997 Stock Plan of the Registrant.
          10.5*      -- Lease of premises at 10301 Stella
                        Link, Suite 110, Houston, Texas,
                        dated December 3, 1986, as amended.
          10.6*      -- Stock Purchase Agreement, dated July
                        14, 1987, by and among the Registrant
                        and Tse Wen Chang, Nancy T. Chang,
                        Alafi Capital Company, Shireen Alafi,
                        Joseph Heskel, Trustee for
                        Christopher Alafi, and Invitron
                        Corporation.
          10.7++*   --  License for Winter Patent, dated June
                        26, 1989, by and between Medical
                        Research Council and the Registrant.
          10.8++*   --  Amendment to the License for Winter
                        Patent, dated February 9, 1990, by
                        and between Medical Research Council
                        and the Registrant.
          10.9++    --  Development and Licensing Agreement,
                        dated May 11, 1990, by and between
                        the Registrant and Ciba-Geigy
                        Limited.
          10.10*     -- Term Sheet for Secured Loan, dated
                        December 14, 1994, by and between the
                        Registrant and Ciba-Geigy Limited.
          10.11++   --  Chiron-PanGenetics Research and
                        Development License and Options for
                        Commercial License, dated September
                        25, 1995, by and between PanGenetics,
                        B.V., Panorama Research, Inc. and
                        Chiron Corporation.
          10.12*     -- Stock Purchase Agreement, dated as of
                        March 12, 1998, by and between the
                        Registrant and the holders of shares
                        of PanGenetics, B.V.
          10.13++   --  License Agreement, dated June 1,
                        1998, by and between Biogen, Inc. and
                        the Registrant.
          10.14++   --  Outline of Terms for Settlement of
                        the Litigations Among Genentech,
                        Inc., Genentech International, Ltd.,
                        the Registrant and Ciba-Geigy Limited
                        Relating to Anti-IgE Inhibiting
                        Monoclonal Antibodies, dated July 8,
                        1996.
          10.15++   --  Supplemental Agreement between the
                        Registrant and Ciba-Geigy Limited,
                        dated July 8, 1996.
          10.16++   --  Settlement and Cross-Licensing
                        Agreement, dated July 8, 1996, by and
                        between the Registrant and Genentech,
                        Inc. and Genentech International
                        Limited.
          10.17++   --  Settlement and Participation
                        Agreement, dated July 8, 1996, by and
                        between the Registrant and F.
                        Hoffman-La Roche, Ltd., Hoffman-La
                        Roche, Inc., Roche Holding Ltd. and
                        Roche Holdings, Inc.
          10.18++*  --  Patent License Agreement, dated June
                        30, 1998, by and between Protein
                        Design Labs, Inc. and the Registrant.
          10.19++*  --  Amendment to Patent License
                        Agreement, dated June 28, 1999, by
                        and between Protein Design Labs, Inc.
                        and the Registrant.
          10.20*     -- Research and License Agreement, dated
                        April 21, 1999, by and between the
                        Registrant and Biovation Limited.
          10.21*     -- Material Transfer and Commercial
                        Evaluation Agreement, dated March 9,
                        1999, by and between Tanox, Inc. and
                        Biovation Limited.
          10.22++   --  G-CSF Receptor Non-exclusive License
                        Agreement, dated January 11, 2000, by
                        and between Immunex Corporation and
                        the Registrant.
          10.23*     -- 2000 Non-Employee Directors' Stock
                        Option Plan.
          10.24++   --  Master Agreement, dated March 17,
                        2000, by and between the Registrant
                        and Protein Design Labs, Inc.
          21.1*      -- List of Subsidiaries of the
                        Registrant.
          23.1       -- Consent of Arthur Andersen LLP dated
                        April 4, 2000.
          23.2+      -- Consent of Chamberlain, Hrdlicka,
                        White, Williams & Martin (included in
                        Exhibit 5.1).
          23.3*      -- Consent of KPMG LLP, dated March 5,
                        2000.
          24.1*      -- Power of Attorney.
          27*        -- Financial Data Schedule.
- ---------------------------

 +  To be filed by amendment.

++  Certain confidential material contained in the document has been omitted and
    filed separately with the Securities and Exchange Commission pursuant to
    Rule 406 of the Securities Act.

 *  Previously filed

                                      II-4
<PAGE>
(b)  Financial Statement Schedules

All schedules are omitted because they are not applicable or because the
required information is contained in the Financial Statements or Notes thereto.

ITEM 17.  UNDERTAKINGS.

Insofar as indemnification for liabilities arising under the Securities Act may
be permitted to directors, officers and controlling persons of the registrant
pursuant to the foregoing provisions, or otherwise, the registrant has been
advised that in the opinion of the Securities and Exchange Commission such
indemnification is against public policy as expressed in the Act, and is,
therefore, unenforceable. In the event that a claim for indemnification against
such liabilities (other than the payment by the registrant of expenses incurred
or paid by a director, officer or controlling person of the registrant in the
successful defense of any action, suit or proceeding) is asserted by such
director, officer or controlling person in connection with the securities being
registered, the registrant will, unless in the opinion of its counsel the matter
has been settled by controlling precedent, submit to a court of appropriate
jurisdiction the question whether such indemnification by it is against public
policy as expressed in the Act and will be governed by the final adjudication of
such issue.

The undersigned registrant hereby undertakes:

  (1)  That for purposes of determining any liability under the Securities Act,
       the information omitted from the form of prospectus filed as part of this
       Registration Statement in reliance upon Rule 430A and contained in a form
       of prospectus filed by the registrant pursuant to Rule 424(b)(1) or (4)
       or 497(h) under the Securities Act shall be deemed to be part of this
       Registration Statement as of the time it was declared effective.

  (2)  That for the purposes of determining any liability under the Securities
       Act, each posteffective amendment that contains a form of prospectus
       shall be deemed to be a new registration statement relating to the
       securities offered therein, and the offering of such securities at that
       time shall be deemed to be the initial bona fide offering thereof.

  (3)  To provide to the Underwriters at the closing specified in the
       underwriting agreement certificates in such denominations and registered
       in such names as required by the underwriters to permit prompt delivery
       to each purchaser.

                                      II-5
<PAGE>
                                   SIGNATURES

PURSUANT TO THE REQUIREMENTS OF THE SECURITIES ACT, THE REGISTRANT HAS DULY
CAUSED THIS AMENDMENT NO. 4 TO THE REGISTRATION STATEMENT TO BE SIGNED ON ITS
BEHALF BY THE UNDERSIGNED, THEREUNTO DULY AUTHORIZED, IN THE CITY OF HOUSTON,
STATE OF TEXAS ON APRIL 6, 2000.

                                          TANOX, INC.

                                          By: /s/ JOHN BLICKENSTAFF
                                                  JOHN BLICKENSTAFF
                                                  SECRETARY

PURSUANT TO THE REQUIREMENTS OF THE SECURITIES ACT, THIS AMENDMENT NO. 4 TO THE
REGISTRATION STATEMENT HAS BEEN SIGNED BY THE FOLLOWING PERSONS IN THE
CAPACITIES INDICATED ON APRIL 6, 2000.

                                          By: /s/ JOHN BLICKENSTAFF
                                                  JOHN BLICKENSTAFF
                                                  ATTORNEY-IN-FACT

                                                    Chairman of the Board,
                NANCY T. CHANG, PH.D.               President, and Chief
                                                    Executive Officer

                                                    Vice President of Finance
                  DAVID DUNCAN, JR.                 and Chief Financial Officer

                                                    Director
                 TSE WEN CHANG, PH.D.

                                                    Director
                 OSAMA MIKHAIL, PH.D.

                                                    Director
               WILLIAM J. JENKINS, M.D.

                                      II-6

                                                                    EXHIBIT 10.9

CERTAIN INFORMATION IN THIS EXHIBIT IS SUBJECT TO A REQUEST FOR CONFIDENTIAL
TREATMENT. IN ACCORDANCE WITH RULE 406 UNDER THE SECURITIES ACT OF 1933, AS
AMENDED, SUCH INFORMATION HAS BEEN OMITTED AND FILED SEPARATELY WITH THE
SECURITIES AND EXCHANGE COMMISSION. THE LOCATION OF SUCH OMITTED INFORMATION HAS
BEEN INDICATED WITH AN ASTERISK(*).

                      DEVELOPMENT AND LICENSING AGREEMENT

     This Development and Licensing Agreement ("Agreement") is made and
entered into as of the 11th day of May, 1990, between TANOX BIOSYSTEMS, INC., a
Texas corporation ("Tanox"), and CIBA-GEIGY Limited, a body corporate of
Switzerland ("Ciba-Geigy").

                                   RECITALS:

     Tanox and Ciba-Geigy posses, have developed, and are developing certain
antibodies and related technology directed toward treatment of IgE-mediated
allergic reactions in humans. Each possesses certain trade secrets, know-how,
and other proprietary technology related thereto, including such proprietary
technology disclosed under the pending patent applications reference in Annex 1,
attached hereto.

     To continue research, development, and commercialization of anti-allergy
products within the Field, as hereinafter defined, Tanox and Ciba-Geigy desire
to enter into a joint cooperation. It is understood that the parties shall
contribute, subject to the provisions of this Agreement, to the cooperation all
of their existing and future rights or studies owned or to be owned in the
Field.

     Beyond the cooperation in the Field, Ciba-Geigy intends, subject to the
terms and conditions of that certain Stock Purchase Agreement of even date
herewith, to make an equity investment in Tanox.

     Therefore, Tanox and Ciba-Geigy have entered into this Agreement which sets
forth the terms and conditions of their cooperation and the respective rights
and licenses within the Field which each shall have as a result of such
cooperation.

1.  DEFINITIONS.

     1.1  Agreement Period shall mean the period of time commencing on the date
of execution of this Agreement and extending on a country by country basis until
a) the last to expire in each country of the patents issuing from the patent
applications of Tanox listed in Annex 1 or claiming its priorities thereof (such
expiration to occur only after expiration of extensions to such patents which
may be obtained under the Drug Price Competition and Parent Term Restoration Act
of 1984 in the U.S.A. and similar patent extension laws in other countries) or
b) the expiry of nine (9) years from the day of the first commercial sale of the
respective Product(s) in each country, whichever is later. Ciba-Geigy shall have
the right to extend the Agreement Period, by written notice to Tanox give within
ninety (90) days of Ciba-Geigy's receipt of written notice of the issuance of
such parent, in the event that Tanox obtains rights to a patent, not issuing
from the patent applications of Tanox listed in Annex 1 or claiming its
priorities thereof, upon which Ciba-Geigy relies in order to make, have made,
use or sell Product(s). Such notice shall effect an inclusion of such patent
under clause a) above of this Paragraph 1.1 for purposes of determining the
applicable agreement Period.

                Development and Licensing Agreement  -  Page 1.
<PAGE>
     1.2  Product(s) shall mean the monoclonal antibodies owned or controlled by
Tanox and Ciba-Geigy for use in the Field, as described in the U.S. patent
application(s) of Tanox and the U.K. patent application of Ciba-Geigy referenced
in Annex 1, and fragments, toxin conjugates, antibody toxin chimeric constructs,
humanized or reshaped antibodies derived from such monoclonal antibodies
including such forms as are ready to be administered in humans.

     1.3  Field shall mean anti-IgE antibody-based treatments in humans for
IgE-mediated reactions, *.

     1.4  Patent Rights shall mean any patent application or patent(s) owned or
controlled by Tanox or Ciba-Geigy whose claims cover the manufacture, use, or
sale of the Product(s), as well as any additional patents hereafter issuing from
additional patent applications relating to the Product(s), including, but not
limited to, a method of use of the Product(s), and any substitutions,
continuations, continuations-in-part, divisions, reissues, re-examinations,
renewals, or extensions of the terms thereof.

     1.5  Know-How shall mean any and all unpatented and/or non-patentable
technical data, information, materials, biological materials, such as plasmids,
vectors, DNA sequences, organisms, cell lines, and antibodies, samples and other
information owned or controlled by Tanox or Ciba-Geigy in the Field during the
Agreement Period which (i) relate to Product(s), including, without limitation,
its chemical, biological, pharmacological, toxicological, nonclinical and
clinical data, formulations, specifications and/or usage, or (ii) relate to
processes, techniques and specifications for the manufacture of Product(s),
including, without limitation, preparation, synthesis, culture, recovery and
purification and quality control processes, techniques and specifications.
Know-How shall not encompass Patent Rights. Know-How of Ciba-Geigy and Tanox
shall be limited, however, to only that information which is developed as part
of or in conjunction with CIGA-Geigy's and Tanox's program directed at
development of Product(s) in the Field; but shall not include such information
which relates to non-classical, non-conventional, high technology delivery
systems for the Product(s).

     1.6  Affiliate(s) shall mean all corporations or business entities which,
directly or indirectly, are controlled by, control, or are under common control
with Ciba-Geigy or Tanox, including, with respect to Ciba-Geigy, its Affiliate,
CIBA-GEIGY Corporation, headquartered in the United States of America (U.S.A.).

     For this purpose, the meaning of the word "control" shall mean the
ownership of fifty percent (50%) or more of the voting shares or interest of
such corporation or business entity, or any corporation or business entity, even
though the extent of ownership of a party in such corporation or business entity
is less than fifty percent

                Development and Licensing Agreement  -  Page 2.
<PAGE>
(50%), as to which a party to this Agreement can demonstrate that the operation
and management of such corporation or business entity is carried out in
conformity with such party's standing policy; provided, that any such
corporation or business entity shall be deemed an Affiliate only so long as such
ownership of voting shares or interest or adherence to such standing policy
continues.

     1.7  Third Party(ies) shall mean any person or entity other than a party to
this Agreement, its Affiliate(s), and/or its respective employees.

     1.8  Net Sales shall mean the amount billed by Ciba-Geigy, its Affiliate(s)
or sublicensees to Third Parties for the sale of Product(s) less cash discounts
and/or quantity allowances actually allowed; credits for customers; returns and
allowances; charges for freight, handling and transportation separately billed;
and sales and use taxes and other similar taxes incurred, as reasonably and
fairly determined in accordance with Ciba-Geigy's standard accounting method.

     1.9  Exclusive Rights shall mean the sole right of the party possessing
such right, as expressly conferred by this Agreement, to sell Product(s) within
a territory for which such right is granted.

     1.10  Semi-Exclusive Rights shall mean the joint or shared right of the
parties possessing such right, as expressly conferred by this Agreement, to the
exclusion of all Third Parties, to sell Product(s) within a territory for which
such right is granted.

     1.11  Co-Promotion shall mean the promotion in accordance with Paragraph
8.3 by both parties of Product(s) under the same trademark. Products subject to
Co-Promotion shall be sold solely by Ciba-Geigy and shall be identified by a
trademark chosen by Ciba-Geigy with due consideration to trademark suggestions,
if any, from Tanox.

     1.12  Co-Marketing shall mean the marketing and sale of Product(s) by each
party under a separate trademark, chosen by each party; provided, that
Ciba-Geigy, at its option, may co-market Product(s) under the same trademark
used by the parties for Product(s) being co-promoted and, in such event, Tanox
may not use such trademark in those countries where the Product is being
co-marketed.

     1.13  Abandoned Product(s) shall mean any Product(s) with respect to which
Ciba-Geigy relinquishes its rights under this Agreement by notice of such
relinquishment.

     1.14  Major Country shall mean and include the following countries: Japan,
the United Kingdom, West Germany, Italy, France and the U.S.A.

     1.15  Other commonly used terms or abbreviations, such as Food and Drug
Administration ("FDA"), Phase I. Phase II, Phase III, Notice of Claimed
Investigational Exemption for a New Drug ("IND"), New Drug Application
("NDA"), Establishment License Application ("ELA"), and Product License
Application ("PLA"), shall mean or have the meanings indicated in the United
States Food, Drug and Cosmetic Act and

                Development and Licensing Agreement  -  Page 3
<PAGE>
applicable regulations promulgated thereunder, and all such terms or
abbreviations shall apply equally, as applicable, to any counterpart or
equivalent agencies or activities in countries outside the U.S.A.

     1.16  Exclusive Territories shall mean all countries of the world except
those included within the Semi-exclusive Territories.

     1.17  Semi-exclusive Territories shall mean the U.S.A., Taiwan, Hong Kong,
Singapore, China and Korea.

2.  GRANT OF LICENSE; SUBLICENSE; REPRESENTATIONS.

     2.1  Subject to the provisions of this Agreement, Tanox grants to
Ciba-Geigy during the Agreement Period a world-wide license under its Know-How
and Patent Rights, with the right to grant sublicenses, to make, have made, use
and sell the Product(s) for use in the Field. Said license shall be exclusive in
the Exclusive Territories and shall be co-exclusive with Tanox in the
Semi-exclusive Territories.

     2.2  Subject to the provisions of this Agreement, Ciba-Geigy grants to
Tanox during the Agreement Period a license under its Know-How and Patent
Rights, to make, have made, use and sell the Product(s) for use in the Field.
Said license shall be limited to the Semi-exclusive Territories and shall be
co-exclusive with Ciba-Geigy in said Territories.

     2.3  At the end of the Agreement Period in each respective country, the
licenses granted in Paragraphs 2.1 and 2.2 hereinabove shall be converted into
perpetual, royalty-free, non-exclusive licenses.

     2.4  Ciba-Geigy shall warrant the performance of any and all rights and
obligations of this Agreement by its Affiliate(s) and/or sublicensees. Tanox
shall warrant the performance of any and all rights and obligations of this
Agreement by its Affiliate(s).

     Tanox agrees, if Ciba-Geigy so requests, to enter into a separate agreement
with any Affiliate(s) of Ciba-Geigy granting a license in accordance with the
provisions of this Agreement. Such agreement shall incorporate all of the terms
of this Agreement to the extent that they are applicable. Ciba-Geigy shall
guarantee the performance of any and all responsibilities of the Affiliate(s)
under such separate agreement.

     Additionally, the parties may, by mutual written consent, license rights
granted or retained under this Agreement to a third party to manufacture the
commercial supply of Product(s) for itself and/or the other party.

     2.5  Each party warrants to the other that it is the owner of, or has
exclusive rights to commercialize, with the right to grant licenses under its
respective Patent Right(s) and Know-How and has not assigned, conveyed or
otherwise encumbered by any agreement, either oral or written, any right, title
or interest in and to the respective

                Development and Licensing Agreement  -  Page 4.
<PAGE>
Patent Rights and Know-How which would be inconsistent with the rights granted
hereunder. Each party warrants that it is free to enter into this Agreement and
is free to carry out all of its obligations under this Agreement. Except as
provided in Paragraphs 2.4, 2.5 and 7 and the Annexes hereto and as may be
otherwise agreed in writing between the parties, the parties expressly disclaim
all other warranties, express or implied, including without limitation,
warranties of merchantability or fitness for a particular purpose with respect
to the Product(s).

3.  PROJECT STEERING COMMITTEE/WORKING GROUPS

     3.1  A.  Upon execution of this Agreement, the parties hereto shall set up
a Project Steering Committee to which each party shall appoint up to three (3)
experts as its deputies.

     A member of the Project Steering Committee appointed by Ciba-Geigy shall
assume the chairmanship of this Project Steering Committee.

     Decisions of the Project Steering Committee shall be taken, if possible, by
unanimous vote and the chairman shall have a casting vote; provided, however,
that no action may be taken by the Project Steering Committee to impose or
increase upon either party financial or any other obligations not expressly
contained in this Agreement except with the prior written consent of such party.

     B.  The Project Steering Committee shall:

          (i)  agree from time to time, particularly before entering into a new
     research and/or development phase as hereinafter set forth, on the
     development and detailed working program (including timetable) to be
     carried out and the budgets thereto, whereby the Project Steering Committee
     shall set up the priorities and determine the various tasks of each partner
     as hereinafter described;

          (ii)  coordinate and monitor the progress of such development work;

          (iii)  provide for a free exchange of any relevant information and
     results relating to the development work under this Agreement and subject
     to the terms of this Agreement.

     C.  As necessary or required, the Project Steering Committee shall hold
meetings at intervals and locations to be mutually agreed upon, but at least
once a year. The minutes to the meetings shall be marked as "Confidential" and
shall be subject to the secrecy obligations and restrictions on use as per
Paragraph 6 hereinafter.

     3.2  A.  The Working Groups shall be responsible for proposing a detailed
development plan (setting forth the different steps and time frames, as well as
the budget for their respective activities) to the Project Steering Committee.
After approval of the development plan by the Project Steering Committee, which
must occur in a timely way

                Development and Licensing Agreement  -  Page 5.
<PAGE>
so as not to impede the progress of the Working Groups, the Working Groups shall
coordinate and implement all day-to-day activities of the parties, respectively,
under this Agreement. The Working Groups shall work openly and cooperatively and
shall meet periodically, as the parties reasonably determine may be necessary,
to coordinate research, preclinical and clinical development, process
development and production, and other activities conducted by the parties
according to the objectives and priorities of the cooperation under this
Agreement. The results of such meetings shall be recorded in writing. The
minutes shall be approved and signed by both parties' project leaders. The
minutes shall be marked as "Confidential" and shall be subject to the secrecy
obligations and restrictions on use as per Paragraph 6 hereinafter.

     B.  The Working Groups shall include those of its expert employees that
each party reasonably determines to be necessary or appropriate (such employees
may participate in more than one Working Group which, unless requested by a
party, need not include an equal number of each party's expert employees).

     The Working Groups shall include the following and such other Working
Groups as may be agreed from time to time by the Project Steering Committee.

          (i)  Research Group -- The Research Group shall be responsible for
     proposing research plans to the Project Steering Committee, supervising
     research activities, and coordinating and implementing all day-to-day
     activities in connection with those various research activities Annex 2.
     The Research Group shall report to the Project Steering Committee from time
     to time the research results for review of the work performed and for the
     discussion of and decision on the subsequent activities.

          (ii)  Clinical Development Group -- The Clinical Development Group
     shall be responsible for proposing the clinical development plans to the
     Project Steering Committee, supervising all clinical activities, and
     coordinating and implementing the clinical trials and regulatory
     submissions in connection with those various clinical trial activities
     identified in Annex 3. The Clinical Development Group shall report to the
     Project Steering Committee from time to time the results of development
     activities for review and for decisions on subsequent activities.

          (iii)  Process Development and Production (PDP) Group -- The PDP Group
     shall be responsible, as necessary from time to time, for proposing the
     process development and production activities to the Project Steering
     Committee supervising such activities, and coordinating and implementing
     initial, adaption and scale-up activities identified in Annex 4. The PDP
     Group also shall support with its activities the clinical development
     process as outlined in Annex 3. The PDP Group shall report to the Project
     Steering Committee from time to time the results of the work performed for
     decisions on subsequent activities.

Z                Development and Licensing Agreement  -  Page 6.
<PAGE>
4.  RESPONSIBILITIES OF THE PARTIES.

     4.1  Activities of the parties under this Agreement can be characterized as
follows: a) activities in which both parties will participate independently or
on an agreed basis at each party's own cost: b) activities for which Tanox will
have primary or sole responsibility at Tanox's cost; c) activities for which
Ciba-Geigy will have primary or sole responsibility at Ciba-Geigy's cost; d)
activities which can be undertaken with mutual agreement of the parties and for
which Tanox or Ciba-Geigy will be entitled to reimbursement of its costs and e)
activities for which Ciba-Geigy will have primary or sole responsibility at a
cost to be shared between the parties. Each party shall be responsible for
performing, in good faith, all activities for which it is responsible in a
commercially reasonable manner.

     4.2  Categories of activities in which the respective parties will
participate, and identification of the party which will have responsibility for
each of such activities is set forth in Annex 2 (Research Activities), Annex 3
(Clinical Development Activities), and Annex 4 (Process Development and
Production Activities), respectively. For activities in which both parties have
a major participation, the parties will share responsibility for such activities
or one party will have the overall responsibility, as the Project Steering
Committee may mutually agree (except as specified in Paragraph 4.4 below for
clinical development activities).

     4.3  Costs for each party's activities, as set forth in Annex 2, Annex 3,
and Annex 4, will be borne by such party or will be subject to reimbursement,
all as specified in each such Annex. Reimbursement of Tanox's reimbursable
activities will be made in accordance with the guidelines for reimbursement set
forth in Annex 5.

     4.4  The overall responsibility for IND Application -- U.S. and Clinical
Development -- U.S., as identified in Annex 3, along with the overall regulatory
strategy during clinical development, NDA approval and post-NDS approval phases,
is agreed to be with Ciba-Geigy. However, the parties will jointly participate
through the Clinical Development and PDP Groups in all of such activities. Both
parties will have full access to all submissions to, including clinical studies
and other supporting information, and communications with the FDA relating to
the Product(s). Ciba-Geigy, or its Affiliates, shall file and hold title to all
regulatory applications, approvals and supplements hereto in the U.S.A. Each
party, or its Affiliate(s) or (in the case of Ciba-Geigy and at its discretion,
sublicensees), shall have the irrevocable right to refer to and cross-reference
all such documents for registrations in such other countries, subject to the
terms of this Agreement.

     4.5  Ciba-Geigy and Tanox shall have continuing obligations to timely
advise each other of all adverse drug reactions and other similar matters
relevant to maintaining approvals and registrations of the Product(s).
Ciba-Geigy and Tanox shall have the continuing obligations to timely advise each
other of any governmental regulatory problems, notices, actions or
communications relating to the Product(s).

                Development and Licensing Agreement  -  Page 7.
<PAGE>
     4.6 Ciba-Geigy will bear overall responsibility for commercialization of
the Product(s) in all counties in which it desires to maintain the marketing
rights to the Product(s) set forth in Paragraph 8. Ciba-Geigy agrees to use
commercially reasonable efforts to obtain and maintain all Product(s) approvals,
registrations, and government authorizations necessary for commercial sale of
the Product(s) in all such countries (see 4.7), and will, subject to section
12.2A (ii), maintain commercial sales of Product(s) in those countries in which
such approvals are obtained. Ciba-Geigy shall notify Tanox as provided in
Paragraph 4.7 below should it elect not to exercise its rights to pursue
commercialization of a Product in a country. Ciba-Geigy shall be in compliance
with its responsibilities hereunder so long as it is proceeding with all such
activities in a commercially reasonable manner.

     4.7  A.  When the registration package requesting approval for commercial
sale of the Product(s) (including approval for reimbursement by the appropriate
health insurance authorities as well as price approvals where required) is first
filed in a Major Country, Ciba-Geigy will notify Tanox in writing of such filing
and will advise Tanox in such notice of any countries for which Ciba-Geigy holds
the Exclusive Rights, but does not intend to file for registration of the
Product(s). Such notice will effectuate Ciba-Geigy's voluntary abandonment of
its right hereunder to market Product(s) in such country. With respect to all
other countries outside the U.S., Ciba-Geigy shall submit the registration
package requesting approval for commercial sale of the Products as soon as
reasonably consistent with its normal practice for products within its
organization [currently approximately 3 to 9 months in countries where
Ciba-Geigy's Basic International Registration Dossier (BIRD) forms the basis of
the local submissions]. Thereafter, absent the occurrence of any events beyond
its control, including non-performance by Tanox, of its obligations under this
Agreement, Ciba-Geigy shall have the following maximum periods in which to
commence regular commercial sales of the Product(s) following the date of
approval for commercial sale (including reimbursement and price approval where
required) in each such country.

In the U.S.A.              -- 12 months
In each Major County       -- under normal circumstances 6 months
                                (outside the U.S.A.)
In each other country      -- 24 months

The abandonment of (a) Product(s) pursuant to this Paragraph 4 shall not be
construed to be a termination of this Agreement.

     B.  In the U.S., Ciba-Geigy may voluntarily abandon its right hereunder to
market a Product(s), upon written notice to Tanox, at any time prior to
submission of the NDA for such Product(s) to the FDA. Between the time of
submission and the time of approval of said NDA, Ciba-Geigy may voluntarily
abandon its right hereunder to market a Product(s) in the U.S., upon written
notice to Tanox, solely for the reasons set forth in Section 12.2A (ii) as
grounds for a termination.

     C.  With respect to the Territory outside the U.S.A., Ciba-Geigy shall be
obligated to establish, prior to the commercial introduction of the Product(s),
a

                Development and Licensing Agreement  -  Page 8.
<PAGE>
reasonable minimum sales forecast for years 1 to 4 after introduction in the
Major Countries (established as 1/3 of the best estimate of expected sales);
whereby, if the minimum sales in an average of two consecutive years are not
achieved in a Major Country, Tanox shall have the right to grant a second
license in such Major Country, unless Ciba-Geigy shall pay the minimum royalties
so accrued based on the minimum sales forecast for such period or shall be able
to show that these sales figures have not been reached due to reasons beyond the
control of Ciba-Geigy.

     4.8  If Tanox at any time should advise Ciba-Geigy of its concern, and the
specific reasons for same, that Ciba-Geigy is not pursuing development,
commercialization and sale of the Product(s) outside the U.S.A. in the manner
required under this Agreement, then both parties shall discuss the situation in
good faith to reach a satisfactory resolution addressing Tanox's concerns, as
appropriate.

5.  EXCHANGE OF INFORMATION.

     5.1  Subject to the confidentiality of Paragraph 6, Tanox and Ciba-Geigy
shall share their Know-How with each other. If necessary, each party also will
provide such information to the other, to the extent reasonable, in suitable
form for regulatory approval and registration purposes. Know-How that is subject
to the confidentiality obligations of Paragraph 6 received by each party from
the other shall only be used for the Product(s) in the Field, except with the
express written consent of the other party, such consent not to be unreasonably
withheld. Prior to any use of such Know-How in products outside the Field, each
party agrees that it will discuss in good faith with the other any such intended
use and the possibility of compensation for such use as appropriate in view of
the source and the scientific inventiveness of such Know-How, the source of
funding, and other reasonable factors.

     5.2  The Project Steering Committee and Working Groups, as described in
Paragraph 3, shall be responsible for the exchange of Know-How between Tanox and
Ciba-Geigy. (As appropriate, written reports shall be prepared for the meetings
of the Project Steering Committee and Working Groups).

     5.3  Tanox will obtain, at its cost, its Patent Right(s) covering the
Product(s) in each country in which Tanox believes patent protection to be
appropriate. After the Agreement date, Tanox will advise Ciba-Geigy in writing
not later than four (4) months before the expiration date of the priority year
of the filing of any foreign patent applications, as to those countries where it
does not intend to timely file for patent protection and will offer at the same
time in writing to file in the remaining countries suggested by Ciba-Geigy
corresponding patent applications within such applicable priority year on
Ciba-Geigy's behalf and at Ciba-Geigy's cost. Ciba-Geigy shall collaborate and
share equally with Tanox the cost of preparing and filing patent applications
covering jointly made inventions. Ciba-Geigy will obtain, at its cost, patents
based upon its independent research activities for the Product(s) in each
country in which Ciba-Geigy believes such patent protection to be beneficial or
appropriate.

                Development and Licensing Agreement  -  Page 9.
<PAGE>
     The parties have communicated to each other, prior to the date of this
Agreement, the text of the priority patent applications, and
continuations-in-part, currently filed in the Field as listed in Annex 1. The
parties will communicate to each other, not later than ninety (90) days after
the filing thereof, the text of any additional priority patent applications
which are filed or notice of intention to abandon any such application so as to
permit the other party to assume prosecution of same at its own expense.

6.  CONFIDENTIALITY AND PUBLICATIONS.

     6.1  Unless otherwise provided for in this Agreement, both parties shall
treat the Know-How and any and all other information and data received or
derived under this Agreement as strictly confidential, and shall not disclose
the same to any Third Party during the Agreement Period and for five years
thereafter, except for information which:

          (1) is or shall have been known to the receiving party prior to the
     disclosure by the other party as evidenced by written record of other
     proof;

          (2) is or shall have been public knowledge through no fault of the
     receiving party;

          (3) has been received from a Third Party who did not acquire it
     directly or indirectly from the disclosing party;

          (4) needs to be disclosed to government officials for purposes of
     obtaining registration of the Product(s); or

          (5) is compelled to be disclosed in the course of litigation by a
     Third Party, provided that the party compelled to make such disclosure
     provides the other party to this Agreement with notice of such compulsion
     sufficiently in advance of disclosure so as to provide such other party a
     reasonable time period to seek a protective order.

     Notwithstanding the above, both parties may disclose such information (i)
to their legal representatives and employees, to Affiliates, to legal
representatives and employees of Affiliates, and to consultants to the extent
such disclosure is necessary to achieve the purposes of this Agreement and
provided such legal representatives, employees and consultants are covered by
obligations of confidentiality with respect to such information no less
stringent than those set forth herein; and (ii) as required by law.

     6.2  The parties acknowledge the legitimate interest of their respective
employees in publishing findings under this Agreement to the scientific
community. On the other hand, the parties recognize their mutual interest that
publications be made and lectures, seminars, or other presentations be given
only to the extent that both parties' commercial interests have been reasonably
safeguarded through patent protection or otherwise so that Third Parties cannot
make commercial and/or industrial use of the information contained in such
disclosures. For this purpose, each party shall ensure that the other shall have
the opportunity to comment in advance on any publication or oral

                Development and Licensing Agreement  -  Page 10.
<PAGE>
presentation in public involving disclosure of any information under this
Agreement that may constitute confidential information and that no such
publication or presentation relating to such confidential information under this
Agreement shall be made without such other party's prior written consent. The
party from which such consent is requested shall not unreasonably withhold or
delay such consent. A request from the non-disclosing party that any such
publication or presentation be delayed until a patent application is filed
thereon shall be a reasonable request to delay; provided, that such delay lasts
no more than six (6) months from the date of such request.

7.  PRODUCT MANUFACTURING.

     7.1  In the interest of the competitive position of the Products emerging
from the cooperation, an economic, safe and reliable source of manufacture must
be identified. After the start of Phase I clinical trials, the PDP Group will
initiate the cooperative identification and development of suitable
manufacturing technology to provide the best reasonable conditions for
manufacturing the Product(s). Regulatory provisions which apply to biologicals
may have an impact on the final manufacturing arrangements. For example, it may
be required that Ciba-Geigy obtain and maintain the ELA for the Product(s) in
the U.S.A. to assume and maintain its governmental marketing approval for the
U.S.A. in accordance with this Agreement. If so, Ciba-Geigy may be required to
satisfy FDA requirements for ownership and/or control over the means of
manufacture in order to obtain and maintain such ELA. In that event, Ciba-Geigy
shall hold ownership and/or control over such means of manufacture. The parties
shall negotiate in good faith to reach mutually agreeable terms to permit
Ciba-Geigy to comply with its regulatory responsibilities.

     7.2  In accordance with Amex 4 (Process Development and Production), Tanox
will produce Product(s) required for pre-clinical and Phase I and Phase II
clinical development, subject to reimbursement of Tanox's manufacturing costs
(as defined in the third and fourth sentence of Paragraph 7.4) by Ciba-Geigy.
Production of Product(s) for Phase III clinical trials and subsequent commercial
production will be subject to the respective manufacturing rights of the parties
agreed under this Paragraph 7.

     7.3  Should neither Ciba-Geigy nor Tanox -- working in cooperation to
identify the best reasonable conditions for manufacturing the Product(s) -- be
capable of providing such manufacturing conditions and reasonably determine that
an alternative Third Party source of manufacturing is necessary, then Tanox and
Ciba-Geigy will negotiate in good faith on a reasonable compensation to Tanox
for relinquishing its manufacturing rights. Such compensation to Tanox shall be
established as an appropriate percentage of the estimated manufacturing profits
to Tanox, as mutually agreed.

     7.4  Subject to Paragraph 7.3 above, Tanox will retain manufacturing rights
for *. Ciba-Geigy shall
determine, in good faith, considering Tanox's input and the objectives of this
Agreement, which of Ciba-Geigy's Affiliates' requirements * shall
be supplied by Tanox. For all Product(s) manufactured by Tanox for sale to
Ciba-Geigy pursuant hereto, Ciba-Geigy will purchase such Product(s) from Tanox
at a price *

                Development and Licensing Agreement  -  Page 11.
<PAGE>
*

     In any event, all Product(s) supplied by Tanox shall satisfy the standards
set forth in Annex 3 and 4 and the specifications for the Product(s) to be
agreed upon between the parties. Payment for such Product(s) shall not be due
until after quality control evaluation by Ciba-Geigy determines that said
Product(s) satisfy said standards and specifications.

     7.5 In addition to quantities and pricing of the Product(s) agreed in
Paragraph 7.3 above, additional details concerning the commercial manufacturing
arrangements will be negotiated in good faith between the parties. These
discussions may cover Ciba-Geigy's financial support of Tanox's contribution
to acquisition and/or development of the Know-How for the commercial manufacture
of the Product(s). If it should prove difficult for Tanox to obtain financing
from other sources for the establishment of manufacturing facilities and
operations, Ciba-Geigy declares in principle and without binding effect its
readiness to negotiate with Tanox the conditions of such financial support. In
any event, these conditions should be such as to reflect the risk character of
the investment so that Ciba-Geigy shall obtain an appropriate return on its
investment derived from such manufacturing in case the investment shall be
successful.

     7.6  If the parties reasonably determine that manufacture of the Product(s)
from one facility provides the best reasonable manufacturing conditions, then,
as an alternative, Tanox and Ciba-Geigy may agree to establish manufacturing
capability for the Product(s) in the form of a joint venture.

     7.7  In the event that (i) Tanox could not supply Ciba-Geigy's
requirements, in whole or in part, for the Product(s) or that (ii) Tanox should
not be able to supply, in whole or in part, the Product(s) in the quality as
agreed upon between the parties in writing at least twelve (12) months prior to
the delivery date established for the first commercial supplies by Tanox to
Ciba-Geigy, or that (iii) Ciba-Geigy or its Affiliates or sublicensees should be
compelled to manufacture the Product(s) locally in any country of the Territory
due to the laws or regulations by the government authorities in such country or
due to other compelling commercial reasons beyond the control of the parties,

                Development and Licensing Agreement  -  Page 12.
<PAGE>
Tanox or Ciba-Geigy, as the case may be, shall notify the other party
immediately to this effect and both parties hereto shall, as promptly as
possible, but not later than thirty (30) days after the receipt by Tanox or
Ciba-Geigy, as the case may be, shall notify the other party immediately to this
effect and both parties hereto shall as promptly as possible, but not later than
thirty (30) days after the receipt by Tanox or Ciba-Geigy, as the case may be,
of said notification by Tanox or Ciga-Geigy, start good faith negotiations with
the aim to find a quick solution to overcome the difficulties arisen. If the
parties hereto do not come to an agreement in this respect within ninety (90)
days after the date of notification, then Ciba-Geigy shall have the right to
manufacture itself such portion of its requirements of the Product(s) as may be
necessary without any compensation to Tanox.

     If Ciba-Geigy is manufacturing such Product(s) due to the occurrence of
event (iii) above, then Ciba-Geigy will agree to adjust purchases of its
requirements for other countries in a manner that will permit Tanox to continue
to supply * Regarding the occurrence of events (i) or (ii) above, Ciba-Geigy and
Tanox will negotiate in good faith in concluding the details of the
manufacturing and supply arrangements to establish the return of such
manufacturing responsibility to Tanox as soon as reasonable or to terminate its
manufacturing responsibility, in whole or in part, as appropriate under the
circumstances.

     7.8 Ciba-Geigy shall have the right to have, at its own expense, an
independent certified public accountant, to which Tanox has no reasonable
objection, inspect Tanox's books and records of account to determine and
communicate to Ciba-Geigy only whether Tanox has properly charged Ciba-Geigy
pursuant to Article 7 for supplies of Product(s) and for reimbursement of other
Tanox costs pursuant to this Agreement and the amount of any discrepancy. Tanox
agrees that such records are maintained or will be maintained in sufficient
detail to permit such determination for a period of at least three (3) years
from the date of their origin. If any review by the independent accountant of
Ciba-Geigy of such books and records should indicate that the amount(s) paid by
Ciba-Geigy has not been correct, the parties shall seek to mutually agree to
settle any discrepancies raised by Ciba-Geigy's accountants and, if the parties
mutually agree that the discrepancy is greater than one percent (1%) in Tanox's
favor, then Tanox shall agree to reimburse Ciba-Geigy for the expense of such
inspection.

8.  MARKETING

     8.1  Subject to the terms and conditions of this Agreement, Ciba-Geigy will
have Exclusive Rights in the Exclusive Territories during the Agreement Period.

     8.2  Subject to the terms and provisions of this Agreement, both Tanox and
Ciba-Geigy will have Semi-Exclusive, Co-Marketing Rights in the Semi-exclusive
Territories during the Agreement Period.

     8.3  Notwithstanding anything above to the contrary, in the U.S.A.,
Ciba-Geigy and Tanox will have Semi-Exclusive, Co-Promotion Rights to the
Product(s), subject, as applicable, to the following:

                Development and Licensing Agreement  -  Page 13.
<PAGE>
     A.  Tanox and Ciba-Geigy agree to negotiate in good faith the details of
their Co-Promotion agreement at a mutually agreeable time and in accordance with
the terms and conditions described in this Paragraph 8.3 and elsewhere in this
Agreement as applicable. Such negotiation, however, shall commence no later than
the date of filing of the NDA in the U.S. or at such other earlier time as Tanox
and Ciba-Geigy determine is commercially reasonable.

     B.  Tanox's and Ciba-Geigy's compensation shall be fairly determined based
on the profits from such Co-Promotion computed in a mutually agreeable manner
based on Ciba-Geigy's standard accounting procedures ("Ciba-Geigy Profits"),
which Ciba-Geigy Profits are defined as the difference between Net Sales of the
Product(s) in the U.S.A. and Ciba-Geigy's "Total Marketing Expense" in the
U.S.A. Ciba-Geigy's "Total Marketing Expense" shall include but not
necessarily be limited to the following costs incurred by Ciba-Geigy and by
Tanox, if any, as may be reasonable:

           (i)  Cost of goods to Tanox and Ciba-Geigy, as appropriately
     determined in accordance with Ciba-Geigy's standard accounting procedures:

           (ii)  Royalty payments from Ciba-Geigy to Tanox on that proportion of
     Net Sales attributable to Ciba-Geigy;

          (iii)  Product specific marketing expenses (PSME) which include but
     are not limited to costs for direct advertising, films, samples, exhibits,
     clinical conference aids, peer promotion activities, marketing reasearch
     and such other costs as are normally included in PSME according to
     Ciba-Geigy's standard accounting procedures;

           (iv)  Field force costs (FF) which are the direct and indirect costs
     of the combined Tanox and Ciba-Geigy field forces, such costs to be borne
     by Tanox and Ciba-Geigy respectively, properly allocated to the sale of the
     Product(s) and in accordance with Ciba-Geigy's (and Tanox's) standard
     accounting procedures; provided, that the FF costs may be included or
     excluded from Ciba-Geigy's Total Marketing Expenses as the parties may
     mutually agree;

           (v)  Other marketing expenses according to Ciba-Geigy's standard
     accounting procedures; and

           (vi)  Overhead costs and cost of services as determined in accordance
     with Ciba-Geigy's standard accounting procedures.

     C.  Tanox's compensation (TC) shall be a proportion of Ciba-Geigy Profits,
* of Ciba-Geigy Profits. Such proportion shall be determined by Ciba-Geigy
Profits, and the two factors described below:

                Development and Licensing Agreement  -  Page 14.
<PAGE>
           (i)  Relative field force time (RFFT) is that amount of Tanox's field
     force time spent in direct promotion of the Product(s) to the Product(s)
     target audience, divided by that time spent by the combined Ciba-Geigy and
     Tanox field forces.

          (ii)  Relative field force productivity (RFFP) is that amount of the
     Tanox field force experience, in terms of years, in promoting Product(s) in
     the indication(s) for which the Product(s) are approved, divided by that
     quantity for the Ciba-Geigy field force. RFFP shall at no time be less than
     0.75 or greater than 1.0.

     D.  Tanox acknowledges that it shall permit Ciba-Geigy to design and
implement the overall marketing and sales program as Ciba-Geigy determines is
commercially reasonable for the Product(s), with consideration of such input as
Tanox representatives may from time to time provide, for a reasonable time
following the launch of the Product(s).

     Ciba-Geigy acknowledges that after said reasonable time which shall be no
less than three (3) years following the launch of the Product(s), if Tanox gives
notice to Ciba-Geigy that it is not satisfied with the sales performance of the
Product(s), then in such case Ciba-Geigy, in its discretion, reasonably
exercised, may grant Tanox the right to imitate certain activities on its own in
order to increase the sales performance of the Product(s) and its relative
benefits therefrom.

     E.  Ciba-Geigy acknowledges that, in accordance with its sole right to
determine the overall marketing and sales strategy for the Product(s), and in
consideration of the input to same which, from time to time may be provided by
Tanox, it shall provide Tanox with a commercially reasonable opportunity to
achieve its * compensation of Ciba-Geigy Profits as defined above.

     8.4  If Ciba-Geigy abandons its right to market a Product in a country in
accordance with Paragraph 4.7 (without electing to sublicense), then such rights
shall be owned in full by Tanox and Tanox shall thereafter retain the Exclusive
Rights to market the Product in such country. If Ciba-Geigy has abandoned and
relinquished (either worldwide or in particular countries) its marketing rights
hereunder with respect to the Product(s) (one or more than one, as applicable),
without electing to sublicense, Tanox or a Third Party licensee or sublicensee
of Tanox may freely carry on future development and commercialization of the
Abandonment Product. If Tanox acquires any rights to an Abandoned Product, Tanox
may use any studies conducted by Ciba-Geigy and its Affiliate(s), and shall have
access and rights thereto, to the extent that such rights and access have not
already been provided under this Agreement.

                Development and Licensing Agreement  -  Page 15.
<PAGE>
     9.  Financial Commitments of Ciba-Geigy.

     9.1  Subject to the continuing interest of Ciba-Geigy in this project,
Ciba-Geigy shall pay the following amounts to Tanox upon the happening of the
events specified hereinafter.


                                                  PAYMENT
EVENT                                          (in millions)

  1.  On signing of the Agreement by both         *
      parties
  2.  Within 30 working days after receipt        *
      by Ciba-Geigy of a two (2) mg sample
      of a chimeric mAb developed by Tanox
      at a quality to be agreed upon in
      advance in writing between the
      parties
  3.  Within 30 working days after receipt        *
      by Ciba-Geigy of batch 0 of the
      Product at quantity / quality /
      specifications to be agreed upon in
      advance in writing between the
      parties
  4.  Start by Ciba-Geigy of phase I              *
      clinical trials
  5.  Start by Ciba-Geigy of phase II             *
      clinical trials
  6.  Start by Ciba-Geigy of phase III            *
      clinical trials
  7.  Upon submission of NDA/PLA/ELA in           *
      first Major Country (other than
      Japan) (50% creditable against
      royalties)
  8.  Upon submission of NDA/PLA in Japan         *
      (50% creditable against royalties)
  9.  Upon approval of NDA/PLA/ELA in first       *
      Major Country (other than Japan) (50%
      creditable against royalties)
 10.  Upon approval of NDA/PLA in Japan           *
      (50% creditable against royalties)

     The above payments under event numbers 1 and 4 to 10 shall be due within
thirty (30) days after occurrence of the event specified.

     The above payments (except for the signing payment) shall be made for the
initial Product and for each different Product which the parties agree to pursue
which
                Development and Licensing Agreement  -  Page 16.
<PAGE>
is not a follow-up or second generation product initiated solely by
Ciba-Geigy's R&D activities; however, if the parties agree to replace a Product
being developed with another Product of the same type and function which shows
greater promise, then such payments will continue with the payment next due at
the time such initial product was replaced.

     9.2  A.  In consideration of the rights herewith granted, Ciba-Geigy shall
pay royalties to Tanox on Net Sales of the Product(s) based on the following:


     (i)  on all Net Sales within a calendar year in Exclusive
          Territories, in the aggregate, where Tanox's Patent Right(s)
          exist in the form of issued, valid, and unexpired patents:

          --  up to and including *:                                          *

          --  between * and up to
              and including *:                                                *

          --  over *:                                                         *

     (ii) on Net Sales in Semi-exclusive Territories where Tanox's
          Patent Rights exist in the form of issued, valid, and
          unexpired patents:                                                  *

    (iii) on Net Sales in countries outside of the U.S.A. in which
          there are no Tanox Patent Rights in the form of issued,
          valid, and unexpired patents:                                       *

     (iv) on Net Sales in the U.S.A. if there are no Tanox Patent
          Rights in the form of issued, valid, and unexpired patents:         *

Tanox, at its option on written notice to Ciba-Geigy, may permanently waive
prior to a commercial introduction of the Product(s) its Semi-Exclusive Rights
in one or more countries, from time to time, and such countries shall thereafter
be considered for purposes hereof as countries with Exclusive Rights held by
Ciba-Geigy.

B.  If the Product(s) contain one or more therapeutically active substances and
such substances are of comparable significance, or the added one(s) are of
greater significance than the original Product(s), then the parties shall in
good faith renegotiate a reduction to the above royalty rates applicable to such
Product(s).

C.  Where royalty payments to Tanox become due, Ciba-Geigy shall have the right
to receive a credit for * of the total amount of each such royalty
payment until such time as the cumulative credits received under this provision
shall equal * of the amounts paid under
Paragraph 9.1, event numbers 7, 8, 9 and 10), plus amounts as may be permitted
to be credited against royalty payments under Annex 3, paragraph number 4.

                Development and Licensing Agreement  -  Page 17.
<PAGE>
D.  If in any country any Product is covered by more than one of Tanox's Patent
Rights which entitles Tanox to royalty payments hereunder, the highest royalty
rate shall be applicable, but no cumulation of royalties shall be made.

E.  The royalties shall be payable in each country as follows: (i) until the
last to expire in each of the respective countries of the patents actually used
and covering the manufacture, use, or sale of Product(s) issuing from the patent
applications of Tanox listed in Annex 1 as of the date of the signature of this
Agreement or claiming its priorities thereof (such expiration to occur only
after expiration of extensions of any nature to such patents which may be
obtained under applicable statues or regulations in the respective countries of
Territory, such as the Drug Price Competition and Patent Term Restoration Act of
1984 in the U.S.A. and similar patent extension laws in other countries), or
(ii) for a duration of nine (9) years from the day of the first commercial sale
of the respective Product(s) in each of the respective sales countries if there
is no patent protection in such country at the expiration of such nine (9) year
period, whichever is longer. If a patent expires in a country prior to such nine
(9) year period, then the royalty rate shall drop to the rate applicable in
countries without patent protection.

F.  All royalty payments shall be made in U.S. Dollars for each calendar half
year (ending on June 30 and December 31, respectively) within ninety (90) days
after the end of such calendar half year. Such royalty payments shall be
accompanied by a written statement indicating Net Sales of the Product(s), as
applicable, by country.

If Ciba-Geigy is required to pay or withhold any income tax or other tax with
respect to royalty payments, Ciba-Geigy shall first (i) furnish Tanox, in
writing, with satisfactory evidence that such payment or withholding is
required, (ii) give Tanox its reasonable assistance to enable or assist Tanox to
claim exemption from any such deduction and (iii) shall provide satisfactory
documentation to confirm the payment of the tax.

To the extent and as long as the laws and/or regulations in force in any country
prohibit the payment, conversion or remittance of the royalties as hereby
contemplated, Ciba-Geigy's obligations under this Paragraph 9.2.F. shall be
discharged by the deposit thereof to the account of Tanox, or its designee, in
any commercial bank or trust company selected by Tanox located in such country;
provided, that no infraction of law or regulation occurs in making such deposit.

Tanox shall have the right to have, at its own expense, an independent certified
accountant, to which Ciba-Geigy has no reasonable objection, inspect
Ciba-Geigy's books and records of account to determine and communicate to Tanox
only whether appropriate payments have been made to Tanox and the amount of any
discrepancy. Ciba-Geigy agrees that such records are maintained or will be
maintained in sufficient detail to permit such determination for a period of at
least three (3) years from the date of their origin. If any review by the
independent accountant of Tanox of such books and records should indicate that
the amount(s) paid by Ciba-Geigy have not been correct, the parties shall seek
to mutually agree to settle any discrepancies raised

                Development and Licensing Agreement  -  Page 18.
<PAGE>
by Tanox's accountants and, if the parties mutually agree that the discrepancy
is greater than 1% in Ciba-Geigy's favor, then Ciba-Geigy shall agree to
reimburse Tanox for the expense of such inspection.

     9.3  Notwithstanding any set-offs or other reductions to royalties which
may be provided under this Agreement, the parties agree that the total annual
aggregate royalties payable to Tanox under this Agreement shall in no event be
reduced by greater than * of the total annual aggregate amount which would be
payable absent any such set-offs or reductions.

10.  INDEMNIFICATION; LIABILITY; INFRINGEMENT.

     10.1  Ciba-Geigy shall indemnify and hold Tanox harmless from and against
any and all damages, costs, expenses, and other liabilities, including, without
limitation, all liability claims and damages with respect to the Product(s) sold
by Ciba-Geigy (including sales under Co-Promotion Rights) provided that a) no
later than ten days after receipt of notice by Tanox of such claim, Tanox shall
notify Ciba-Geigy thereof; b) said damages, costs, expenses and other
liabilities do not arise out of the negligence or violation by Tanox of
applicable laws or of its obligations under this Agreement; c) Tanox fully
cooperates with Ciba-Geigy in the defense of such claims without out-of-pocket
cost to Tanox; and d) Ciba-Geigy shall control the defense and or settlement
thereof. Ciba-Geigy also agrees to add Tanox as an additional named insured on
any product liability insurance policy that Ciba-Geigy may have outside the
U.S.A. which covers such Product(s) and furnish satisfactory evidence of same
upon request from time to time.

     Tanox shall indemnify and hold Ciba-Geigy harmless from and against any and
all damages, costs, expenses, and other liabilities, including, without
limitation, all liability claims and damages with respect to the Product(s) sold
by Tanox under its Co-Marketing Rights (or any subsequent Exclusive Rights it
may obtain); provided that a) no later than ten days after receipt of notice by
Ciba-Geigy of such claim, Ciba-Geigy shall notify Tanox thereof; b) said
damages, costs, expenses and other liabilities do not arise out of the
negligence or violation by Ciba-Geigy of applicable laws or of its obligations
under this Agreement; c) Ciba-Geigy fully cooperates with Tanox in the defense
of such claims without out-of-pocket cost to Ciba-Geigy; and d) Tanox shall
control the defense and or settlement thereof. Tanox also agrees to add Ciba-
Geigy as an additional named insured on any product liability insurance policy
that Tanox may have outside the U.S.A. which covers such Product(s) and furnish
satisfactory evidence of same upon request from time to time.

     It is understood, however, that neither party nor their officers, directors
and employees shall be liable for any loss or damage caused by the negligence of
the other party while the latter party is performing its work under this
Agreement.

     10.2  Tanox shall indemnify and hold harmless Ciba-Geigy, its Affiliates
and sublicensees from and against any and all damages, costs, expenses, and
other liabilities incurred by them as the result of any infringement of patent
rights of any Third Party arising from the manufacture, use or sale of the
Product(s); provided that no later than

                Development and Licensing Agreement  -  Page 19.
<PAGE>
ten days after receipt of notice by Ciga-Geigy of any such claim, Ciga-Geigy
shall notify Tanox thereof and give Tanox the opportunity to undertake and
direct the defense and/or settlement thereof. Any amount due to Ciga-Geigy, its
Affiliates or sublicensees pursuant to this indemnification shall be paid solely
out of royalties thereafter due by Ciga-Geigy to Tanox hereunder.

     In the event of any such infringement, Tanox may obtain, or Ciga-Geigy may
require Tanox to use its best efforts to obtain, for Ciga-Geigy a license
applicable to such country of such Third Party's patent rights. If royalties
shall become payable to third parties under such a license obtained by Tanox or
under a license which Ciga-Geigy is compelled to execute with a Third Party to
market Product(s) without infringing the patent rights of that Third Party, such
royalties shall be deductible of the royalties due Tanox, but the royalties due
Tanox shall in any event at least be equal to those in countries of the
Territory without Tanox's Patent Rights.

     10.3  If Tanox, Ciga-Geigy, or its respective Affilite(s) or sublicensees
becomes aware of any actual or threatened infringement of any Patent Rights,
such party shall promptly notify the other party in writing. Ciga-Geigy and its
Affiliate(s) or sublicensees, shall have the first right to bring, at
Ciga-Geigy's own expense, an infringement action against any third party in its
own name, or if necessary in the name of Tanox. If Ciga-Geigy, or its
Affiliate(s) or sublicensees, do not bring a particular patent infringement
action within six (6) months from the date of notification, or within two months
prior to expiration of any applicable statute of limitations on such action,
Tanox, after notifying Ciga-Geigy in writing, shall be entitled to bring such
infringement action at Tanox's own expense. The party not conducting such suit
shall assist the other party and cooperate in any such litigation at the other's
reasonable request without out-of-pocket expense to the party providing such
assistance. The award or settlement in such litigation shall first be used to
pay the legal costs and expenses of such suit and any remaining amount shall be
divided between the parties in proportion to each party's respective injury
caused by the infringer.

     11.  RIGHT OF FIRST REFUSAL.  Ciba-Geigy will have the right of first
refusal to market any Product(s) with the Field that are independently developed
by Tanox as permitted under Annex 3, paragraph number 5. At such time as Tanox
desires to license out all or part of the rights to any such Product(s), Tanox
shall notify Ciba-Geigy in writing, specifying in such notice the terms and
conditions upon which such license will be offered. Ciba-Geigy will have sixty
(60) days after the date of receipt of all relevant information to review such
information regarding the Product(s) as Tanox has made or will make available to
interested Third Parties. If Ciba-Geigy desires to exercise its right of first
refusal hereunder, it will notify Tanox of same and negotiate any details
necessary to consummate such license transaction within one hundred and twenty
(120) days from the date of its decision to exercise such right of first
refusal. At the conclusion of such one hundred and twenty (120) days period,
unless Ciba-Geigy and Tanox have reached written agreement with respect to the
exercise of its rights (with closing to occur within thirty (30) days
thereafter), Tanox shall be free to conclude such license transaction with a
Third Party in accordance with its notice to Ciba-Geigy, provided, that if Tanox
should determine that it will conclude any such license transaction on terms and
conditions

                Development and Licensing Agreement  -  Page 20.
<PAGE>
materially more favorable than those stated in its notice to Ciba-Geigy, then
Tanox will permit Ciba-Geigy to have another right of refusal with respect to
such other terms and conditions.

     12.  TERM; TERMINATION

        12.1  A.  The term of this Agreement shall begin as of the date hereof
and, on a country by country basis, unless earlier terminated as permitted
hereunder, shall remain in effect for the Agreement Period.

     B.  Upon such expiration of the Agreement Period, each party shall continue
to have the right and license to sell Product(s) under any name, trademark, and
product label applicable to the Product(s) sold by such party during the term of
this Agreement so long as such party takes all actions reasonably necessary to
protect and maintain the goodwill associated with such names or marks; except
that in the U.S.A. only Ciba-Geigy shall have the right to continue to use the
previously used trademark. Actions to protect and maintain such goodwill shall
include, without limitation, (i) using and displaying such marks in the manner
required by law and consistent with the manner in which such name(s) or marks
were used or displayed during the term of this Agreement and (ii) using such
names or marks only in connection with Product(s) which meet standards,
specifications, and quality assurance requirements that are the same, in all
material respects, as were applicable to such Product(s) during the term of this
Agreement.

     12.2 A.(i) Prior to submission of a registration package requesting
approval for commercial sale of the Product(s) in the first Major Country, this
Agreement and the licenses granted hereunder may be terminated by Ciba-Geigy,
with or without cause, at any time upon one hundred-twenty (120) days prior
written notice thereof to Tanox. During such period, pending the effectiveness
of such termination notice, Ciba-Geigy agrees to withhold public disclosure of
such termination until it has provided the reasons for such termination to
Tanox. Any payments according to Paragraph 9.1 of this Agreement shall, however,
not become payable by Ciba-Geigy to Tanox during such 120 days' notice period.

     (ii)  Subsequent to submission of a registration package requesting
approval for commercial sales of the Product(s) in the first Major Country, if
Ciba-Geigy reasonably determines, in good faith, that there are unanticipated
limitations on the market opportunity represented by the Product(s) because of
restrictive labeling requirements, side effects, absence of medical needs,
conditions which in Ciba-Geigy's reasonable judgement make it commercially
unreasonable to launch the Product(s), or similar problems, then this Agreement
and the licenses granted hereunder, may be terminated by Ciba-Geigy upon one
hundred and twenty (120) days' prior written notice thereof to Tanox. During
such period, pending the effectiveness of such termination notice, Ciba-Geigy
agrees to withhold public disclosure of such termination until it has provided
the reasons for such termination to Tanox. Any payments according to paragraph
9.1 of this Agreement, shall, however, not become payable by Ciba-Geigy to Tanox
during such one hundred and twenty (120) days' notice period.

                Development and Licensing Agreement  -  Page 21.
<PAGE>
     B.  Either party may terminate this Agreement in the event of a material
breach by the other, provided, that the breaching party is given written notice
of such claimed breach and a reasonable time, not to exceed sixy (60) days, in
which to cure such breach or submit same to arbitration hereunder. Such period
to cure may be extended for up to one hundred twenty (120) days, upon written
request, if such additional time is reasonably necessary to effect such cure;
provided, that such breaching party is using its reasonable efforts to
diligently pursue such cure. If Tanox is the breaching party and fails to cure
its breach within such period allowed for cure, then Ciba-Geigy, at its election
in lieu of termination of this Agreement under Paragraph 12.2.A. above, shall be
entitled to setoff against the royalty payments due Tanox, without effect of the
limitation on aggregate reduction under Paragraph 9.3, the amount of damages
agreed or determined by arbitration to have resulted from such breach.

     12.3  A.  If this Agreement is terminated by Tanox pursuant to Paragraph
12.2.B. or by Ciba-Geigy pursuant to Paragraph 12.2.A., then Ciba-Geigy and its
Affiliate(s) and sublicensees, as applicable, shall return to Tanox all
documented or written Know-How provided by Tanox under this Agreement and Ciba-
Geigy, and its Affiliate(s) and sublicensees, shall have no further right or
license to Tanox's Know-How and Patent Rights. Upon such termination (other than
a termination by Ciba-Geigy pursuant to 12.2.B), Tanox shall retain and be
granted a non-exclusive, world-wide license to Ciba-Geigy's Patent Rights and
Know-How for the manufacture, use, and sale of the Product(s), with the right to
sublicense. If Ciba-Geigy terminates this Agreement in good faith under
Paragraph 12.2.A.(i) because adverse results obtained in the development
activities for the Product(s) make such termination reasonable under the
circumstances and, if Tanox or any of its licensees intends to use Ciba-Geigy's
Patent Rights or Know-How for the manufacture, use and/or sale of the
Product(s), the studies conducted by Ciba-Geigy and its Affiliates and
sublicensees relating to Product(s) may only be used if Tanox shall agree to
compensate Ciba-Geigy for such use in an aggregate amount equal to Ciba-Geigy's
payments to Tanox under Article 9.1, events 1-10 of this Agreement. If
Ciba-Geigy terminates this Agreement under Paragraph 12.2.A(i) for any other
reason and the foregoing use by Tanox or its licensees occurs, then Tanox shall
compensate Ciba-Geigy for such use in an aggregate amount equal to Ciba-Geigy's
payments to Tanox under 9.1, events 3-10, of this Agreement. Such compensation
shall be paid from Tanox's own Product(s) sales and/or from other payments made
by Third Parties for the rights under this Agreement and shall be paid in
installments equal to 3.3% of Tanox's Product(s) sales and/or one-third of such
other payments until Ciba-Geigy has obtained full recovery of the amounts agreed
above.

     If Ciba-Geigy terminates this Agreement under Paragraph 12.2.A.(ii), then:
(i) Ciba-Geigy and its Affiliate(s) and sublicensees, as applicable, shall
return to Tanox all documented or written Know-How provided by Tanox under this
Agreement and Ciba-Geigy, and its Affiliate(s) and sublicensees, shall have no
further right or license to Tanox's Know-How and Patent Rights; (ii) Tanox shall
retain and be granted a non-exclusive, worldwide license to Ciba-Geigy's Patent
Rights and Know-How for the manufacture, use and sale of the Product(s), with
the right to sublicense; and (iii) Tanox may use the studies conducted by
Ciba-Geigy and its Affiliates and sublicensees relating to Product(s) without
paying additional compensation to Ciba-Geigy. In addition, Ciba-

                Development and Licensing Agreement  -  Page 22.
<PAGE>
Geigy will provide Tanox with such additional reasonable assistance in
connection with transfer of development activities, product registrations and
applications, regulatory approvals, and other matters necessary to Tanox's
assumption of Ciba-Geigy's responsibilities under this Agreement as the parties
may mutually agree is appropriate.

     B.  Termination of this Agreement for any reason shall be without prejudice
to Tanox's right to receive all royalties accrued and unpaid on the effective
date of termination and shall not relieve either party of any liability from any
obligations which have accrued hereunder prior to such termination.

     C.  The confidentially obligations set forth in Paragraph 6 shall survive
the termination or expiration of this Agreement for the maximum period permitted
under Paragraph 6.

     13.  FORCE MAJEURE.  Neither party shall be liable to the other for failure
or delay in the performance of any of its obligations under this Agreement for
the time and to the extent such failure or delay is caused by riots, civil
commotions, wars, hostilities between nations, embargoes, acts of God, storms,
fires, accidents, labor disputes or strikes, sabotage, explosions or other
similar or different contingencies, in each case, beyond the reasonable control
of the respective parties. If the performance of any obligation under this
Agreement is delayed owing to a force majeure for any continuous period of more
than six (6) months, the parties hereto shall consult with respect to an
equitable solution, including the possible termination of this Agreement.

     14.  NON-DISCLOSURE.  The existence and the terms of this Agreement shall
not be disclosed by Tanox or Ciba-Geigy to any Third Party or be published
unless both parties expressly agree otherwise in writing. However, this
restriction shall not apply to disclosure of information set forth in the form
of an agreed press release, which will be prepared in mutually agreeable format
and substance following the closing of this Agreement, and to announcements
required by law or regulation except that in such event the parties shall
coordinate to the extent possible with respect to the wording of any such
announcement. Also, this restriction shall not apply to disclosure of this
Agreement to certain private Third Parties such as the shareholders of Tanox,
investment bankers and other financial consultants, and prospective investors in
Tanox or its technology under development, if such disclosure is made under
confidentiality obligations extending for at least three (3) years and otherwise
similar in substance to the provisions of Paragraph 6. Except for disclosure
pursuant to the press release to be mutually agreed following closing, Tanox
expressly agrees that subsequent press releases or other disclosure for press
publication will be subject to the obligations of non-disclosure under this
paragraph, unless such disclosure includes, in substance, only the information
set forth in such agreed press release.

     15.  NOTICES.  All notices or communications sent or delivered hereunder by
one party to the other party shall be in writing and shall be deemed duly given
when delivered to the other party at the address set forth below or when sent by
electronic facsimile transmission (Fax), with receipt evidenced by Fax
transmission acknowledgement, to the Fax number set forth below. A party's
address or Fax number may be changed

                Development and Licensing Agreement  -  Page 23.
<PAGE>
upon notice of such change given to the other party as provided herein. Notice
to the parties shall be delivered to their respective addresses or Fax numbers,
as follows:

If to Tanox:                  Tanox Biosystems, Inc.
                              Attn: Nancy T. Chang, President
                              10301 Stella Link
                              Houston, Texas 77025
                              U.S.A.
                              FAX: (713) 664-8914

If to Ciba-Geigy:             Ciba-Geigy Limited
                              Pharma Licensing
                              CH-4002 Basle
                              Switzerland
                              FAX: 061-6963887

     16. ARBITRATION AND JURISDICTION. The parties agree to attempt to settle
any dispute, controversy or difference arising out of or relating to this
Agreement, or breach thereof, by friendly discussions, including concluding any
subsequent agreements required or contemplated by this Agreement. If and when
any such dispute, controversy, or difference is not settled by such means, then
any such dispute, controversy, or difference shall be subject to arbitration,
with three (3) arbitrators (one each selected by the parties and a neutral
arbitrator appointed by the American Arbitration Association) in accordance with
the rules of the American Arbitration Association. The parties acknowledge that
the arbitrators, if required to resolve any difference or dispute of the parties
with respect to the terms of any such subsequent agreements should be guided by
the purpose and intent of the parties reflected in this Agreement and by general
industry practices among companies of equal bargaining power. The parties agree
to be bound by the award and/or decision of such arbitration and such award
and/or decision may be enforced by any court of competent jurisdiction. The
place of arbitration shall be a mutually agreeable site. This Agreement shall be
construed in all respects and governed by applicable laws of Texas and the
United States.

     17.  RELATIONSHIP OF PARTIES.  Both parties are independent contractors
under this Agreement. Nothing contained in this Agreement is intended nor is to
be construed so as to constitute Tanox or Ciba-Geigy as partners or joint
venturers with respect to this Agreement. Neither party shall have any express
or implied right or authority to assume or create any obligations on behalf of
or in the name of the other party or to bind the other party to any other
contract, agreement, or undertaking with any Third Party.

     18.  ASSIGNMENT.  The rights and obligations of the parties hereunder may
be assigned to Affiliates, but shall otherwise not be transferred or assigned by
either party, except as otherwise permitted in compliance with the requirements
of this Agreement, without the prior written consent of the other party. This
Agreement shall be binding upon and inure to the benefit of any such permitted
assigns or successors.

                Development and Licensing Agreement  -  Page 24.
<PAGE>
     19.  SEVERABILITY.  If any part of this Agreement shall be held
unenforceable, the remainder of the Agreement shall nevertheless remain in full
force and effect.

     20.  ENTIRE AGREEMENT AND AMENDMENT.  As of the date hereof, this Agreement
constitutes the entire understanding between the parties with respect to the
subject matter hereof and supersedes any previous understandings or agreement
between the parties. No modification or amendment of this Agreement shall be
valid or binding upon the parties unless made in writing and duly executed on
behalf of both of the parties. The parties also acknowledge execution of that
certain Stock Purchase Agreement of even date herewith and those additional
agreements to be entered into hereafter which are referenced herein.

     21.  WAIVER.  No failure or delay by any party to insist upon the
performance of any term or condition of this Agreement, or to exercise any
right, power, or remedy hereunder consequent upon a breach hereof, shall
constitute a waiver of any such term, condition, right, power, or remedy, or of
any such breach, or preclude such party from exercising any such right, power,
or remedy at any later time or times.

     22.  AGREEMENT TO PERFORM NECESSARY ACTS.  Each party agrees to perform any
further acts and execute and deliver any and all further documents, agreements,
and/or instruments which may be reasonably necessary or desirable to carry out
or effect the provisions of this Agreement.

     23.  APPLICABLE LAWS.  The parties hereby agree to comply with all laws,
rules, regulations, ordinances, and other governmental requirements in
connection with the performance of their respective rights, responsibilities,
and obligations hereunder, including, without limitation, laws governing export,
import, or other shipment of the Product(s), regulating approvals and
registrations of the Product(s), and requiring identification of Patent Rights
on labels and containers for the Product(s).

                Development and Licensing Agreement  -  Page 25.
<PAGE>
     IN WITNESS WHEREOF, this Agreement has been executed on the day and year
first above written.

                                          TANOX BIOSYSTEMS, INC.

                                          By:  Nancy T. Chang,
                                               Nancy T. Chang, President

                                          CIBA-GEIGY LIMITED

                                          By:   H.F. Mohr
                                          Name: H. F. Mohr
                                          Title: Head, Pharma Licensing

                                          By:   H. Gut
                                          Name: Herbert Gut
                                          Title: Counsel Pharma Div.

                Development and Licensing Agreement  -  Page 26.
<PAGE>
                                    ANNEX 1

                             PATENT RIGHTS IN FIELD

TANOX PENDING PATENT APPLICATIONS

<TABLE>
<S>             <C>            <C>                                    <C>           <C>
TNX37-12        Chang ET AL.   High affinity Anti-Human IgE-          12/31/87      S/N 140,036
  U.S.                         Monoclonal Antibody Which Bind
                               To Igge-Bearing B Cells And Not
                               Basophils
TNX87-12A       Change ET AL.  High affinity Anti-Human IgE-          7/29/88       S/N 226,421
  U.S.                         Monoclonal Antibody Which Binds
                               To IgE-Bearing B Cells And Not
                               Basophils
TNX87-12AA      Chang ET AL.   High affinity Anti-Human IgE-          12/28/88      S/N 291,068
  U.S.                         Monoclonal Antibody Which Binds
                               To IgE-Bearing B Cells And Not
                               Basophils
TNX87-12AAA     Chang          IgE-Specific Antibodies That Do        3/6/89        S/N 320,294
                               Not Bind IgE on B Lymphocytes
                               and Basophils
TNX87-12AAB     Chang ET AL.   High Affinity Anti-IgE Mono-           5/26/89       S/N 357,483
  U.S.                         clonal Antibody Which Binds
                               To IgE-Bearing B Cells And Not
                               Basophils
TNX88-03        Chang          Antigenic Epitopes Of IgE              8/5/88        S/N 229,178
  U.S.                         Present On B Cell But Not
                               Basophil Surface
TNX88-03A       Chang          Antigenic Epitopes Of IgE              11/16/88      S/N 272,243
  U.S.                         Present On B Cell But Not
                               Basophil Surface
TNX-03AA        Chang          Antigenic Epitopes Present             6/21/89       S/N 369,625
  U.S.                         On Membrane-Bound But Not
                               Secreted IgE
TNX87-12AA                     Antigenic Epitopes of Immunoglobulin   1/3/89        S/N 587,431-9
  Canada                       E Present On B Cell
                               But Not Basophil Surface
PCT (3)                        Unique Antigenic Epitopes On           12/29/88      PCT/US88/04706
                               IgE-Bearing B Lymphocytes
CIBA-GEIGY PENDING PATENT APPLICATIONS
Great Britain   Heusser        Monoclonal Antibodies Specific for     5/4/89        4-17570
                               an Immunoglobulin Isotype
</TABLE>
<PAGE>
                                     ANNEX 2

                        COOPERATIVE RESEARCH ACTIVITIES

                         UNDER DIRECTION/SUPERVISION OF
                    PROJECT STEERING COMMITTEE/WORKING GROUP

<TABLE>
<CAPTION>
         RESEARCH ACTIVITIES             MAJOR PARTICIPATION       FUNDING CODE
- -------------------------------------   ---------------------    -----------------
<S>                                     <C>                     <C>
                                                                 (SEE SECTION 4.1)
Continuation of hybridoma research
  for new mAbs                                  T/C-G                    a
mAb characteristics and selection               T/C-G                    a
IN VITRO studies addressing
  therapeutic mechanism and
  efficiency                                    T/C-G                    a
Animal studies addressing therapeutic
  mechanism and efficacy                         C-G                     c
Development of chimeric
  antibody-producing cell lines                 T/CG                     a
Chimeric mAb characterization                   T/C-G                    a
</TABLE>

Tanox will be obligated to perform the above research activities indicated for
up to two other antibodies which the parties may mutually agree to pursue and,
specifically, is responsible for completion of such development for Tanox's
monoclonal antibody (mAb) 11-4-70 (the above mentioned other antibodies will be
selected by mutual agreement of Tanox and Ciba-Geigy for initial clinical
development).

If Ciba-Geigy reasonably believes that other approaches such as Fab or hybrid
derivatives or antibody conjugates should be pursued, Tanox and Ciba-Geigy can
establish a mutually acceptable product development plan, subject to
reimbursement of Tanox costs for its activities under the plan.
<PAGE>
                                    ANNEX 3

                  COOPERATIVE CLINICAL DEVELOPMENT ACTIVITIES

                         UNDER DIRECTION/SUPERVISION OF
                    PROJECT STEERING COMMITTEE/WORKING GROUP

1.    Tanox warrants that Tanox's *, to the extent tested:

      -    reacts specifically with *, not other serum substances
           (including specifically *).

      -    reacts with *, not other cell types.

      -    does not induce *.

      -    does not bind to *.

      -    does not bind to *

      -    has a high *

      Further, Tanox has provided Ciba-Geigy prior to the date of this Agreement
      with approximately 5 mg of the purified murine mAb 11 -- 70 and will
      provide Ciba-Geigy with an additional 7 mg of such mAb (+ or - 90% pure)
      upon the closing of this Agreement, if requested, so that Ciba-Geigy can
      perform additional confirmatory testing of the above.

2.    Subject to confirmation of the above characteristics by Ciba-Geigy, the
      parties agree that Tanox's mAb 11 -- 70 is a promising candidate and
      warrants initiation of clinical development with the comparable chimeric
      mAb 11 -- 70 as soon as such antibody has been developed and produced for
      initial clinical trials provided that the additional studies required for
      an IND confirm such assessment. Therefore, the parties agreed that the
      necessary studies outlined below will be completed and phase 1 trials in
      the U.S., Europe, or another country will be undertaken with such antibody
      (or such other antibody as Tanox and Ciba-Geigy may reasonably agree to
      substitute) as soon as sufficient quantities of the antibody have been
      produced by Tanox in accordance with GMP and GCP (as provided in Annex 4)
      to initiate the studies.

<TABLE>
<CAPTION>
                                                                                      FINANCIAL
                     PRODUCT DEVELOPMENT              ACTIVITY RESPONSIBILITY      RESPONSIBILITY
            -------------------------------------     ------------------------     ---------------
            <S>                                       <C>                          <C>
                                                                        (SEE SECTION
                                                                            4.1)
            Safety Pharmacology                                 C-G                       c
            Toxicological Studies
            (Preclinical)                                       C-G                       c
            (Clinical)                                          C-G                    c or a*
            Galenical Formulations
            (Clinical)                                          C-G                    c or a*
</TABLE>
<PAGE>
<TABLE>
<CAPTION>
                                                                                      FINANCIAL
                     PRODUCT DEVELOPMENT              ACTIVITY RESPONSIBILITY      RESPONSIBILITY
            -------------------------------------     ------------------------     ---------------
            <S>                                       <C>                          <C>
                                                                        (SEE SECTION
                                                                            4.1)
            IND Application -- Europe, Japan and                C-G                   c or a**
              other countries
            IND Application -- U.S.                             C-G                       e
            Clinical Development -- Europe,                     C-G                   c or a***
              Japan and other countries
            Clinical Development -- U.S.                        C-G                       a
</TABLE>

            ------------

            a*   --  If performed in U.S.

            a**  --  For countries where Tanox has Co-Marketing rights

            a*** --  For local clinical trials in countries where Tanox has
                     Co-Marketing rights.

3.    For clinical development activities outside the U.S., the Clinical
      Development Group will serve as a conduit by which Tanox will be able to
      review and stay informed with respect to progress and results of such
      activities. For clinical development within the U.S., however, it will be
      the responsibility of the Clinical Development Group, with the supporting
      participation of the PDP Group and its activities, to actively direct and
      supervise all such clinical development of the Product(s) and Tanox shall
      be a participant in such activities and decisions relating thereto. If any
      difference of opinion should exist with respect to such decisions,
      Ciba-Geigy shall retain final responsibility for such decisions, after
      considering in good faith Tanox's input, which shall be provided in such
      timely manner so as not to impede the progress of the program.

4.    Ciba-Geigy shall maintain a record of its costs for clinical development
      activities in the U.S. according to its standard accounting procedures,
      which shall reasonably and fairly establish such costs. Tanox shall
      contribute to said costs * provided, that Tanox's obligation for such
      costs will be paid solely out of credits against royalties and subject to
      the annual limitations contained in Paragraph 9.2.C. The measurement year
      for purposes of determining Tanox's contribution will be the first full
      calendar year following product introduction in the United States. To the
      extent Tanox has incurred any costs in connection with its activities
      hereunder for U.S. IND and clinical development, such costs will be
      included in the total U.S. IND and clinical development costs and Tanox
      shall be entitled to a credit against its required contribution hereunder
      for the total amount of its costs.

5.    If Tanox desires to pursue development of any Products(s) within the
      Field, in addition to Product(s) already being developed hereunder, which
      Ciba-Geigy believes is not sufficiently superior to justify a simultaneous
      clinical development program, then Tanox itself, without giving rights to
      any Third Party, will have the right to pursue development of such
      Product(s) at its sole expense; subject, however, to the right of first
      refusal of Ciba-Geigy to license the Product(s) as provided under
      Paragraph 11 of this Agreement.
<PAGE>
                                     ANNEX 4

            COOPERATIVE PROCESS DEVELOPMENT AND PRODUCTION ACTIVITIES

                         UNDER DIRECTION/SUPERVISION OF
                    PROJECT STEERING COMMITTEE/WORKING GROUP

1.    The PDP Group and Clinical Development Group will initially work closely
      together to establish specifications for the Product(s) and to assure the
      production of sufficient Product(s) to permit the parties to initiate
      Phase I clinical trials as soon as possible. Throughout the continuation
      of clinical trials, Process Development and Production Activities will be
      coordinated with Clinical Development Activities to assure completion of
      regulatory approvals and registrations in a commercially reasonable manner
      as required under the Agreement. Ciba-Geigy and Tanox shall share such
      activities. Tanox's in-house costs and necessary Third Party costs
      incurred by Tanox and agreed upon by both parties shall be reimbursed by
      Ciba-Geigy in accordance with the reimbursement guidelines set forth in
      Annex 5.

2.    Process development and production activities shall include the following:

      A.    Adaption of production cell lines, including cloning, screening and
            selecting with procedures designed to identify stable and high
            producing cell lines.

      B.    Scale-up of production cell lines, including adaption of cell lines
            to and optimization of production medium and analysis and selection
            of optimal cell culture production method (scale-up will occur in
            reasonable stages which will permit initial production of Product(s)
            for the start of clinical trials as soon as possible, with
            continuing scale-up activities as necessary for subsequent
            production of Product(s) in commercial quantities as contemplated by
            this Agreement).

      C.    Characterization and quality assurance, maintenance and improvement
            of the production cell lines, including Third Party costs necessary
            to testing and standardization of the production cell lines.

      D.    Development of purification processes and Product(s) specific
            analytical techniques necessary for characterization and required
            regulatory and QA/QC testing of Product(s), including final products
            for clinical trial production and for subsequent production of
            Product(s) in commercial quantities as contemplated by this
            Agreement.

      E.    Development and standardization of raw material and final product
            manufacturing procedures, including product formulation, vialing,
            labeling and packaging.
<PAGE>
3.    Tanox warrants that it will produce Product(s) for Ciba-Geigy in
      accordance with all applicable U.S. laws, including, but not limited to,
      U.S. guidelines for Good Manufacturing Practices (GMP) and Good Clinical
      Practices (GCP) and in accordance with all applicable laws in countries
      where Ciba-Geigy wishes to use (a) Product(s) produced by Tanox, provided
      such laws place no undue burden on Tanox, and within specifications to be
      mutually agreed to fulfill regulatory requirements for Phase I and Phase
      II clinical trials in the U.S., Europe, Japan, and such other countries as
      separate clinical trials may be reasonably determined to be necessary. The
      parties anticipate that Phase I clinical trials shall be initiated first
      in either the U.S. or a Major Country in Europe and that Phase I clinical
      trials will be initiated in any other Major Country in which they are
      determined to be necessary as soon as reasonably possible.

4.    The PDP Group, as provided by Paragraph 3.2, shall coordinate production
      of clinical trials material for Phase III studies in a manner that the
      parties mutually agree will best permit obtaining necessary regulatory
      approvals and Product(s) registrations.

5.    The PDP Group will be responsible for coordinating process development as
      provided in Paragraph 1 above, together with considering any technology
      acquisition and coordinating the establishment of necessary manufacturing
      facilities, in the manner reasonably designed to result in the
      uninterrupted continuation of clinical trials to conclusion and to permit
      the establishment of reasonable levels of Product(s) inventory by such
      time as the first approval to sell Product(s) commercially is obtained.
<PAGE>
                                     ANNEX 5

                            REIMBURSEMENT GUIDELINES

Reimbursement of Tanox activities, as applicable, shall be made in accordance
with the following guidelines and procedures:

1.    The total reimbursable cost of the Tanox activities subject to
      reimbursement will include the following categories of charges, as
      applicable: direct personnel and travel costs related to the activities
      except for IND filing and for clinical development in the U.S.A. through
      to NDA approval, overhead charges that are allocated to the production
      project according to accounting standards and practices generally
      acceptable within the industry, supplies and materials necessary for
      applicable research, production, testing, and regulatory requirements
      (including establishment of master and working cell banks), dedicated
      equipment costs (if desired, this equipment can be shipped to Ciba-Geigy,
      at its expense, upon completion of Tanox's production responsibilities),
      direct third party costs for storage, testing, and vialing and
      miscellaneous insured shipping costs. No General & Administrative charges
      will be included.

2.    Under its procedures for reimbursement, Tanox will send Ciba-Geigy
      semi-annual budgets, on a calendar year basis, in sufficient detail to
      reasonably identify general categories of costs. The activities and
      estimated budget for the first 6-month period (beginning for the period
      from the date of this Agreement through December, 1990) will be submitted
      for Ciba-Geigy's review and approval. The activities and budget estimates
      for the activities suggested for the second 6-month period are for general
      information only since schedules and activities may change based on
      project status and progress.

3.    Upon approval of the estimated budget by Ciba-Geigy for the next 6-month
      period, which Ciba-Geigy will complete as soon as possible (but in any
      event within thirty [30] days of receipt thereof), Tanox will submit an
      invoice, or other appropriate request for payment, for 80% of the
      estimated budget. Ciba-Geigy will pay this invoice in accordance with its
      normal procedures for 30-day payment obligations. Within 30 days (this
      would be December 1, 1990 for the next following budget) of the beginning
      of next 6-month budget period, Tanox will repeat the above budget approval
      procedures.

4.    Tanox also will include in each succeeding invoice an adjustment
      calculation for actual total costs incurred in the preceding six (6) month
      period, together with any other supporting documentation reasonably
      requested. The amount computed in this adjustment calculation will be
      added to (or possibly "deducted from" if excess payment was made) the
      amount to be invoiced for the next budget period.

5.    The above procedures will be repeated as long as Tanox reimbursable
      activities are continued.

                                                                   EXHIBIT 10.11

CERTAIN INFORMATION IN THIS EXHIBIT IS SUBJECT TO A REQUEST FOR CONFIDENTIAL
TREATMENT. IN ACCORDANCE WITH RULE 406 UNDER THE SECURITIES ACT OF 1933, AS
AMENDED, SUCH INFORMATION HAS BEEN OMITTED AND FILED SEPARATELY WITH THE
SECURITIES AND EXCHANGE COMMISSION. THE LOCATION OF SUCH OMITTED INFORMATION HAS
BEEN INDICATED WITH AN ASTERISK(*).

                  CHIRON-PANGENETICS RESEARCH AND DEVELOPMENT
                   LICENSE AND OPTIONS FOR COMMERCIAL LICENSE

THIS AGREEMENT, by and between PanGenetics B.V. ("PanGenetics B.V.") a company
organized and existing under the laws of the Netherlands and having its
principal place of business at E. van Calcarstraat 30, 1963 DG Heemskerk, the
Netherlands, and Panorama Research Inc. ("Panorama"), a company organized and
existing under the laws of California, and having its principal place of
business at 2462 Wyandotte Street, Mountain View, California 94043 (collectively
PanGenetics B.V. and Panorama shall be deemed "PanGenetics"), Mark de Boer
("de Boer"), and Chiron Corporation ("Chiron"), a Delaware corporation
having its principal place of business at 4560 Horton Street, Emeryville,
California 94608, is effective upon the last signature date (the "Effective
Date").

                                   BACKGROUND

WHEREAS, certain inventions relating to marine monoclonal antibodies against the
human antigen known as CD40 ("Anti CD40 Mabs") have been made by Chiron, and
by de Boer, subject to the provisions of a material transfer agreement between
Chiron's predecessor Cetus and de Boer dated December 16, 1991, (the "1991
MTA"), a consulting agreement between Chiron and de Boer dated January 1, 1993,
(the "1993 Consulting Agreement"), a consulting agreement between Chiron and
de Boer dated January 1, 1994 (the "1994 Consulting Agreement"), a material
transfer agreement between Chiron and Panorama dated November 9, 1994 (the
"1994 MTA") and their subsequent amendments.

WHEREAS, PanGenetics, Chiron and de Boer (the "Parties") now wish to provide
for the licensing of rights relating to such inventions and the further
development of anti-CD40 antibodies for human therapeutic uses;

                                   AGREEMENT

NOW, THEREFORE, PanGenetics, Chiron and de Boer agree as follows:

1  DEFINITIONS

     As used in this Agreement:

     1.1  "AFFILIATE" with respect to any person, means any company, entity,
joint venture or similar business arrangement which is controlled by,
controlling or under common control with such person, and shall include without
limitation any company fifty percent or more of whose voting stock or
participating profit interest is owned or controlled, directly or indirectly, by
such person, and any company which owns or controls, directly or indirectly,
fifty percent or more of such person. Without limiting the generality of the
foregoing, the Affiliates of Chiron expressly exclude Ciba-Geigy Limited, a
Switzerland corporation, or any wholly owned subsidiaries of Ciba-Geigy Limited
("Ciba"), unless and until such time as Ciba-Geigy and Chiron may mutually
agree upon the terms and conditions upon which Ciba may be deemed an Affiliate
of Chiron for the purposes of this Agreement.

     1.2  "ANTI-CD40 MABS" means monoclonal antibodies against human CD40

                                       1
<PAGE>
produced by the hybridomas 5D12, 3A8 and 3C6, or any monoclonal antibody derived
therefrom, including humanized anti-CD40 Mabs, and/or human anti-CD40 Mabs, and
fragments thereof capable of binding the Human CD40 Molecule.

     1.3  "CHIRON TECHNOLOGY" means all information, developments,
discoveries, inventions, know-how, products, substances, processes and
methodologies, and other proprietary information or technology developed or
otherwise acquired by Chiron relating to the Field as of the Effective Date,
including, but not limited to, the hybridoma cell lines described in Section
1.2, the Anti-CD40 Mabs produced therefrom, and the use of said Anti-CD-40 Mabs.

     1.4  "CHIRON PATENTS" means any U.S. patents or patent applications,
including any continuations, renewals, extensions or re-issues or divisions
thereof, relating to, or incorporating the Chiron Technology, together with any
foreign counterpart thereof and any divisional, continuation,
continuation-in-part and any reissue or extension thereof, to the extent they
claim or incorporate the Chiron Technology, including, but not limited to, U.S.
patent application USSN 08/070,158, and those patent applications filed in the
countries designated by PCT filing WO 94/01547 and are listed on the PCT Patent
Application Schedule attached as Exhibit 1, and any patentable improvements
invented by Chiron or relating to the lumanization of Anti-CD40 Mabs and
fragments thereof capable of binding the Human CD40 Molecule.

     1.5  "CHIRON TERRITORIES" shall mean all countries of the world, except
Europe and Japan.

     1.6  "DE BOER RIGHTS" shall mean de Boer's interest in inventions within
the Field (i) which are governed by the 1991 MTA, attached as Exhibit 3 to this
Agreement, and its subsequent amendments; and (ii) without limiting the
foregoing, inventions within the Field created by de Boer during the course of
this agreement. With respect to all de Boer inventions within the Field which
are governed by the terms and conditions of the 1993 Consulting Agreement, the
1994 Consulting Agreement, (collectively the "Consulting Agreements") and
their subsequent amendments, de Boer has assigned or will assign all right title
and interest in such inventions to Chiron in accordance with the terms of said
Consulting Agreements. de Boer rights arising from inventions within the Field
made by de Boer after the conclusion of the Consulting Agreements shall be
governed by the terms and conditions of this Agreement, including, without
limitation, the provisions of Article 3, relating to de Boer's assignment of de
Boer rights to PanGenetics, and Pan Genetics' obligations to assign to Chiron
patentable improvements relating to the humanization of Anti-CD40 Mabs and
fragments thereof capable of binding the Human CD40 Molecule for inclusion
within the Chiron Patents.

     1.7  "FIELD" means the use of Anti-CD40 Mabs or products based on or
derived from the use of Anti-CD40 Mabs in human therapeutic applications wherein
the Mab mediates a therapeutic effect by binding to the Human CD40 Molecule. The
Field shall not include the use of gene therapy, except to the extent
PanGenetics is permitted under the terms and conditions of this Agreement,
including, without limitation, the terms and conditions set forth in Article 7
to undertake activities relating to Second Generation Products which use gene
therapy solely for the endogenous local delivery and synthesis of Anti-CD40
Mabs. The following commercial applications are specifically excluded from the
Field: (i)

                                       2
<PAGE>
vaccines; (ii) diagnostics; (iii) gene therapy, anti-gene therapy, including,
without limitation, the use of antisense or ribozyme molecules, except as
provided in Article 7 and (iv) peptidomimetic or other synthetic,
small-molecular weight, non-peptide molecules. Without limiting the foregoing,
PanGenetics may use Anti-CD40 screening assays, provided that such assays are
used solely for non-commercial, internal research purposes.

     1.8  "HUMAN CD40 MOLECULE" means the type I transmembrane protein encoded
by the CD40 gene and known to be expressed on a number of cells including,
without limitation, B cells, dendritic cells, monocytes and macrophages.

     1.9  "JOINT TECHNOLOGY" shall mean Technology and inventions within the
Field which are invented jointly by employees of Panenetics (including persons
obligated to assign inventions to PanGenetics) and employees of Chiron
(including persons obligated to assign inventions to Chiron), whether or not
such inventions are also owned in conjunction with third parties pursuant to
this Agreement.

     1.10  "JOINT TECHNOLOGY PATENTS" shall mean U.S. patents or patent
applications claiming or incorporating Joint Technology, together with any
foreign counterpart thereof and any divisional, continuation,
continuation-in-part and any reissue or extension thereof, to the extent they
claim or incorporate Joint Technology.

     1.11  "LICENSED PRODUCT(S)" means any product, the manufacture, use or
sale of which, but for the license granted hereunder, would infringe any valid
and enforceable claim of any Chiron Patents or PanGenetics Patents in the
country of such manufacture, use or sale, or product, which relates to or
requires the use of Chiron Technology or Panorama Technology. Licensed Products
include, but are not limited to, any human therapeutic product(s), or one under
development, which is based directly or indirectly on an Anti CD40 Mab or
products based on or derived from the use of Anti-CD40 Mabs. The following
commercial applications are specifically excluded from the Field: (i) vaccines;
(ii) diagnostics; (iii) gene therapy, anti-gene therapy, including, without
limitation, the use of antisense or ribozyme molecules, except as provided with
respect to Second Generation Products as provided in Article 7 and (iv)
peptidomimetic or other synthetic, small-molecular weight, non-peptide
molecules.

     1.12  "NET SALES" shall mean the amount billed or invoices for each unit
of Licensed Products sold less:

       (i)  Customary trade, quantity or cash discounts;

      (ii)  Amounts repaid or credited by reason of rejection or return; and/or

     (iii)  To the extent separately stated on purchase orders, invoices or
            other documents of sale, taxes levied on and/or other governmental
            charges made as to production, or transportation or insurance
            charges.

      (iv)  sales and value-added taxes separately stated on invoices. Licensed
            Products shall be considered sold when shipped.

                                       3
<PAGE>
     In the event that Licensed Products are sold in combination with another
product or active component, (a "Combination Product") for a single price, Net
Sales from sales of Combination Products for purposes of calculating royalties
due or allocating profits under this Agreement shall be calculated by
multiplying the Net Sales of that Combination Product by the fraction A/(A+B),
where A is the gross selling price of the Licensed Product sold separately in
the country of sale and B is the gross selling price of the other product(s) or
components sold separately in the country of sale. In the event that no such
separate sales are made, Net Sales, for purposes of determining royalty payments
on such Combination Products, shall be a reasonable apportionment of the gross
amount invoiced therefor based upon the relative contribution of the Licensed
Products to the price of the Combination Product. Such apportionment shall be
negotiated in good faith between the parties and such apportionment shall be
established prior to the time that a party hereto shall have the right to sell
such Combination Products.

     1.13  "PANGENETICS TECHNOLOGY" shall mean all information, developments,
discoveries, inventions, know-how, products, substances, processes and
methodologies, and other proprietary information or technology developed or
otherwise acquired by PanGenetics relating to the development of Licensed
Products within the Field, including, but not limited to, methods for preparing
or using such materials as well as methodologies for testing their interaction
in biological systems, clinical and pre-clinical data and submissions,
discoveries and trade secrets, whether patentable or unpatentable, and other
proprietary information or technology developed by PanGenetics, or licensed to
PanGenetics with a right to sublicense, or otherwise acquired by PanGenetics
within the Field, prior to or after the Effective Date of this Agreement.

     1.14  PANGENETICS PATENTS" shall mean U.S. patents or patents issuing from
patent applications claiming or incorporating PanGenetics Technology, together
with any foreign counterpart thereof and any divisional, continuation,
continuation-in-part and any reissue or extension thereof, to the extent they
claim or incorporate PanGenetics Technology, as set forth in the PanGenetics'
Patent Schedule, attached as Exhibit 2 to this Agreement, and as may be amended
from time to time. In the event that PanGenetics Patents include any patentable
improvements relating to the humanization of Anti-CD40 Mabs and fragments
thereof capable of binding the Human CD40 Molecule, or any other improvements to
Chiron Patents, the provisions of Article 1.4 and Section 3.9 shall apply.

     1.15  "PANGENETICS TERRITORIES" shall mean Europe and Japan.

     1.16  "SECOND GENERATION PRODUCTS" shall mean products which involve the
use of gene therapy solely for the endogenous local delivery and synthesis of
Anti-CD40 Mabs. Second Generation Products shall be governed by the provisions
of Article 7 of this Agreement, and shall not be governed by the provisions of
the Commercial License contemplated in Article 6. This Agreement grants
PanGenetics no license, express or implied, to create Second Generation
Products.

2.  OWNERSHIP

     PanGenetics hereby acknowledges and confirms that Chiron is the owner of
the Chiron Technology and the Chiron Patents. PanGenetics hereby agrees to
assign to Chiron all right, title and interest PanGenetics might acquire,
invent, develop or claim in Chiron

                                       4
<PAGE>
improvements which fell within Claims Technology or Chiron Patents, or
improvements thereto, subject to the license rights granted to PanGenetics under
this Agreement. PanGenetics shall, without additional consideration from Chiron,
execute (or, if necessary, PanGenetics shall cause any of its employees to
execute) any assignment or other documentation reasonably required to record or
confirm such ownership by Chiron.

3.  RESEARCH AND DEVELOPMENT LICENSE

The Parties commit to the following:

     3.1  RESEARCH AND DEVELOPMENT LICENSE.  Subject to the terms hereof, Chiron
hereby grants PanGenetics an exclusive, (except as to Chiron) research and
development license (the "Research and Development License") under the Chiron
Patents and Chiron Technology, solely to carry on research and development
activities worldwide with respect to the Licensed Products. This Research and
Development License grants PanGenetics no rights to make, use or sell Licensed
Products for commercial purposes. The Research & Development License is subject
to the provisions of Section 3.6 relating to due diligence. As provided in
Section 3.6, upon the failure of PanGenetics to fulfill its due diligence
obligations, Chiron shall have the right, but not the obligation, to terminate
the Research and Development License granted pursuant to this Section 3.1. In
the Event of such termination, Chiron shall retain all rights under the Chiron
Technology and Chiron Patients, and shall be granted rights under PanGenetics'
Patents and Technology pursuant to Section 5.2 of this Agreement.

     3.2  EVALUATION OF PATENT RIGHTS.  Chiron shall undertake commercially
reasonable efforts to prosecute and maintain all United States and foreign
patent applications and patents defining Chiron's rights in the Chiron
Technology and Chiron Patents. A report from an outside patent counsel assessing
the Parties' freedom of operation to develop, use, manufacture or sell Licensed
Products has been prepared and received by PanGenetics.

     3.3 DE BOER PANGENETICS COUNSELING AGREEMENT. Subject to the rights and
obligations of Chiron and de Boer under the Consulting Agreements and their
subsequent amendments, PanGenetics and de Boer shall enter into a separate
agreement, (the "de Boer PanGenetics Consulting Agreement") to be effective on
the Effective Date, pursuant to which de Boer shall consult and collaborate with
PanGenetics, at no expense to Chiron, on research related to the Chiron
Technology, and the development of Licensed Product. The de Boer PanGenetics
Consulting Agreement may make provisions for coordinating the Anti CD40 Mab
related research activities of de Boer and PanGenetics with the anti CD40 Mab
related research activities of Professor Lucien Aarden at the Central Laboratory
of the Netherlands Red Cross Blood Transfusion Services ("CLB") in Amsterdam.
Any inventions made by de Boer within the Field which relate to or result from
collaborative activities, including, without limitation, collaborative
activities with the CLB, shall be subject to terms and conditions of this
Agreement, and if applicable, the terms and conditions of the 1991 MTA and
Consulting Agreements. PanGenetics and de Boer represent and warrant that any
and all collaborative activities undertaken by PanGenetics and de Boer shall
comply in all respects with the terms and conditions of this Agreement,
including, without limitation, the provisions of Section 3.4.

     3.4  EMPLOYEE OBLIGATIONS.  PanGenetics and de Boer represent and warrant
that all

                                       5
<PAGE>
employees, representatives, agents or consultants who will be involved in
activities relating to this Agreement shall be bound by an obligation to assign
all inventions to PanGenetics and to cooperate with Chiron and/or PanGenetics in
connection with the patenting of any such inventions. Neither de Boer nor Pan
Genetics shall permit persons not bound by such obligations to work on the
Research.

     3.5  RESEARCH & DEVELOPMENT PLAN.  PanGenetics will product and submit to
Chiron for Chiron's review and approval a product development and business plan
(the "Research and Development Plan") which outlines the research and
development activities necessary to bring a Licensed Product to market. At a
minimum, PanGenetics' Research and Development Plan shall provide milestones
from early research activities though Phase III Clinical trials and evaluation,
which will permit Chiron to measure PanGenetics' diligence in complying with its
research and development obligations. The Research and Development Plan shall be
incorporated into this Agreement, and are attached as Exhibit 6.

     3.6 DUE DILIGENCE. PanGenetics shall exercise its best efforts and due
diligence in developing and bringing to market a Licensed Product. Within four
(4) years after the Effective Date of this Agreement, PanGenetics shall enter
into clinical trials directed toward evaluating candidates for a Licensed
Product for commercial use. PanGenetics shall be solely responsible for
acquiring, and, if applicable, maintaining, any third party patents relating to
humanized Mabs and/or human Mabs and processes for making humanized Mabs and/or
human Mabs required by PanGenetics for the development and commercialization of
a Licensed Product. If, on the date occurring at the end of five (5) years from
the Effective Date, PanGenetics has not filed an IND or equivalent submission
related to Licensed Products with either the Japanese Koseisho, or a
corresponding regulatory agency in the United Kingdom, Germany, France or other
major market country in the European Community, Chiron shall have the right to
determine whether PanGenetics has made diligent efforts to produce Licensed
Products. In the event that Chiron reasonably determines that PanGenetics has
not satisfied the criteria set forth above, and has not exercised the requisite
diligence in developing Licensed Products, PanGenetics's license grant shall
continue, but PanGenetics shall pay to Chiron an annual maintenance fee of * to
preserve its rights under this Agreement. If, on the date occurring at the end
of eight (8) years from the Effective Date, PanGenetics has not released a
Licensed Product in any major market, and PanGenetics cannot demonstrate
commercially reasonable diligence in developing Licensed Products, Chiron shall
have the right to terminate this Agreement, and all license grants made to
PanGenetics hereunder shall revert back to Chiron. Once initiated, PanGenetics'
obligation to pay the * annual maintenance fee shall continue until PanGenetics
pays to Chiron the registration payment referenced in Section 6.6 of this
Agreement. PanGenetics' rights to undertake research and development activities
shall be subject to Chiron's First Refusal Rights as referenced in the
provisions of Section 6.12 of this Agreement.

     3.7  PANGENETICS IMPROVEMENTS.  Upon Chiron's request, as promptly as
reasonably practicable, PanGenetics shall supply Chiron with reasonable
quantities of improvements to Chiron Technology, including Anti-CD40 Mabs,
developed by PanGenetics, for Chiron's use. Further, in the event PanGenetics
develops any improvements relating to the humanization of Anti-CD40 Mabs and
fragments thereof capable of binding the Human CD40 Molecule, or any other
improvements to Chiron Patents, (the "PanGenetics Improvements") PanGenetics
shall assign to Chiron all right title and interest in such

                                       6
<PAGE>
PanGenetics Improvements, including, without limitation, the right to file,
prosecute and maintain patients related to the PanGenetics Improvements. Chiron
shall grant back to PanGenetics licenses to such Pangenetics Improvements (the
"PanGenetics Improvement Grant-Back License"). During the term of the Research
and Development License, the PanGenetics Improvement Grant Back License(s) shall
be worldwide, co-exclusive and royalty free. Once the parties have concluded the
terms of the Commercialization License, the PanGenetics Improvement Grant-Back
Licenses shall be worldwide, co-exclusive and royalty free.

     3.8  ASSIGNMENT OF DE BOER RIGHTS TO CHIRON.  de Boer grants Chiron all
right, title and interest in the de Boer Rights existing as of the Effective
date. Further, de Boer and PanGenetics agree to undertake all measures necessary
to perfect Chiron's interest in all present and future de Boer Rights,
including, without limitation, the execution of assignments to convey all de
Boer Rights existing as of the Effective Date of this Agreement.

     3.9  ASSIGNMENT OF DE BOER RIGHTS TO PANGENETICS AND CHIRON.  deBoer Rights
arising from inventions within the Field made by de Boer after the conclusion of
the Consulting Agreements shall be governed by the terms and conditions of this
Agreement. de Boer and PanGenetics agree that de Boer shall assign all such de
Boer Rights to PanGenetics. de Boer and PanGenetics shall assign to Chiron all
patentable improvements relating to the humanization of Anti-CD40 Mabs and
fragments thereof capable of binding the Human CD40 Molecule for inclusion
within the Chiron Patent. PanGenetics and de Boer agree, represent and warrant
that the CD40 License & Collaboration Agreement between de Boer and Panorama,
dated October 1, 1994, and attached as Exhibit 7, is null, void, and of no
further effect. PanGenetics and de Boer further agree, represent and warrant
that they have undertaken or will undertake all measures necessary to render
such agreement null, void and of no legal effect.

     3.10  PROGRESS MEETINGS  During the term of the Research and Development
License, Chiron and PanGenetics shall meet at least annually to discuss research
and development progress and potential clinical indications and applications for
Licensed Products.

     3.11  Except as set forth herein, PanGenetics shall have the sole
responsibility for, and shall bear the cost of, the research and development of
each Licensed Product. Chiron's sole responsibility shall be the prosecution and
maintenance of Chiron Patents, as provided herein. Prior to PanGenetics exercise
of its option rights as set forth in Article 4. Chiron shall pay for the
prosecution and maintenance of Chiron Patents in the United States all countries
listed in the PCT Patent Applications Schedule attached as Exhibit 1, to this
Agreement. After PanGenetics' exercise of its option rights as set forth in
Article 4, Chiron will pay for the prosecution and maintenance of Chiron Patents
in the Chiron Territories, and PanGenetics will reimburse Chiron for the cost of
filing, prosecution and maintenance of Chiron patents in the PanGenetics
Territories.

4.  OPTION TO OBTAIN COMMERCIAL LICENSE

     4.1  OPTION TO COMMERCIAL LICENSE.  Subject to completion of the
obligations of Chiron, PanGenetics and deBoer set forth in Article 3 of this
Agreement, Chiron hereby grants PanGenetics, and Pangenetics hereby grants
Chiron, an option to obtain a commercial

                                       7
<PAGE>
license (the "Commercial License"), subject to the provisions of Article 6. The
Commercial License shall grant Chiron and Pan Genetics all rights and licenses
necessary to make, use, have made and sell, market and otherwise commercialize
Licensed Product as provided in Article 6, including, without limitation,
licenses under the Chiron Technology, Chiron Patents, PanGenetics Technology,
PanGenetics Patents, any regulatory submissions and licenses. The Commercial
License shall be upon terms and conditions substantially similar to those set
forth below in Article 5 of this Agreement, and any additional terms of
conditions mutually acceptable to both parties and negotiated in good faith by
the parties. Such option shall be exercisable within six (6) months after the
injection of at least three patients with Licensed Product in a Phase I/II
clinical trial as referenced in the PanGenetics' Research and Development Plan
set forth in Exhibit 6.

5.  TERM AND TERMINATION OF RESEARCH AND DEVELOPMENT LICENSE AND OPTION RIGHTS

     5.1  TERM.  This Research and Development License and Option Agreement
shall survive until:

          5.1.1  the expiration of the options granted in Article 4 of this
     Agreement;

          5.1.2  the parties conclude the terms of the Commercial License in
     accordance with Article 6 of this Agreement;

          5.1.3  termination as provided below in Section 5.2.

     5.2  TERMINATION.  All licenses granted hereunder from one party to the
other may be terminated by written notice to the licensee party in the event
that the licensee breaches a provision of this Agreement and has failed to cure
or demonstrate the nonexistence of the breach within ninety (90) days of receipt
of a written notice and demand to cure such breach. Without limiting the
foregoing, if PanGenetics fails to perform its due diligence obligations
pursuant to Section 3.6, Chiron shall have the right, but not the obligation, to
terminate the Research and Development License or Option Right granted to
PanGenetics pursuant to this Agreement. In the event of such termination, the
following shall occur:

          5.2.1  Chiron shall retain all rights under the Chiron Patents;

          5.2.2  PanGenetics shall grant Chiron all licenses necessary to permit
     Chiron to commercialize Licensed product, including, without limitation,
     licenses to Pan Genetics Patents, PanGenetics Technology, regulatory
     submissions and regulatory submissions and regulatory licenses. Such
     licenses shall be worldwide and royalty free. Without limiting the
     foregoing, in the event that PanGenetics obtains third party patents,
     including, without limitation, any third party patents relating to
     humanized Mabs and/or human Mabs and processes for making humanized Mabs
     and/or human Mabs, PanGenetics shall (i) undertake commercially reasonable
     efforts to secure the right to sublicense such patents, and (ii) shall
     sublicense to Chiron Pangenetics' rights in such third party patents. With
     respect to such licenses to third party patents, in the event that Chiron
     wishes to exercise its right to obtain such sublicense, Chiron shall assume
     PanGenetics' obligations with respect to earned royalties, but shall not
     pay any milestone or other upfront fees.

                                       8
<PAGE>
6.  COMMERCIAL LICENSE AGREEMENT

     6.1  TERMS.  Upon the exercise of the option provided in Article 4 of this
Agreement, the Parties hereto shall enter into a commercial license agreement
(the "Commercial License") upon the terms and conditions set forth in this
Article 6.

     6.2  CHIRON LICENSE GRANTS TO PANGENETICS.  Chiron shall grant to
PanGenetics an exclusive Commercial License, with the right to sublicense
marketing rights only, to all rights and licenses necessary to make, have made,
use, sell market and otherwise commercialized Licensed Product(s) in the
PanGenetics' Territories, including, without limitation, licenses under the
Chiron Patents, Chiron Technology, and any regulatory submissions and approvals.

     6.3  PANGENETICS LICENSE GRANTS TO CHIRON/EXCLUSIVITY AND
TERRITORIES.  PanGenetics shall grant to Chiron an exclusive Commercial License,
to all rights and licenses necessary to make, have made, use, sell market and
otherwise commercialize Licensed Product(s) in the Chiron Territories, including
with the right to sublicense marketing rights, including, without limitation,
licenses under PanGenetics' Technology, PanGenetics Patents, and all regulatory
submissions and approvals.

     6.4  MANUFACTURING RIGHTS.  Chiron will have the right of negotiation to
manufacture the product for commercial sale world-wide. If the parties cannot
agree upon mutually acceptable terms for such manufacturing rights, each party
shall have the right to manufacture licensing products for commercial sale
within their respective territories.

     6.5  MARKETING ARRANGEMENTS.  Prior to the marketing of Licensed Product,
the parties shall agree on terms for the promotion and sale of Licensed Product.
The marketing provisions shall include appropriate termination and diligence
terms. In territories where the parties agree to co-promote or co-market
Licensed Product, the parties shall negotiate in good faith appropriate
compensation provisions that reflect the parties' relative contributions with
regard to the commercial sale of the Licensed Product. These negotiations shall
be subject to a time limit and the objective of the arrangements shall be to
maximize the economic return to both parties.

     6.6 REGISTRATION PAYMENT. Within ninety (90) days after successful
registration of a Licensed Product by PanGenetics in either Japan, the United
Kingdom, France, or Germany, PanGenetics shall pay to Chiron One Million Dollars
($1,000,000) (the "Registration Payment").

     6.7 ROYALTIES. Following the first Commercial Sale of a Licensed Product by
PanGenetics or Chiron pursuant to the Commercialization Agreement and licenses
granted therein, the party making such sale (the "Paying Party") shall submit to
the other party (the "Payee") within sixty (60) days of the end of every
calendar quarter a quarterly report setting out Net Sales of each Licensed
Product by country, royalty credits accumulated or taken, and sublicense
receipts, if any. The Paying Party shall, at the same time such report is
submitted, pay the Payee an earned royalty (the "Earned Royalty") in the amount
of * of Net Sales by the Paying Party or its affiliates of sublicensees, and *
of any up-front or milestone fees or other similar value received from
sublicensees.

                                       9
<PAGE>
     6.8  MANNER OF PAYMENT.  All payments hereunder shall be made by bank
transfer to the bank account designated by the party to receive such payments.
Where required to do so by applicable law or treaty, the Paying Party shall
withhold taxes required to be paid to a taxing authority on account of such
income to the Payee, and the Paying Party shall furnish the Payee with
satisfactory evidence of such withholding and payment in order to permit the
Payee to obtain a tax credit or other relief as may be available under the
applicable law or treaty. If any sum due hereunder is not paid in full on the
due date, interest at the average prime rate for the month preceding payment of
the unpaid balance (as published from time to time by the THE WALL STREET
JOURNAL shall accrue and be payable on any unpaid balance from the date such
payment became due until the date paid.

     6.9  RECORDS OF ROYALTY OBLIGATIONS.  The Paying Party will keep and
maintain proper books and records as are required accurately to determine
royalties payable to the Payee for three (3) years following the date on which
such royalties were paid or reported. The Payee shall have the right, at its own
expense, to have such books and records examined by independent certified public
accountants acceptable to the Paying Party at reasonable times solely for the
purpose of verifying the accuracy of royalties paid or reported by the Paying
Party. The Payee shall bear the cost of any such inspection; provided, that in
the event the inspection discloses that any payments made to the Payee hereunder
for any accounting period were deficient by more than ten percent, the Paying
Party shall promptly reimburse the Payee for the cost of such independent audit
and shall pay to Payee the amount of such deficiency together with interest
thereon at the rate specified in Section 6.8 above.

     6.10  TERM AND TERMINATION OF COMMERCIAL LICENSE AGREEMENT.  Upon the later
of the expiration of the last to expire of the patent rights included in the
Chiron Parents, PanGenetics Patents, or Joint Technology Patents (if any), or
ten (10) years after the first commercial sale of Licensed Product, the
provisions of the Commercial License shall be of no further force and effect,
except for provisions of the Commercial License which impose obligations that
continue beyond the expiration of the agreement, including, without limitation,
provisions relating to confidentiality and indemnity. Prior to the expiration of
the last to expire of the Chiron Patents, PanGenetics Patents, or Joint
Technology Patents, neither party shall have the right to terminate the
Commercial License, except as follows:

          6.10.1  Upon mutual written agreement of the parties; or

          6.10.2  If a party materially breaches a material provision of the
     Commercial License and has failed to cure or demonstrate the nonexistence
     of the breach within ninety (90) days of receipt of a written notice and
     demand to cure such breach; or

          6.10.3  In the event that one of the parties becomes insolvent or
     files for bankruptcy protection or fails generally to pay its debts as they
     become due, makes an assignment of substantially all of its assets for the
     benefit of creditors or applies for or consents to the appointment of a
     custodian, trustee or receiver for such party or the majority of its
     property, or if any other proceeding for relief under any bankruptcy law or
     similar law for the relief of debtors is instituted by or against such
     party and, if instituted against such party, is consented to or not
     dismissed within ninety (90) days after such institution.

     6.11  LIMITATION OF LICENSE.  This license does not extend to any rights or
products other than those referred to herein.

                                       10
<PAGE>
     6.12  CHIRON'S FIRST REFUSAL RIGHTS.

          6.12.1  GRANT OF RIGHT OF FIRST REFUSAL.  PanGenetics grants Chiron a
     right-of-first-refusal to obtain rights related to PanGenetics inventions;
     provide funding for research or development activities; provide research or
     development services; manufacture licensed product for commercial sale; and
     market licensed product, within the Field of this Agreement in any country
     (the "First Refusal Rights.")

          6.12.2  NOTIFICATION TO CHIRON.  PanGenetics shall promptly send to
     Chiron, at the address specified herein, a reasonably detailed written
     notification of any event which would give rise to the Chiron First Refusal
     Rights referenced above. Chiron shall respond to PanGenetics within sixty
     (60) days of its receipt of such notification of its interest in exercising
     its First Refusal Rights.

          6.12.3  NEGOTIATION OF TERMS.  For a period of up to ninety (90) days
     after PanGenetics receives notice of Chiron's intention to exercise its
     First Refusal Rights, the parties shall negotiate in good faith a
     reasonable agreement mutually acceptable to both parties.

          6.12.4  COMMERCIALIZATION BY PANGENETICS.  In the event that Chiron
     fails to respond within sixty (60) days, or affirmatively indicates that it
     is not interested in exercising its First Refusal Rights with respect to
     the opportunity presented by PanGenetics, or the parties fail to reach a
     definitive terms of agreement pursuant to Section 6.12.3, PanGenetics shall
     be free to pursue other arrangements regarding the opportunity, either
     independently or with one or more third parties, provided that PanGenetics
     shall not offer to extend rights related to the opportunity to a third
     party on terms more favorable than those previously offered to Chiron with
     respect to such opportunity without first offering such more favorable
     terms to Chiron.

7.  SECOND GENERATION PRODUCTS

     With respect to the development of any Second Generation Product, Chiron
and PanGenetics agree as follows:

     7.1  NO LICENSE GRANTED FOR SECOND GENERATION PRODUCT.  Nothing in this
Agreement shall be construed to grant to PanGenetics an express or implied
license under the Chiron Patents or Chiron Technology to undertake activities
related to the research, development, or marketing of a Second Generation
Product.

     7.2  NOTICE.  Each party agrees to keep the other party reasonably informed
of its activities which relate to the development of a Second Generation
Product. In the event that either party undertakes activities relating to the
research or development a Second Generation Product, each party shall notify the
other of such activities. Such notification and disclosure shall be subject to
the confidentiality obligations set forth in Article 9.

     7.3  PANGENETICS' DEVELOPMENT OF SECOND GENERATION PRODUCT.  With respect
to activities related to the development of a Second Generation Product that may
be undertaken by PanGenetics, the following shall apply:

                                       11
<PAGE>
          7.3.1  PanGenetics shall not undertake the internal commercial
     development of any Second Generation Product without first obtained
     Chiron's prior written approval;

          7.3.2  PanGenetics shall not undertake any activities related to the
     research or development of a Second Generation Product with any third party
     without having obtained Chiron's prior written consent.

     7.4  CHIRON'S DEVELOPMENT OF SECOND GENERATION PRODUCT.  In the event that
Chiron undertakes activities related to the development of a Second Generation
Product, the following shall apply:

          7.4.1  Chiron shall notify PanGenetics of its activities which relate
     to Second Generation Product, as provided in Section 7.2.

          7.4.2  PanGenetics may, at its discretion, present Chiron with
     proposals regarding PanGenetics' participation in the Second Generation
     Product research and development being undertaken by Chiron.

          7.4.3  Chiron may, at its discretion, evaluate the PanGenetics
     proposals referenced in Section 7.4.2, and may, at its discretion, invite
     PanGenetics to enter into negotiations regarding the collaboration of
     Chiron and PanGenetics in Second Generation Product related activities.
     Neither party shall be obligated to collaborate with the other with respect
     to such activities except upon terms and conditions mutually acceptable to
     both parties.

          7.4.4 In the event that (i) Chiron brings a Second Generation Product
     to market in Europe or Japan, and (ii) Chiron and PanGenetics have not
     entered into a definitive collaboration arrangement pursuant to Section
     7.4.3 which provides additional compensation to PanGenetics in exchange for
     value contributed by PanGenetics to the development of said Second
     Generation Product, Chiron shall pay PanGenetics an earned royalty of * of
     net sales of such Chiron Second Generation Product.

8.  PATENT PROSECUTION, MAINTENANCE AND ENFORCEMENT

     8.1  Chiron shall have the right and obligation to prepare, file and
maintain the Chiron Patents in the United States and the countries listed in the
PCT Patent Applications Schedule, and, if applicable, in such other countries as
Chiron may elect. Chiron shall use reasonable efforts to prosecute and maintain
the Chiron Patents. PanGenetics shall, at its cost and expense, cooperate fully
in such effort, including providing documentary support from de Boer if
necessary. Chiron shall keep PanGenetics informed as to the status of such
patent applications and provide to PanGenetics, upon PanGenetics' written
request, all relevant information relating to such applications.

     8.2  PanGenetics shall, at its cost and expense, prepare, file and maintain
patent application(s) claiming the PanGenetics Technology in the United States
and all of the countries listed in the PCT Patent Application Schedule attached
as Exhibit 2, and such other countries as the parties mutually agree.
PanGenetics shall use diligent efforts toward the prosecution and maintenance of
the PanGenetics Patents. Chiron shall undertake reasonable cooperation in such
effort. In the event that PanGenetics files, prepares or otherwise

                                       12
<PAGE>
prosecute patents relating to any patentable improvements relating to the
humanization of Anti-CD40 Mabs and fragments thereof capable of binding the
Human CD40 Molecule, or files, prepares or otherwise prosecutes any other
improvements related to subject matter claimed by the Chiron Patents,
PanGenetics shall grant to Chiron an option to obtain a license to the de Boer
Rights, which license shall be of such scope and upon such terms and conditions
as the parties may mutually agree.

     8.3  Each party shall promptly notify the other if any legal proceedings
are commenced or threatened against either party or any purchaser of the
Licensed Products sold by either party on the ground that the manufacture,
possession, use, or sale of the Licensed Products is an infringement of a third
party's patent or other intellectual property rights. Each party shall, at its
own expense, conduct all suits brought against it as a result of the exercise of
the rights granted hereunder, and the other party shall, at the request and
expense of the party conducting such suit, give all reasonable assistance in any
such proceedings.

     8.4  The preparation, filing and prosecution of patent application(s)
relating to any Joint Technology, if any, and the maintenance and prosecution of
any patent(s) resulting therefrom, shall be performed by counsel mutually
acceptable to the parties (which may be inside counsel for either party) and
costs for such preparation, filing, prosecution and maintenance shall be borne
equally by the parties. Decisions to abandon patents or patent applications
shall be taken jointly. The party conducting such activities shall keep the
other party reasonably informed and provide the other party with copies of
substantive actions from the US, European and Japanese Patent Offices, and (to
the extent feasible) provide the other party with copies of draft responses
thereto sufficiently in advance of filing to allow reasonable period for review
and comment. Filing of priority patent applications is to be undertaken without
delay introduced through consultation with the other party; nonetheless the
other party should be informed thereof as quickly as possible so that comments
from the other party can be considered in time for subsequent updated priority
applications. Each party agrees that it will not bring a claim for any act,
omission, fault or neglect against either the other party or its inside patent
attorney relating to that party's handling of the preparation, filing and
prosecution of any Joint Technology patent application or the maintenance and
prosecution of any patent(s) resulting therefrom.

9.  CONFIDENTIALITY

     9.1  CONFIDENTIALITY.  Chiron and PanGenetics agree that, during the term
of this Agreement and for a period of five (5) years following the expiration or
termination of this Agreement, each of them shall maintain in confidence and not
disclose by any means any Confidential Information (as hereinafter defined)
received from the other party and to use such Confidential Information only in
furtherance of this Agreement. "Confidential Information" means any
confidential and proprietary information which is provided by one party to the
other party in writing or, if initially disclosed in non-tangible form,
summarized in writing within thirty (30) days after disclosure in non-tangible
form. The confidentiality and nondisclosure obligations shall not apply to the
extent that such disclosure is necessary for the prosecution and enforcement of
patents pursuant to this Agreement, or to comply with judicial decrees or
government actions or regulations; provided that the disclosing party shall use
all reasonable efforts to obtain confidential treatment of such disclosure to
the maximum extent permitted by law. In addition, such obligation of
confidentiality and limitation of use shall not apply to Confidential
Information that the receiving party can demonstrate:

                                       13
<PAGE>
          9.1.1     is known to the receiving party or is independently
                    developed, discovered or arrived at by the receiving party,
                    in each case to the extent evidenced by written records; or

          9.1.2     was disclosed not subject to a confidentiality or similar
                    agreement to the receiving party by a third party that has
                    the right to make such disclosure; or

          9.1.3     becomes patented, published or otherwise part of the public
                    domain through no fault of the receiving party; or

          9.1.4     is required to be disclosed subject to a confidentiality
                    agreement or similar arrangement by order or regulation of
                    the FDA or similar authority in other countries of other
                    governmental or non-governmental authorities to facilitate
                    the issuance of marketing or safety approvals for products
                    licensed to either party or by order of a court of competent
                    jurisdiction; or

          9.1.5     to the extent that it is provided to third parties under
                    appropriate terms and conditions, including confidentiality
                    and use provisions equivalent to those in this Agreement,
                    for subcontracting or consulting activities necessary for
                    conducting research and development.

Each party agrees to take all reasonable steps to protect the Confidential
Information of the other party in the same manner it ensures protection of its
own confidential or proprietary information.

10.  MISCELLANEOUS

     10.1  PROVISIONS CONTRARY TO LAW.  In performing this Agreement, the
parties shall comply with all applicable laws. Nothing in this Agreement shall
be construed so as to require the violation of any applicable law, and wherever
there is any conflict between any provision of this Agreement and any applicable
law the law shall prevail, but in such event the affected provision of this
Agreement shall be affected only to the extent necessary to bring it within the
applicable law, provided that the resulting provisions are consistent with the
spirit and intent of the Agreement as originally entered into.

                                       14
<PAGE>
     10.2  NOTICES.  Any notices required or permitted to be given by this
Agreement shall be given by postpaid, first class, registered or certified mail
addressed as set forth below unless changed by notice so given:

For Chiron:                      For PanGenetics:         For Panorama:
Rajen Dalal                      James W. Larrick         James W. Larrick
Vice President                   President                President
Business Development             PanGenetics B.V.         Panorama Research Inc.
and Corporate Planning           E. van Calcarstraat 30   2462 Wyandotte Street
Chiron Corporation               1963 DG Heeniskerk       Mountain View,
4560 Horton Street               The Netherlands          California 94043
Emeryville, California 94608
U.S.A.

With a copy to:

General Counsel
Chiron Corporation
4560 Horton Street
Emeryville, California 94608
U.S.A.

     10.3  USE OF NAMES.  Neither party shall use the name of the other in any
promotional materials or advertising without the prior written consent of the
other.

     10.4  ASSIGNMENTS.  No license granted under this Agreement may be assigned
by the licensee except with the prior written consent of the licensor. The
licensor may assign its rights and obligations under such license upon
reasonable notice to the licensee.

     10.5  WAIVERS AND MODIFICATIONS.  The failure of any party to insist on the
performance of any obligation hereunder shall not act as a waiver of such
obligation. No waiver, modification, release or amendment of any obligation
under this Agreement shall be valid or effective unless in writing and signed by
both parties hereto.

     10.6  SUCCESSORS IN INTEREST.  This Agreement shall inure to the benefit of
and be binding on the parties' permitted assigns, successors in interest, and
subsidiaries.

     10.7  NO WARRANTY.  The licenses granted hereunder are provided WITHOUT
WARRANTY OF MERCHANTABILITY OF FITNESS FOR A PARTICULAR PURPOSE OF ANY OTHER
WARRANTY, EXPRESS OR IMPLIED. THE LICENSOR AS TO EACH LICENSE MAKES NO WARRANTY
THAT THE LICENSEE'S ACTIVITIES UNDER SAID LICENSES NOT NOT INFRINGE ANY PATENT
OR OTHER PROPRIETARY RIGHT OF A THIRD PARTY. The licensor will not be liable for
such infringement, or an allegation thereof, nor shall same be an excuse for
nonperformance of the licensee's obligations hereunder.

                                       15
<PAGE>
     10.8  MUTUAL INDEMNITIES.  PanGenetics (and its Affiliates) shall
indemnify, defend, and hold harmless Chiron and its affiliates and their
officers and directors for any claim, demand, or injury arising out of the
actions of PanGenetics or its affiliates or sublicensees arising from or
relating to this Agreement; provided however that such indemnity shall not
extend to damages arising directly from any breach or willful or negligent act
of Chiron. Chiron shall indemnify, defend, and hold harmless PanGenetics and its
affiliates and their officers and directors for any claim, demand, or injury
arising out of the actions of Chiron or its affiliates or sublicensees arising
from or related to this Agreement; provided however that such indemnity shall
not extend to damages arising directly from any breach or willful or negligent
act of PanGenetics. The provisions of this Section shall survive expiration or
termination of this Agreement.

     10.9 INSURANCE. PanGenetics shall at all times comply, through insurance or
self-insurance, with all statutory workers' compensation and employers'
liability requirements covering any and all employees with respect to activities
performed under this Agreement. In addition to the foregoing, PanGenetics shall
obtain and maintain, immediately prior to the first human clinical trial of a
Licensed Product, Comprehensive General Liability Insurance, including Products
Liability Insurance, with reputable and financially secure insurance carrier(s)
to cover the activities of PanGenetics and its sublicensee(s). Such insurance
shall provide minimum limits of liability of $2,000,000 per incident and shall
name Chiron as an additional insured party. Such insurance shall be written to
cover claims incurred, discovered, manifested, or made during or within five (5)
years after (a) the expiration of this Agreement, or (b) complete cessation of
sales of all Licensed Products, whichever is longer.

     10.10  CHOICE OF LAW AND JURISDICTION.  This Agreement is subject to and
shall be construed and enforced in accordance with the laws of the U.S.A. and
California. Chiron and PanGenetics shall attempt to settle any dispute or
controversy arising out of, or in connection with this Agreement without
resorting to litigation. If such attempts should fail, then the parties hereby
submit to arbitration in accordance with the rules then prevailing of the
American Arbitration Association ("AAA"), by one more arbitrator(s) appointed
in accordance with said rules as applicable at such time. The arbitration shall
be conducted in English and so shall be final, binding and enforceable.

     10.11  ENTIRE AGREEMENT.  Except as otherwise provided herein, this
Agreement constitutes the entire agreement between the parties hereto with
respect to the subject matter hereof, and all prior or contemporaneous
agreements, whether written or oral, or proposals or understandings concerning
the subject matter hereof are superseded hereby. This Agreement may be amended
only in a writing executed by both parties.

                                       16
<PAGE>
     IN WITNESS WHEREOF, the parties have caused this agreement to be executed
as of the date first-above written.

CHIRON CORPORATION                               PAGENETICS, B.V.

By:   /s/ LEWIS T. WILLIAMS                      By: /s/ JAMES W. LARRICK
Name:  Lewis T. Williams                         Name:  James W. Larrick
Title:   Senior Vice President                   Title:   Director
Date:   September 25, 1995                       Date:   September 12, 1995

PANGENETICS B.V.                                 PANORAMA RESEARCH INC.

By: /s/ MARK DE BOER                             By: /s/ JAMES W. LARRICK
Name:  Mark de Boer                              Name:  James W. Larrick
Title:   Managing Director                       Title   President
Date:   September 17, 1995                       Date:   September 12, 1995

MARK DE BOER

By: /s/ MARK DE BOER
Name:  Mark de Boer
Date:   September 7, 1995

                                       17
<PAGE>
                                   EXHIBIT 1
                    WORLD INTELLECTUAL PROPERTY ORGANIZATION
         PCT                  INTERNATIONAL BUREAU

                   INTERNATIONAL APPLICATION PUBLISHED UNDER
                      THE PATENT COOPERATION TREATY (PCT)


(51)INTERNATIONAL PATENT                 (11) INTERNATIONAL PUBLICATION NUMBER:
    CLASSIFICATION(5):                        WO 94/01547
    C12N 15/06, C12P 21/08       A2
    C07K 15/00, C12N 15/86               (43) INTERNATIONAL PUBLICATION DATE:
    A61K 39/395                               20 JANUARY 1994 (20.01.94)

<TABLE>
<S>                                    <C>
(21) INTERNATIONAL APPLICATION         (81) DESIGNATED STATES: CA, JP, European patent (AT,
NUMBER:     PCT/US93/06432                   BE, CH, DE, DK, ES, FR, GB, GR, IE, IT, LU, MC,
                                             NL, PT, SE).
(22) INTERNATIONAL FILING DATE:
     8 July 1993 908.07.93)
(30) PRIORITY DATA:                    PUBLISHED
        07/910,222        9 July 1992        WITHOUT INTERNATIONAL SEARCH REPORT AND TO BE
      (09.07.92)        US                   REPUBLISHED UPON RECEIPT OF THAT REPORT.
(71) APPLICANT: CETUS ONCOLOGY
      CORPORATION [US / US]; 4560
      Horton Street, Emeryville, CA
      94608-2916 (US).
(72) INVENTORS: DE BOER, Mark; James
      Stewartstraat 50, NL-132 JG
      Almere (NL). CONROY, Leah, B.;
      515 Beaumont Boulevard,
      Pacifica, CA 94044 (US).
(74) AGENTS: McGARRIGLE, Philip, L.,
      Jr. et al.; Chiron Corpora-
      tion, 4560 Horton Street -
      R440, Emeryville, CA 94608-2916
      (US)
</TABLE>

(54) TITLE: A METHOD FOR GENERATION OF ANTIBODIES TO CELL SURFACE MOLECULES

(57) ABSTRACT

     The present invention relates to a method of generating antibodies directed
against cell surface antigens and its uses recombinant insect cells as
immunogens. The insect cells have been transfected with coding regions for a
molecule containing a cell surface antigen and these antigens are expressed on
the surface of the insect cells. Host animals are immunized with these
transfected insect cells to generate antibodies directed against the cell
surface antigen. Antibody-producing cells from the host animal are used to
generate monoclonal antibody-producing hybridoma cells. Sera and hybridoma
supernatants can be tested for the presence of antibodies against the surface
antigen, using the transfected cells in a screening assay. Specific antibodies
that have been generated by the present method are anti-B7 and anti-CD40
antibodies and they can be used to prevent or treat an antibody-mediated or
immune system disease in a patient. The anti-B7 antibodies can be used to cause
T cell anerty, treat allograft transplant rejection, treat graft versus host
disease, and prevent or treat rheumatoid arthritis. An immunosuppressive agent
may be co-administered with the antibody. The anti-CD40 antibodies which bind to
the CD40 antigen can be used to prevent the growth or differentiation of the B
cell. Monoclonal antibodies useful in these methods, and epitopes immunoreactive
with such monoclonal antibodies are also presented.
<PAGE>
                      FOR THE PURPOSES OF INFORMATION ONLY

     Codes used to identify States party to the PCT on the front pages of
pamphlets publishing international applications under the PCT.

<TABLE>
<S> <C>                                     <C>   <C>                          <C>   <C>
AT  Austria                                 FR    France                       MR    Mauritania
AU  Australia                               GA    Gabon                        MW    Malawi
BB  Barbados                                GB    United Kingdom               NE    Niger
BE  Belgium                                 GN    Guinea                       NL    Netherlands
BF  Burkina Faso                            GR    Greece                       NO    Norway
BG  Bulgaria                                HU    Hungary                      NZ    New Zealand
BJ  Benin                                   IE    Ireland                      PL    Poland
BR  Brazil                                  IT    Italy                        PT    Portugal
BY  Belarus                                 JP    Japan                        RO    Romania
CA  Canada                                  KP    Democratic People's          RU    Russian Federation
CF  Central African Republic                      Republic                     SD    Sudan
CG  Congo                                         of Korea                     SE    Sweden
CH  Switzerland                             KR    Republic of Korea            SI    Slovenia
CI  Cote d'Ivoire                           KZ    Kazakhstan                   SK    Slovak Republic
CM  Cameroon                                LI    Liechtenstein                SN    Senegal
CN  China                                   LK    Sri Lanka                    TD    Chad
CS  Czechoslovakia                          LU    Luxembourg                   TG    Togo
CZ  Czech Republic                          LV    Latvia                       UA    Ukraine
DE  Germany                                 MC    Monaco                       US    United States of America
DK  Denmark                                 MG    Madagascar                   UZ    Uzbekistan
ES  Spain                                   ML    Mali                         VN    Viet Nam
FI  Finland                                 MN    Mongolia

</TABLE>
<PAGE>
                                   EXHIBIT 2
                          PanGenetics' Patent Schedule
<PAGE>
                                   EXHIBIT 3

                          MATERIALS TRANSFER AGREEMENT

THIS AGREEMENT is made as of December 16, 1991, by and among Mark de Boer, Ph.D.
("Dr. de Boer") and Cetus Corporation ("Cetus").

     A.  During the course of his relationship with Cetus, Dr. de Boer has been
engaged in research in the area of T cell activation (the "Research").

     B.  Dr. de Boer wishes to continue certain aspects of the Research, and
Cetus desires to receive the benefits of the Research as set forth herein.

     C.  Therefore, Cetus is willing to provide Dr. de Boer with mouse
monoclonal antibody B7-24H4G12 and the related reagents/derivatives listed on
Attachment 1 hereto (which, together with any cell line, genetic material,
chemical or other substance derived by Dr. de Boer therefrom, constitute the
"Cetus Substances"); and confidential information, know-how, and data related
to the Cetus Substances (the "Cetus Confidential Information" which, together
with the Cetus Substances constitute the "Cetus Properties"). Cetus is willing
to allow Dr. de Boer to take the Cetus Properties with him under the terms of
this Agreement.

NOW, THEREFORE, the parties agree as follows:

1.  SCOPE OF USE The Cetus Properties are provided to Dr. Boer only for his use
in the Research. Dr. de Boer agrees to maintain in confidence and not to
distribute, disclose, or release the Cetus Properties to any person other than
laboratory personnel directly under Dr. de Boer's supervision and will ensure
that no one may copy, send, or take the Cetus Properties to any other location,
or use the Cetus Properties in research which is subject to a licensing or
consulting obligation to a third party (other than the U.S. Government), unless
written permission is obtained from an authorized representative of Cetus. Dr.
de Boer promises that the Cetus Properties will be used only in laboratory
animals or in IN VITRO experiments and will not be used in human beings.

2.  FREEDOM TO PUBLISH Dr. de Boer is free to present or publish the fundings of
the Research in a scientific publication, or public noncommercial conference, or
similar forum, provided that: (a) no Cetus Confidential Information is revealed
thereby; and (b) at lease 30 days prior to submission thereof to a publisher or
any third party, Dr. de Boer shall have delivered copies of the proposed
presentation or publication to Cetus for review. Cetus may, within 30 days of
such delivery, object to the publication or presentation because there would be
a disclosure of Cetus Confidential Information or because there is patentable
subject matter, in which Cetus has an interest under paragraph 4, which needs
protection. Upon Cetus' request, Dr. de Boer shall, for up to 60 days from
initial delivery to Cetus, delay disclosing such patentable subject matter in
order to permit the filing of patent applications thereon. The parties shall, in
any publication, acknowledge the contributions and publication of the other as
scientifically appropriate.

3.  DISCLOSURES Dr. de Boer will promptly provide a full written "Disclosure"
to Cetus of any invention, improvement, or discovery made in the Research using
the Cetus Properties (an "Invention"). Cetus shall be free to use such
findings for any purpose. Except as expressly set

LMTA (5/91)                           PAGE 1                            AGT 7655
<PAGE>
forth in this Agreement, neither party shall obtain rights in or a license to
any patent, copyright, trademark or other intellectual property right of the
other.

4.  TITLE AND INVENTIONS  All right, title, and interest in the Cetus Properties
shall belong to Cetus. Cetus shall be free, in its sole discretion, to
distribute the Cetus Properties to others and to use them for its own purposes.
In consideration of access to the Cetus Properties, Dr. de Boer hereby grants
Cetus and its affiliates an option to a non-exclusive royalty-free worldwide
license, and grants a further option to an exclusive license bearing a
reasonable royalty for such territories as Cetus may request, in any patent
issuing on an Invention. Cetus may exercise its option within one year of its
receipt of the written Disclosure described herein. A "reasonable royalty"
shall take into account the relative contributions of the parties to the
pertinent product and industry standards and shall be arbitrated by the American
Arbitration Association if the parties cannot in good faith agree on it.

5.  CONTACT WITH COLLABORATORS  Dr. de Boer may communicate and cooperate
regarding the Research with Cetus' collaborators who are rightfully possessing
and using the Cetus Properties, set forth in Attachment 2. To the extent, if
any, that an Invention arises from such collaboration, the rights in it shall be
governed by the respective agreements with Cetus. Dr. de Boer shall not initiate
new collaborations except through Cetus.

6.  NO WARRANTY  The Cetus Properties are investigational and experimental in
nature and are provided WITHOUT WARRANTY OF MERCHANTABILITY OR FITNESS FOR A
PARTICULAR PURPOSE OR ANY OTHER WARRANTY, EXPRESS OR IMPLIED. CETUS MAKES NO
REPRESENTATION OR WARRANTY THAT THE USE OF THE CETUS PROPERTIES WILL NOT
INFRINGE ANY PATENT OR OTHER PROPRIETARY RIGHT. To the extent permitted by law,
Dr. de Boer will hold Cetus harmless from any claims or liability arising from
the use, handling or storage of the Cetus Substances.

7.  COMPLIANCE WITH LAW  Dr. de Boer shall use the Cetus Properties in
compliance with all applicable laws and regulations including, where applicable,
those relating to the treatment of laboratory animals and current NIH
guidelines.

8.  TERMS  This Agreement is the entire agreement between Cetus and Dr. de Boer
relating to the Cetus Properties, and may not be modified, assigned or
transferred without the written consent of an authorized representative of
Cetus. This Agreement shall be governed by the law of California.

     IN WITNESS WHEREOF, the Cetus and Dr. de Boer have executed this Agreement
as of the day and year first above written.

CETUS CORPORATION                             MARK DE BOER, PH.D.
By: /s/ JAMES H. MEADE                    /s/ MARK DE BOER, PH.D.
        James H. Meade, Ph.D.                 Signature
        Senior Director
        Scientific Administration

LMTA (5/91)                           PAGE 2                            AGT 7655
<PAGE>
                                   EXHIBIT 3

                                  ATTACHMENT 1

              cDNA for soluble B
              cDNA for full length B7
              cDNA for ICAM-1
              cDNA for ICAM-2
              cDNA for LFA-3
              cDNA for CD5G
              cDNA for ELAM
              cDNA for VCAM

              recombinant baculovirus for soluble B7
              recombinant baculovirus for full length B7

              hybridoma cell line B7-24

              3T6 cells expressing B7
              3T6 cells expressing ICAM-1

              Four PUC vectors with cloned VH and VL of B7-24

LMTA (5/91)                           PAGE 3                            AGT 7655
<PAGE>
                                   EXHIBIT 3

                                  ATTACHMENT 2

Agt. No.         Collaborator Name    Institution
- ----------       -----------------    ----------------------------------
    *                    *                            *

LMTA (5/91)                           PAGE 4                            AGT 7655
<PAGE>
                                   EXHIBIT 3

     C H I R O N

July 24, 1992

Mark de Boer, Ph.D
Innogenetics
Industriepark 7-box 4
B-9052 Zwijnaarde
BELGIUM

RE:  Letter Amendment #1 to Materials Transfer Agreement #7655

Dear Dr. de Boer:

Incorporating the terms and conditions of the Materials Transfer Agreement dated
December 16, 1991 by and among Cetus Corporation and you, we would like to add
murine B7 PCR primers GM546 through GM549 and murine library ML1019B to the
materials provided to you by Cetus. Accordingly, murine B7 PCR primers GM546
through GM549 and murine library ML1019B have been added to Attachment 1 of the
Agreement. The revised Attachment 1 is attached hereto.

If you agree to this amendment, please sign both originals of this letter and
return one original to Ms. Gaye Engler, Contracts Administrator, Legal
Department. The second original is provided for you records.

This Amendment #1, together with the Materials Transfer Agreement dated December
16, 1991, constitutes the entire agreement between the parties hereto regarding
the subject matter thereof and supersedes any prior or contemporaneous
agreement, understanding or negotiations.

If you have any questions, please feel free to contact Ms. Engler at
(510)601-2916.

Sincerely,                             Agreed to and Accepted by:

CHIRON CORPORATION                     MARK DE BOER, PH.D.

By: /s/ PABLO D. T. VALENZUELA           /s/ MARK DE BOER
        Pablo D. T. Valenzuela, Ph.D.        Signature
        Senior Vice President
        Biological Research &
        Development

La-Amd. (Rev. 9/90)                                            Agt. 7655, Amd. 1
Chriron Corporation o 4560 Horton Street o Emeryville, CA o 94608-2916
 o 510-655-8730
Law Department  o  General Fax: 510-654-5360 o Intellectual Property Fax:
510-655-3542
<PAGE>
                                   EXHIBIT 3

                                  ATTACHMENT 1

              cDNA for soluble B7
              cDNA for full length B7
              cDNA for ICAM-1
              cDNA for ICAM-2
              cDNA for LFA-3
              cDNA for CD5G
              cDNA for ELAM
              cDNA for VCAM

              ML1019B murine library

              Murine B7 PCR primers GM 546 through GM 549

              recombinant baculovirus for soluble B7
              recombinant baculovirus for full length B7

              hybridoma cell line B7-24

              3T6 cells expressing B7
              3T6 cells expressing ICAM-1

              Four PUC vectors with cloned VH and VL of B7-24

LMTA (5/91)                           PAGE 3                            AGT 7655
<PAGE>
                                   EXHIBIT 3

                                AMENDMENT #2 TO
                          MATERIALS TRANSFER AGREEMENT
                                    BETWEEN
                    CHIRON CORPORATION AND DR. MARK DE BOER

Incorporating the terms and conditions of the Materials Transfer Agreement dated
December 16, 1991 and the Letter Amendment #1 dated July 24, 1992 by and between
Chiron Corporation and Dr. Mark de Boer, the Agreement is herein amended,
effective December 17, 1991, by adding anti-CD40 to Attachment 1 of the
Agreement. The revised Attachment 1 is attached hereto.

This Amendment #2, together with the Materials Transfer Agreement dated December
16, 1991 and the Letter Amendment #1 dated July 24, 1992, constitutes the entire
agreement between the parties hereto regarding the subject matter thereof and
supersedes any prior or contemporaneous agreement, understanding or
negotiations.

                                       Agreed to and Accepted by:

CHIRON CORPORATION                     MARK DE BOER, PH.D.

By: /s/  NIEK J. ROOSDORP              /s/  MARK DE BOER
         Niek J. Roosdorp, Ph.D.            Signature
         Vice President
         Business Development

<PAGE>
                                   EXHIBIT 3

                                  ATTACHMENT 1

              cDNA for soluble B7
              cDNA for full length B7
              cDNA for ICAM-1
              cDNA for ICAM-2
              cDNA for LFA-3
              cDNA for CD5G
              cDNA for ELAM
              cDNA for VCAM

              ML1019B murine library

              Murine B7 PCR primers GM546 through GM549

              recombinant baculovirus for soluble B7
              recombinant baculovirus for full length B7

              hybridoma cell line B7-24

              3T6 cells expressing B7
              3T6 cells expressing ICAM-1

              four PUC vectors with cloned VH and VL of B7-24

              anti-CD40
<PAGE>
                                   EXHIBIT 4

                              CONSULTING AGREEMENT

THIS AGREEMENT is effective as of January 1, 1993 by and between Chiron
Corporation ("Chiron"), and Dr. Mark de Boer ("Consultant").

     1.  CONSULTANCY.  Chiron hereby retains Consultant, and Consultant hereby
accepts such retention, commencing as of the date of this Agreement and
continuing for one (1) year thereafter.

     2.  SERVICES.  Consultant shall serve as a consultant to Chiron and its
subsidiaries and affiliates in the area to anti-CD40 (the "Field").

     3.  COMPENSATION.  In consideration of Consultant's provision of consulting
services to Chiron, Chiron will pay Consultant a quarterly fee of *. In
addition, Chiron will reimburse Consultant for reasonable expenses approved in
advance by Chiron.

     4.  OUTSIDE EMPLOYMENT.  (a) During the term of this Agreement Consultant
may be engaged by one or more other "Institutions(s)." Consultant represents
that he is not and shall not become a party to any agreement which conflicts
with the duties hereunder. Consultant shall use best effects to segregate work
done under this Agreement from work at an Institution, or done with Government
funding, so as to minimize any questions of disclosure or ownership of rights
under any Inventions or Confidential Information. Chiron may terminate this
Agreement if in its sole opinion the performance of such work will conflict with
its interests.

     (b) Consultant shall not disclose to Chiron any inventions, trade secrets,
or other information of third parties that Consultant does not have the right to
disclose and that Chiron is not free to use without liability.

     5.  INVENTIONS.  (a) "Invention" shall mean and refer to any composition
of matter, device, process, treatment, or improvement thereof discovered,
created, made, conceived, or reduced to practice ("Invented") by Consultant,
whether patentable or not, during the term of this Agreement and which: (i) was
Invented with the equipment, supplies, facilities, or Confidential Information
of Chiron or those acting on its behalf, or (ii) was Invented by Consultant
while performing services for Chiron, or (iii) resulted from any work performed
by Consultant for Chiron under this Agreement.

     (b) Chiron shall own all right, title and interest in any Invention.
Consultant shall promptly, and without royalty but at Chiron's expense: (i)
disclose to Chiron all information with respect to any Inventions, (ii) execute
all applications, assignments, and other instruments and do such other acts that
Chiron may deem necessary to obtain and maintain patents, copyrights, and
similar rights anywhere in the world, and (iii) provide Chiron evidence needed
in any legal proceedings regarding the Invention.

     6.  CONFIDENTIALITY.  (a) During the term of this Agreement and any
subsequent extensions, and for a period of one (1) year thereafter, Consultant
will not disclose without prior written consent of Chiron, any Chiron
Confidential Information. As used in this Agreement, "Confidential
Information" shall mean all data, technical information, commercial and
research strategies, trade secrets, and know-how disclosed by Chiron to
Consultant, directly or indirectly, whether in writing or orally except for such
information and know-how that (i) can be shown by contemporaneous documentation
to have been in Consultant's possession prior to disclosure by Chiron; (ii) at
the time of disclosure hereunder is, or thereafter becomes, through no fault of
Consultant, part of the public domain; or (iii) is furnished to Consultant by a
third party after the time of disclosure hereunder without the breach of any
duty to Chiron.

     (b) Consultant shall not use any Confidential Information except for the
purposes of this Agreement unless Chiron shall otherwise agree in writing.
Consultant may disclose Confidential Information only to employees or agents who
have a need to know the Confidential Information for the purposes of this
Agreement and who are bound in writing to maintain the secrecy of the
Confidential Information and assign to Chiron any Inventions which they may
make.

     (c) Consultant shall keep separate and segregated from other work all
documents, records, notebooks, correspondence, deposits of microorganisms, cells
or parts thereof, cell lines, part and progeny thereof, and

                                     Page 1              f:\wpgen\done\agt 11092
<PAGE>
all products made thereby, arising from the work under this Agreement. All
right, title, and interest therein shall belong to Chiron, and upon expiration
or termination of this Agreement, all such documents and material, including
copies thereof, whether prepared by Consultant or others, will be delivered to
Chiron.

     (d)  Consultant may lecture upon, disseminate, and publish under
Consultant's own name scientific papers arising from the work done in the course
of performance of services for Chiron hereunder, but only upon the prior written
approval of Chiron. Chiron will not unreasonably withhold its approval provided
Confidential Information will not be disclosed thereby. Appropriate credit will
be given to Chiron in any publication.

     7.  NOTICE.  ANY NOTICE TO CHIRON SHALL BE ADDRESSED AS FOLLOWS OR AS SHALL
BE SPECIFIED BY A PARTY IN WRITING:

If to Chiron:                          If Consultant:
  Chiron Corporation                     Mark de Boer, Ph.D.
  4560 Horton Street                     Meersenier Straat 13B
  Emeryville, California 94608           Ghent B9000
  Attention: Contracts Administrator     BELGIUM
              Legal Department

     8.  SURVIVAL AND TERMINATION.  The terms and obligations of paragraph 5 and
6 shall survive termination of this Agreement for any reason whatsoever. If
Consultant breaches any of term of this Agreement Chiron may, in addition to any
other remedy, terminate Consultant's services by notice to Consultant by letter,
facsimile, telephone call, in person, or other reasonable means by any officer
or agent of Chiron.

     9.  ENTIRE AGREEMENT.  This Agreement is the entire agreement of the
parties relating to the subject matter hereof, and supersedes all prior and
contemporaneous negotiations, correspondence, understandings, and agreements of
the parties relating to the subject matter hereof. It may be amended only by an
agreement in writing, signed by both parties.

     10.  NOT AN EMPLOYEE.  Consultant is an independent contractor and is not
an employee or agent of Chiron. Consultant shall be entitled to no benefits or
compensation from Chiron except as set forth in this Agreement and shall in no
event be entitled to any fringe benefits payable to employees of Chiron.

IN WITNESS WHEREOF, the parties have executed this Agreement as of the date
first written above.

                                       Agreed to and Accepted by:

CHIRON CORPORATION                     MARK DE BOER, PH.D.

By: /s/  NIEK J. ROOSDORP              /s/  MARK DE BOER
         Niek J. Roosdorp                   Signature
         Vice President
         Business Development

                                     Page 2              f:\wpgen\done\agt 11092
<PAGE>
                                   EXHIBIT 4

                    AMENDMENT #1 TO THE CONSULTING AGREEMENT
                                  MADE BETWEEN
                               CHIRON CORPORATION
                                      AND
                                DR. MARK DE BOER

Incorporating the terms and conditions of the Consulting Agreement dated January
1, 1993 made by and between Chiron Corporation and Dr. Mark de Boer, Section 1
and 2 of the Agreement is herein amended, effective January 1, 1994, to read as
follows:

     "1. CONSULTANCY. Chiron hereby retains Consultant, and Consultant hereby
     accepts such retention, commencing as of the date of this Agreement and
     continuing for two (2) years thereafter."

     "2. SERVICES. Consultant shall serve as a consultant to Chiron and its
     subsidiaries and affiliates in the area of anti-CD40 and *.

This Amendment #1, together with the Consulting Agreement dated January 1, 1993,
constitutes the entire agreement between the parties hereto regarding the
subject matter thereof and supersedes any prior or contemporaneous agreement,
understanding or negotiations.

CHIRON CORPORATION                     MARK DE BOER, PH.D.

By: /s/ PATRICIA A. OLSON, PH.D.       /s/ MARK DE BOER
        Patricia A. Olson, Ph.D.           Signature
        Director, Research Operations

                                            f:\wpgen\done\footer.amd\agt 11092.1
<PAGE>
                                   EXHIBIT 5

                          MATERIALS TRANSFER AGREEMENT

Chiron Corporation ("Chiron") and Panorama Research, Inc. ("Institution"),
agree effective as of November 9, 1994 as follows:

1.  RESEARCH.

a.  Chiron is furnishing the following Chiron properties (the "Chiron
Properties"): (i) baculovirus strains AcCD40B and AcCD40C, containing gene
sequences for the extracellular domain (ECD) of human CD40 with, respectively,
the "KT3" or "gluglu" peptide tag expressed at the C terminus of the ECD;
(ii) SF9 insect cells; and (iii) KT3 and E5 monoclonal antibodies, which
respectively bind the KT3 or gluglu peptides tags.

b.  These Chiron Properties are provided only for use in the following
non-commercial research activities (the "Research"): (i) AcCD40B and AcCD40C
may be used to produce soluble human CD40 ECD for use in screening and
characterizing humanized versions of anti-CD40 monoclonal antibodies; (ii) the
SF9 insect cell may be used to produce CD40 ECD; and (iii) KT3 or E5 monoclonal
anti-tag antibodies may be used for affinity purification.

2.  PROPERTIES.  The "Chiron Properties" are:

     a.  "Chiron Substances," including the materials provided by Chiron and
any part or portion of them, even if combined with other substances; if Chiron's
contributed materials have genetic material (such as a cell line, probe or
plasmid) then the Chiron Substances also include any progency, mutant, hybrid,
nucleic acid, or other material containing any portion of genetic material from
the Chiron Substances and any copy, complement, or transcription or expression
product of them; and

     b.  "Chiron Information," which includes Chiron's confidential
information, know-how, and data related to the Chiron Substances. Chiron
Information does not include information which: is shown by written records to
have been in Institution's possession before receipt from Chiron; is or becomes,
through no fault of Institution, part of the public domain; or is received from
a third party without breach of a duty to Chiron.

3.  CONFIDENTIALITY.  Institution shall maintain in confidence and not disclose
the Chiron Information to any third party without the written permission of an
authorized representative of Chiron.

4.  USE.  The Chiron Properties shall belong solely to Chiron and may only be
used by personnel of Institution under the terms hereof. The Chiron Properties
may not be taken to another location or used in research which is subject to a
licensing or consulting obligation to a third party (other than the U.S.
Government) unless Chiron has first consented in writing. The Chiron Properties
shall not be used in human beings, and shall be used in compliance with all
applicable laws and regulations including, where applicable, those relating to
the treatment of laboratory animals and current NIH guidelines. Upon Chiron's
request, Institutions shall stop using the Chiron Properties and shall, at
Chiron's election promptly return or destroy the Chiron Properties in their
possession, including all copies.

                                                              Chiron LMTA (6/94)
Page 1 of 2                                f:\wpgen\done\footer.mta\panorama.mta
<PAGE>
5.  PUBLICATION.  The Institution shall periodically report to Chiron the
results of the Research involving the Chiron Properties for Chiron's internal
use. Institution may also present or publish the findings of the Research in a
scientific publication, conference or similar not-for-profit forum, provided
that: (a) no Chiron Information is revealed thereby; and (b) at least 45 days
prior to submission to a publisher or presentation to any third party,
Institution delivers copies of the proposed presentation or publication to
Chiron for review. At Chiron's request, Institution will, for a reasonable
period up to 90 days from initial delivery to Chiron, delay revealing any
patentable subject matter in the disclosure in order to permit the filing of
patent applications. In any publication, the parties will consider joint
authorship and acknowledge the contributions and publications of the other as
scientifically appropriate.

6.  INVENTIONS.  If an invention results from the use of the Chiron Properties,
Chiron shall have a non-exclusive royalty-free license to use such invention for
internal research purposes. Chiron shall also have an option to a license
bearing a reasonable royalty for such territories and scope of exclusivity as
Chiron may request in any patents or patent applications relating to such
inventions, the terms of which license will be negotiated in good faith and will
be arbitrated if the parties cannot agree. The option will be exercisable no
later than six months after Chiron's receipt of Institution's written request
that Chiron exercise or waive its rights with respect to a particular patent
application. Chiron may, at its election and expense, pursue and obtain patent
protection in consultation with Institution for any invention as to which Chiron
is a joint assignee or as to which Chiron has a right to an exclusive license
hereunder.

7.  RISKS.  The Chiron Properties are experimental in nature and are provided
WITHOUT WARRANTY OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE, OR ANY
OTHER WARRANTY OF NONINFRINGEMENT OR TITLE, EXPRESS OR IMPLIED. To the extent
permitted by law, Institution will indemnify and hold Chiron harmless from any
claims or liability arising from the use, handling or storage of the Chiron
Properties by Institution. Chiron will indemnify and hold Institution harmless
arising from any claim arising from Chiron's use of the findings of the
Research.

8.  TERMS.  Except as expressly set forth, nothing in this Agreement grants
either party rights or a license to any patent, copyright, trademark or other
intellectual property rights of the other. This Agreement is governed by the
laws of the State of California, is the entire agreement of the parties relating
to the Chiron Properties, and may not be modified, assigned or transferred
without the written consent of an authorized representative of Chiron.

<TABLE>
<S>                                   <C>
CHIRON CORPORATION                    PANORAMA RESEARCH, INC.
By: /s/ LEWIS T. WILLIAMS             By: /s/ J.W. WARRICK
        Lewis T. Williams, M.D.,              Signature of Authorized Representative
        Ph.D.                         Name:   James W. Warrick
        Senior Vice President         Title:  President
        Research & Development
        President, Chiron
        Technologies
</TABLE>

                                                              Chiron LMTA (6/94)
Page 2 of 2                                f:\wpgen\done\footer.mta\panorama.mta
<PAGE>
                                   EXHIBIT 6

PANGENETICS B.V.                   ***CONFIDENTIAL***                  JULY 1995

PANGENETICS RESEARCH AND DEVELOPMENT PLAN

TITLE:   HUMANIZED MONOCLONAL ANTIBODIES TO CD40 FOR THE TREATMENT OF AUTOIMMUNE
         DISEASES

PROJECT CODE:   A1-01

1.  RATIONALE AND BACKGROUND

      Most responses of our immune system, whether beneficial or deleterious
consists of an interplay of more than one lymphocyte subtype. The cellular
communication needed is mediated by soluble signaling molecules (cytokines) or
by direct cell-cell contact. The current believe is that cytokines predominately
act as modulators, whereas the specificity in cellular communications is
mediated by direct cell-cell contract. During cell-cell contact, key
ligand-receptor interactions transmit signals that determine the fate of the
receiving cell, with possible outcomes such as proliferation, differentiation or
cell death. At least two signals are required for immune cell activation. One of
these is highly specific for the antigen, the T cell receptor on T cells and
surface immunoglobulin on B cells. The other accessory signal is required to
consolidate and amplify the specific signal.

      Two ligand-receptor systems that play a crucial role in the outcome of
cognate interactions between lymphocytes have recently been identified. First,
ligation of the B7 molecules on antigen-presenting cells such as
monocytes/macrophages and B lymphocytes with CD28/CTLA-4 on T lymphocytes.
Second, the ligation of CD40 ligand (CD40L) on activated T cells with CD40 on B
cells, dendritic cells and monocytes/macrophages. Recent experimental data from
others and ourselves clearly indicate that these cellular interactions may play
a role the pathophsiology of various autoimmune diseases.

2.  CD40 AND ITS LIGAND

      The CD40 molecule belongs to the TNF receptor family of type 1
transmembrane proteins. The members of this gene family, which include: the two
receptors for TNF the low-affinity nerve growth factor receptor; the T cell
activation antigens CD27, OX40 and 4-1BB; CD30 and; the FAS antigen, are
characterized by sequence homology in their cysteine-rich extracellular domains.
Cross-linking of the CD40 molecule with monoclonal antibody mediates a variety
of effects on B cells. Anti-CD40 monoclonal antibodies can induce homotypic and
heterotypic adhesion; mediate B-cell proliferation; promote the production of
IL-6 by B cells; and enhance soluble CD23 release from B cells. In addition, it
has been demonstrated that anti-CD40 monoclonal antibodies presented on
FcyRll-bearing mouse fibroblasts can support the outgrowth of long-term B-cell
lines and, in combination with certain cytokines, induce maturation to antibody
secreting cells. Furthermore, anti-CD40 monoclonal antibodies can prevent
programmed cell dead of B cells isolated from lymph node germinal centers.

      Interestingly, the known ligands for the members of the TNF receptor
family are very homologous as

                                       1
<PAGE>
well, forming an other gene family named the TNF/CD40L gene family. Although
TNF-(alpha) is a soluble cytokine, it is initially synthesized as a membrane
associated molecule. Most of the members of the TNF/CD40L receptor family are
type II transmembrane proteins. CD40L has had a lot of attention over the last
few years. The expression of the CD40L seems to be restricted to activated CD4+
T cells. It has recently been demonstrated by others and ourselves, that
activation of T cells through the TcR/CD3 complex and the CD80-CD28 interaction
is most likely the physiological trigger for CD40L expression. Not only is the
appearance of the CD40L on the cell surface tightly regulated, once engaged with
CD40, the molecule rapidly disappears again. The tight regulation of cell
surface ex2pressison of the CD40L seems logical given its potent biological
activities. The CD40L can stimulate the proliferation of purified B cells and,
in combination with cytokines mediate immunoglobulin production. Stimulation of
human B cells with CD40L in combination with IL-2 or IL-10 specifically enhances
the production of IgM, IgG and IgA, whereas addition of IL-4 or IL-13 enhances
the production of IgG4 and IgE. Furthermore, recombinant CD40L is able to
prevent apoptosis in normal and neoplastic B lymphocytes. It has recently been
demonstrated that in addition to the potent activities of CD40L on B cells, the
molecule can induce cytokine production and tumoroidal activity from monocytes.
This stimulatory activity of the CD40L on human monocytes correlates well with
the expression of the CD40 molecule on these cells. Finally, it was very
recently demonstrated that activation of dendritic cells through CD40
cross-linking strongly enhances their T-cell stimulatory capacity and induces
the secretion of pro-inflammatory cytokines.

3.  THE IN VIVO IMPORTANCE OF THE CD40L-CD40 INTERACTION.

      All the above described IN VITRO observations correlate well with the
recent finding that abnormalities in the gene for the CD40L, resulting in the
absence of a functional molecule on activated T cells, is responsible for the
occurrence of X-linked hyper-IgM syndrome (HIGM1). HIGM1 is one of at least
several inherited immunodeficiencies mapped to the X-chromosome and is
characterized by very low serum levels of IgG, IgA and IgE but normal or
elevated IgM, with a resultant susceptibility to opportunistic bacterial
infections. Interestingly, affected individuals are also prone to infections
more typical of T-cell deficiencies such as PNEUMOCYSTIC CARINII pneumonia and
cryptosporidial diarrhoea. More recently, the HIGM1 phenotype was also found in
genetically altered mice deficient for either CD40 or the CD40L. These data
clearly demonstrate the importance of this cellular interaction for competent
immune responses.

4.  THE ROLE OF CD40L-CD40 IN AUTOIMMUNE DISEASES

      There is an increasing number of scientific studies that clearly indicate
the involvement of the CD40L-CD40 interaction in the pathophysiology of various
autoimmune diseases. In these studies using mice suffering from spontaneous or
experimental autoimmune disease, blocking the CD40L-CD40 interaction had clear
beneficial effects. Also a number of IN VITRO observations using mouse and human
lymphocytes, as well as immunohistochemical analysis of pathological specimen
supports this hypothesis.

    A. RHEUMATOID ARTHRITIS (RA)

       Using a blocking mAb to the murine CD40L, it has been shown that it
    possible to prevent

                                       2
<PAGE>
PANGENETICS B.V.                   ***CONFIDENTIAL***                  JULY 1995

    collagen-induced arthritis in mice. The antibody treatment blocked the
    development of joint inflammation, serum antibody titers to collagen, the
    infiltration of inflammatory cells into the subsynovial tissue, and the
    erosion of cartilage and bone. More recently, it was found that recombinant
    CD40L strongly stimulates the production of pro-inflammatory cytokines such
    as TNF-(alpha) by synovial cells obtained from inflamed joints of RA
    patients.

    C. MULTIPLE SCLEROSIS (MS)

       Experimental allergic encephalomyelitis is an animal model for MS. It has
    recently been found that injection of mice with antibody to CD40L at the
    time of disease induction, completely prevents disease. More interestingly,
    it has also been found that treatment with anti-CD40L after disease onset,
    even shortly before maximum disability score is reached, leads to a dramatic
    disease reduction. In MS, demyelination is thought to be the result of the
    release of toxic mediators such as TNF-(alpha) and nitric oxide, released by
    macrophages and or microglia. It is known some time that activated T cells
    can induce the production of large amounts of nitric oxide. This was thought
    to be mediated by the secretion of pro-inflammatory cytokines such as IFN-y
    and TNF-(alpha). However, it was very recently demonstrated that a direct T
    cell-macrophage contact is needed for optimal induction of nitric oxide,
    which could largely be inhibited by anti-CD40L mAb. When we combine these
    data with our recent findings that in MS lesions activated T cells
    expressing CD40L co-localize with CD40-positive B cells (producing
    antibodies to myelin basic protein) and CD-40-positive macrophages (capable
    of producing toxic mediators such as TNF-(alpha) and nitric oxide), strongly
    suggest that the CD40L-CD40 interaction plays a role in the pathophysiology
    of MS.

    C. SYSTEMIC LUPUS ERYTHEMASTOSUS (SLE)

       In (SWR x NZB)F1 mice (lupus mice), pathogenic autoantibodies cause fatal
    lupus nephritis. The generation of these autoantibodies is a T-cell
    dependent process. It has very recently been demonstrated that lupus mice
    have much higher percentages of CD40L-positive cells in their spleen than
    normal mice, even at pre-autoimmune age. Furthermore, it has been shown that
    the pathogenic autoantibody-inducing ability of T cells from lupus mice
    could be blocked IN VITRO by anti-CD40L mAb. Finally, it has been
    demonstrated that a brief treatment of lupus mice with anti-CD40L mAb had a
    sustained beneficial effect on the spontaneous disease, long after the
    antibody had cleared from their circulation.

5.  SPECIFIC AIM

      The aim of the project is to humanize anti-CD40L mAbs. After humanization,
the best antibody will be tested in relevant animal models and subjected to
pharmacokinetic and toxicology studies, before initiation of phase I/II clinical
trials in autoimmune disease patients. The outline of this project is
schematically represented in Figure 1 (at the end of Section 6), the numbers in
the various project blocks refer to well defined development tasks described in
detail below. The timing of the major project milestones is given in Table 1 at
the end of Section 6.

                                       3
<PAGE>
PANGENETICS B.V.                   ***CONFIDENTIAL***                  JULY 1995

6.  DESCRIPTION OF THE DEVELOPMENT PLAN

6.1.  GENERATION OF HUMANIZED MONOCLONAL ANTIBODIES TO CD40

      Cell fusion techniques have made the generation of rodent monoclonal
antibodies (mAbs) a routine endeavor. As early as 1975 the first investigators
of this technology recognized the therapeutic and industrial potential of mAbs,
particularly human monoclonal antibodies (hu-mAbs), yet fifteen years later only
OKT3, an anti-T lymphocyte antigen [CD3] murine mAb is a licensed drug. There
are two reasons for this apparent lack of progress, target selection and
technical difficulties. Despite this modest beginning a large number of mAbs
generated primarily by cell fusion are in clinical development. Recent advances
using recombinant DNA technology will alleviate many of the technical problems
with cell fusion and will accelerate the availability of therapeutic hu-mAbs.

      Recombinant mAbs have several attractive advantages over conventional
pharmaceuticals. These proteins can be generated with exquisite selectivity and
specificity in a short period of time. Recombinant antibodies can be designed to
have multiple effector functions in addition to their antigen-combining
abilities. This permits the design of molecules capable of performing complex
tasks involving host cells as well as other host mediator functions. Native
antibodies have a long serum half-life, fragments of antibodies can be designed
to penetrate tissues with a rapid plasma clearance. This facilitates
prophylactic treatment of at-risk patients. Finally, specific mAbs can be
generated more rapidly and with far less effort than that required for synthesis
of conventional low molecular weight organic molecules. This means that methods
devised to select antigen and receptor binding molecules have significant
pharmaceutical potential. Thus it is often possible to test whether neutralizing
a given mediator or removing a cell type with an antibody or antibody fragment
benefits the host with much less effort than is required to generate organic
receptor antagonists. Recombinant mAbs permit rapid testing of a THERAPEUTIC
CONCEPT. Finally and most importantly is the limited toxicity of mAbs.

      As therapeutic agents, antibodies are not without their problems.
Antibodies are composed of protein; they are potentially immunogenic; they must
be given parenterally; and they are relatively expensive to produce. Many
therapeutic antibodies are aimed at the treatment of acute life-threatening
disease. In this case cost may be of minor importance. The construction of mAbs
will overcome some of these problems. Production costs of recombinant mAbs in
some systems are substantially below those of hybridomas.

      Several laboratories have pioneered methods for construction of human
antibodies from rodent mAbs by splicing the rodent hypervariable complementarity
determining regions (CDRs) onto human variable framework region sequences. This
technique is called CDR-grafting. CDR-grafting is feasible because the antibody
combining site is constructed from several hypervariable regions held together
to form the antigen binding cleft by a beta-sheet comprised of framework
sequences and because the three dimensional conformation of antibodies is highly
conserved among different species. It has been shown that humanization can also
be achieved by "Selected Residue Replacement". In this process the exposed amino
acid residues in the mouse framework regions, which do not match between mouse
and human, are changed to human. We have recently used this approach
successfully for the humanization of a therapeutic antihuman B7 mAb.

                                       4
<PAGE>
PANGENETICS B.V.                   ***CONFIDENTIAL***                  JULY 1995

      Very recently, a novel technology terms "Epitope Imprinted Selection", has
been developed for humanization of rodent mAbs. Sequences comprising the antigen
binding site of the rodent mAb are combined with a diverse, random repertoire of
sequences of human antibodies. Successful combinations of heavy-light chain
pairing will create compete rodent/human binding sites, which can be displayed
on the surface of filamentous phage, allowing selection of antigen-binding
phage. Next, the remaining rodent sequences are replaced by a repertoire of
complementary human sequences, and successful combinations of heavy-light chain
pairing can again be selected using immobilized antigen.

      It should be noted that often even fully humanized murine mAbs may be
immunogenic. Although limited studies have demonstrated that chimeric
mouse-human antibodies are less immunogenic in humans than the parent mouse mAb,
more studies will be required to determine how much a problem the human
anti-idiotype response will be. With a humanized version of an anti-CD40 mAb we
do not expect any HAMA response, because the therapeutic use of this mAb, if
successful, blocks both primary and secondary antibody responses. However, from
a regulatory standpoint and for marketing reasons it is preferred to work with a
humanized mAb.

      The humanization of the lead anti-CD40 mAb, 5D12, is well underway. The
cDNAs encoding the antibody heavy and light chain variable regions of the mouse
mAbs have been cloned and sequenced. The predicted protein sequences of the
mouse VH and VL regions were used to search different data bases for human
antibody sequences with the best homology to the mouse mAbs. The ten best
matching human antibody sequences were used to determine which of the mouse
amino acids had to be changed to what human amino acid in order to obtain a
humanized version of the mAbs using a method named resurfacing. Since
immunogenicity of a protein is dependent on the nature of its surface, replacing
only the exposed residues of a rodent antibody with those usually found in human
antibodies, will severely decrease or even abolish an immune response. The
judicious replacement of exterior residues only should have little or no effect
on the interior of the domains, or on the interdomain contacts. This method has
indeed successfully been used for the humanization of the anti-B7 mAb B7-24 (de
Boer et al, manuscript in preparation).

      The next step in the humanization process of the mAb will be to change the
key residues identified by the above method from mouse to human. Finally,
correct clones will be transferred from the sequencing vector to an expression
vectors, already containing the human heavy or light chain constant region.
These expression vectors are for transient expression in insect cells, and upon
cotransfection the insect cells will secrete the antibody as a human IgG1 Fab
fragment. We will also cloned the original mouse heavy and light chain variable
regions in this vector system, resulting in expression of a chimeric mouse/human
IgG1 Fab fragment.

6.2.  CONFIRM BIOLOGICAL ACTIVITY AND BINDING AFFINITY OF HUMANIZED MABS

      Expression of the Fab constructs (both humanized and chimeric) will be
anlyzed using an ELISA system. The recombinant Fab fragments will subsequently
be tested for biological activity. First it will be tested whether the
recombinant Fab fragments can bind to their respective target molecules using
both ELISA and FACS analysis. We will perform BIAcore experiments to determine
the binding affinity of the Fab fragments (including on/off rates). Next we will
test the inhibitory capacity of the antibodies in functional

                                       5
<PAGE>
PANGENETICS B.V.                   ***CONFIDENTIAL***                  JULY 1995

experiments using human lymphocytes. These experiments will learn us whether the
humanized mAbs are functionally active. If there are no major differences in
binding affinity between the humanized and the chimeric version of the antibody,
we can continue to the next step of the project, which is the generation of
full-length antibody versions with human constant regions of different isotypes.
If there is a significant decrease in binding affinity of the humanized Fab
fragments, we will make several modifications to restore the original binding
affinity.

      At this point in the project it will also be possible to generate variants
of the original antibodies with even higher binding affinity. This can be done
using various phage display technologies available to PanGenetics.

6.3.  CONFIRM ROLE OF CD40L-CD40 INTERACTION IN THE PATHOPHYSIOLOGY OF VARIOUS
      AUTOIMMUNE DISEASES

      The objective of this task is to use relevant patient-derived lymphocytes
for IN VITRO experiments to assess/confirm the role of the CD40L-CD40 mediated
activation of inflammatory cells in autoimmune diseases such as RA, SLE and MS.
Subsequently, we will test the inhibitory capacity of the lead antibodies in
these experiments. If these key experiments are positive, we will perform a
larger number of IN VITRO experiments using human lymphocytes, both from
controls and obtained from inflamed tissue of autoimmune patients.

      In this task of the project we will also perform IN VITRO experiments
addressing the issue of which human isotype should be used for the production of
the complete humanized mAbs. Major concerns are the antibody effector functions
(FcR binding, complement activation, etc) and the antibody half-life. Finally,
we will investigate the mechanisms by which the antibodies exert their
inhibitory activity. At present we do not know whether the antibodies block just
by hinderance, whether they induce negative signalling or whether they induce
conformational changes in their target molecules leading to a loss of function.

6.4.  LARGE SCALE PRODUCTION OF BEST HUMANIZED MABS

      After confirmation of the biological activity of the humanized Fab
fragments in task 6.2, we will express selected antibodies as complete human
antibodies. This is most likely best done using a CHO cell expression system.

6.5.  OBTAIN PRELIMINARY IN VIVO DATA ON BLOCKING CAPACITY OF LEAD MABS

      Before using the humanized anti-CD40 mAbs in various non-human primate
diseases models, we want to confirm that the antibodies can functionally block
the CD40L-CD40 interaction IN VIVO. It has been confirmed by FACS analysis that
the mAb in question bind to the CD40 molecule on the lymphocytes of various
non-human primates. This preliminary study will provide us proof of concept that
the mAb can functionally block the CD40L-CD40 interaction IN VIVO. We will test
whether treatment of rhesus monkeys with the lead anti-CD40 mAb can inhibit the
generation of a secondary antibody response to a T-cell dependent

                                       6
<PAGE>
PANGENETICS B.V.                   ***CONFIDENTIAL***                  JULY 1995

antigen. These experiments are scheduled to be performed at the BPRC in
Rijswijk, The Netherlands in collaboration with Dr. Bert 't Hart. Nine rhesus
monkeys will be selected that have previously been immunized with a T-cell
dependent antigen. These monkeys will be divided in 3 test groups: (i) control
treatment (PBS, every day for 10 days); (ii) low mAb dose (0.05 mg/kg, every day
for 10 days) and; (iii) high mAb dose (0.5 mg/kg, every day for 10 days). At day
0 all the monkeys will receive a booster injection with the antigen.
Administration of the mAb or control by IV bolus will be done 2 hours before
immunization. Serum will be collected at days 2, 4, 6, 8, 10, 12, 14. (on days
2-10 just prior to study drug administration). The serum samples will be anlyzed
for:

   o  total antibody titers

   o  antigen-specific antobody titers

   o  serum levels of study drug

   o  presence of anti-human (Ig) antibodies (RAHU)

If these preliminary experiments are postive (i.e. treated animals show
decreased secondary antibody responses), we intend to perform IN VIVO
experiments to study the effects of anti-CD40 on disease severity in various
primate autoimmune disease models (see below).

These preliminary in vivo experiments will also be used to analyze the
pharmacokinetic characteristics of the lead humanized mAb. The PK data will be
used to extrapolate (using mathematical models) to a serum half-live
in humans. This will be the basis for determining the dose schedules in further
animal experiments and future patient studies.

6.6  IN VIVO EXPERIMENTS IN NON-HUMAN PRIMATE MODELS FOR AUTOIMMUNE DISEASES

      Before initiating clinical trials with the lead anti-CD40 mAb, it would be
preferred to have data from relevant IN VIVO models. Two models are available to
us: (i) collagen-induced arthritis in rhesus monkeys and chronic EAE in
marmosets. Although the collagen-induced arthritis model in rhesus monkeys does
not represent rheumatoid arthritis in humans (in particular not with respect to
the cause of the disease), we consider it a good model to study local
inflammation (in joints). We plan to perform a number of IN VITRO experiments
and immunohistochemical analysis using rhesus monkey tissue to confirm the role
of CD40L-CD40 in the pathophysiology of RA. If these initial experiments are
positive, we will immunize 12 rhesus monkeys with a single intracutaneous
injection of 3 mg B-CII. Starting at day 8, four animals will be treated with
saline, four with an optimal dose of PG-CD40 and four animals with an
appropriate control, for 14 consecutive days. Thereafter the severity of the
disease will be analyzed.

   We will also test the therapeutic value of the humanized anti-CD40 mAbs in a
chronic EAE model in marmosets. The relatively new model is considered to
represent chronic relapsing multiple sclerosis. We are presently evaluating this
model with respect to the involvement of CD40 in the pathophysiology.

6.7  PRODUCTION OF GMP BATCH OF THERAPEUTIC MAB

      For use in humans, the lead antibodies will have to be produced under GMP
conditions. It has

                                       7
<PAGE>
PANGENETICS B.V.                   ***CONFIDENTIAL***                  JULY 1995

presently not been decided where the material will be produced, although it
seems most likely that it will be subcontracted to a licensed contract
manufacturer. The produced material will be subjected to an extensive QC
analysis to verify purity, biological activity, etc. The testing program has
been divided in a biochemical part and a biological part.

6.8  BIOSAFETY TESTING OF GMP MATERIAL

      As part of the procedure to produce the material under GMP, the produced
material will extensively be tested for the presence of infectious agents. Tests
will be conducted on the master cell bank (MCB), the bulk unpurified product
(BUP) and, the final purified product (FP).

6.9  TOXICOLOGY TESTING OF GMP MATERIAL IN NON-HUMAN PRIMATES

      The GMP produced material will be subjected to toxicology testing in
Rhesus monkeys, before the initiation of clinical studies. These experiments
will be subcontracted to a GLP laboratory. In addition, a GLP study to address
tissue cross-reactivity will be performed.

6.10  PHASE I/II CLINICAL STUDIES

      With the GMP grade material clinical studies in autoimmune disease
patients will be initiated as soon as possible. The primary objective of these
studies will be to determine the safety and tolerability of different dose
levels of anti-CD40 mAbs. Secondary objectives are to determine the efficacy and
to determine the incidence of anti-idiotype response. The studies will be
designed as open label phase I/II inter-patient dose escalation studies to
investigate the safety and tolerability of immunotherapy using blocking mAbs.
The outcome of the non-human primate experiments will determine for which
autoimmune disease the first clinical study will be initiated.

6.11  PHASE II AND III CLINICAL STUDIES

      After successful completion of the initial phase I/II clinical studies,
further clinical studies to provide us with statistical evidence of the drug
efficacy will be initiated.

                                       8
<PAGE>
PANGENETICS B.V.                   ***CONFIDENTIAL***                  JULY 1995

FIGURE 1.  PANGENETICS CD40 RESEARCH AND DEVELOPMENT PLAN

                                     [INSERT CHART HERE]

TABLE 1.  KEY MILESTONE SCHEDULE

- ------------------------------------------------------
MILESTONE TASK                          MILESTONE DATA
- ------------------------------------------------------
MS 1:  Complete humanization of lead
       antibody; update patent application  Q4-1995
- ------------------------------------------------------
MS 2:  Complete key in vitro
       experiments                          Q4-1995
- ------------------------------------------------------
MS 3:  Complete key in vivo
       experiments in non-human primates    Q4-1996
- ------------------------------------------------------
MS 4:  GMP production                       Q2-1997
- ------------------------------------------------------
MS 5:  Biosafety and Toxicology
       testing                              Q4-1997
- ------------------------------------------------------
MS 6:  Approval for Phase I/II study        Q1-1998
- ------------------------------------------------------
MS 7:  Completion of Phase I/II study       Q3-1999
- ------------------------------------------------------

                                       9

<PAGE>
                                    EXHIBIT 7

                       C40 LICENSE\COLLABORATION AGREEMENT

DATE:          October 1, 1994

PARTIES:       1.  Mark Deboer Phd, "Deboer";
               E. van Calcarstraat 30; 1963 DG
               Heemskark; The Netherlands; T: 31
               2510 41356; F: 31 2510 50719.
               2.  Panorama Research Inc., "PRI";
               2462 Wyandotte St.; Mountain View, CA
               94043; T: 415-694-4996; F:
               415-694-7717.

DEBOER AGREES:

1.  To grant PRI a license to all of the rights of Dr. Mark Deboer in the Chiron
    CD40 technology.

PRI AGREES:

1.  To cooperate with Dr. Mark Deboer who will be responsible for the execution
    of the project plan and oversee the work of Dr. Lucien Aarden.

2.  To share ownership of the project with Dr. Mark Deboer on a 50:50 basis.

AGREED:

/s/ MARK DeBOER PhD                                                     10-1-94
    Mark DeBoer PhD                                                        DATE

/s/ JAMES W. LARRICK MD PhD                                             10-1-94
    James W. Larrick MD PhD                                                DATE
    CEO and President
    Panorama Research Inc.

                                                                   EXHIBIT 10.13

CERTAIN INFORMATION IN THIS EXHIBIT IS SUBJECT TO A REQUEST FOR CONFIDENTIAL
TREATMENT. IN ACCORDANCE WITH RULE 406 UNDER THE SECURITIES ACT OF 1933, AS
AMENDED, SUCH INFORMATION HAS BEEN OMITTED AND FILED SEPARATELY WITH THE
SECURITIES AND EXCHANGE COMMISSION. THE LOCATION OF SUCH OMITTED INFORMATION HAS
BEEN INDICATED WITH AN ASTERISK(*).

                                LICENSE AGREEMENT

   This License Agreement (hereinafter "Agreement") is made and entered into as
of the 1st day of June (the "Effective Date") between Biogen, Inc., a
Massachusetts corporation having a principal place of business at 14 Cambridge
Center, Cambridge MA, 02142 ("Biogen") and Tanox Biosystems, Inc., a Texas
corporation, having a principal place of business at 10301 Stella Link, Houston,
TX 77025 ("Tanox").

   NOW THEREFORE, the parties hereby agree as follows:

BACKGROUND

   Biogen owns certain patent rights identified in Appendix A hereto, relating
to ANTI-CD4 MONOCLONAL ANTIBODIES.

   Biogen has additional rights to technical data and information pertaining to
anti-CD4 monoclonal antibodies.

   Tanox wishes to be licensed under certain of the TECHNOLOGY (as defined
below) and patent rights and Biogen is willing to grant Tanox such a license,
for the consideration and under the terms set forth in this Agreement.

1. DEFINITIONS

1.1    "AFFILIATE", as applied to either party, shall mean any corporation,
       firm, partnership or other entity which directly or indirectly owns, is
       owned by, or is under common control with, a party to the Agreement to
       the extent of at least fifty percent (50%) of the equity or other
       ownership interests (or such lesser percentage which is the maximum
       allowed to be owned by a foreign corporation in a particular
       jurisdiction) having the power to vote on, or direct the affairs of, the
       entity.

                                       1
<PAGE>
1.2    "DISTRIBUTOR(S)" shall mean a person or entity in a country who buys
       LICENSED PRODUCT from Tanox or its AFFILIATES or SUBLICENSEES and who,
       under an implied license, sells such LICENSED PRODUCT in that country.

1.3    "FIELD" shall mean the manufacture, use, importation, offer for sale or
       sale of LICENSED PRODUCT for human use only, including therapeutic,
       prophylactic and diagnostic use.

1.4    "FIRST COMMERCIAL SALE" shall mean in each country of the TERRITORY, the
       first sale of a LICENSED PRODUCT by Tanox or any of its AFFILIATES,
       DISTRIBUTOR(S) or its SUBLICENSEES to a third party in connection with
       the nationwide introduction of LICENSED PRODUCT by Tanox or any of its
       AFFILIATES, DISTRIBUTOR(S) or its SUBLICENSEES following marketing and/or
       pricing approval by the appropriate governmental agency for the country
       in which the sale is made. When governmental approval is not required or
       when sales can be made through named patient sales (also including
       "compassionate use sales", "treatment INDs" or their equivalents) prior
       to governmental approval, such FIRST COMMERCIAL SALE in that country
       shall be the first sale in connection with the nationwide introduction of
       LICENSED PRODUCT.

1.5    "IND" shall mean an Investigational New Drug Application filed with the
       U.S. Food and Drug Administration ("FDA") or an equivalent filing in the
       TERRITORY.

1.6    "LICENSED PRODUCT(S)" shall mean any composition(s) (i) the manufacture,
       use, importation, offer for sale, or sale of which, but for this license,
       infringes a VALID CLAIM of one or more PATENTS or (ii) which embodies any
       of the TECHNOLOGY.

                                       2
<PAGE>
1.7    "MAA" shall mean an application for regulatory approval to sell LICENSED
       PRODUCT in the European Union and is similar in purpose to an NDA in the
       United States.

1.8    "NDA" shall mean a New Drug Application or Biologic License Application
       ("BLA") or equivalent filed for LICENSED PRODUCT with the U.S. Food and
       Drug Administration ("FDA").

1.9    "NET SALES" shall mean the total gross invoice amount actually received
       by Tanox on the sale of LICENSED PRODUCT in the TERRITORY by Tanox and
       its AFFILIATES, SUBLICENSEES and DISTRIBUTOR(S) to third parties less the
       following items, as determined from the books and records of Tanox or its
       AFFILIATES, SUBLICENSEES or DISTRIBUTOR(S): (i) insurance and transport
       charges actually invoiced; (ii) amounts repaid or credited for rejection
       or return of LICENSED PRODUCT; (iii) sales or other excise taxes or other
       governmental charges levied on the invoiced amount and actually paid by
       the seller; (iv) custom duties and charges actually paid by the seller;
       (v) normal and customary trade and quantity discounts actually allowed
       and actually taken which relate to LICENSED PRODUCT.

      Sales of LICENSED PRODUCT between or among Tanox, its AFFILIATES,
DISTRIBUTOR(S) or the SUBLICENSEES shall be excluded from the computation of NET
SALES. Notwithstanding the previous sentence, the resale of the LICENSED PRODUCT
by the AFFILIATE, DISTRIBUTOR(S) or SUBLICENSEES to a third party who is not an
AFFILIATE, DISTRIBUTOR(S) or SUBLICENSEES of Tanox, shall be included in the
definition of NET SALES for the purposes of this Agreement.

      In the event that Tanox, its AFFILIATES, DISTRIBUTOR(S) or its
SUBLICENSEES receives in any transaction included within the definition of NET
SALES, any non-cash compensation or lower prices on other products in exchange
for any LICENSED PRODUCT, or sells LICENSED PRODUCT in other than an arms length


                                       3
<PAGE>
transaction, then the gross amount invoiced in such transaction shall be deemed
to be the gross amount that would have been paid had there been such a sale at
the average sale price of such LICENSED PRODUCT during the applicable royalty
reporting period in the country in which such disposition took place. The
preceding sentence shall not apply to the distribution at no cost of LICENSED
PRODUCT to physicians, hospitals or clinics for promotional purposes or academic
investigators for research and clinical trial purposes, which are not included
in the definition of NET SALES.

      In the event that LICENSED PRODUCT is sold in combination with one or more
other active ingredients, including one or more other antibodies having a
therapeutic effect (such antibody(ies) defined as an "Antibody Active
Ingredient"), the NET SALES on the combination product shall be calculated by
multiplying actual NET SALES of the combination product by the fraction obtained
after dividing A by the sum of A+B, in which "A" is the average selling price of
LICENSED PRODUCT sold separately by the same party during the same accounting
period in the country in which the sale of the combination product was made and
"B" is the average selling price of the other active ingredient(s) sold
separately by the same party during the same accounting period in the country in
which the sale of the combination product was made.

      If, however, no separate sales of LICENSED PRODUCT or Antibody Active
Ingredient(s) or other active ingredients are made then:

      A. If the combination product includes one or more Antibody Active
Ingredients (the combination product defined for the purpose of this sentence as
a "TRUE ANTIBODY COMBINATION PRODUCT"), the NET SALES of such TRUE ANTIBODY
COMBINATION PRODUCT shall be reduced by 50%; or

      B. If the combination product includes one or more active ingredients that
are not Antibody Active Ingredients, the parties shall negotiate in good faith a
mutually agreeable formula for determining appropriate reduction in NET SALES
with the goal of equitably determining the appropriate percentage value
represented by the components.

                                       4
<PAGE>
      The parties agree that in no event shall NET SALES of LICENSED PRODUCT or
any combination product of this Article 1.9 be reduced to less than fifty
percent (50%) of actual NET SALES of such LICENSED PRODUCT or combination
product by reason of any adjustment set forth in this Article 1.9.

      The parties further agree that if Tanox becomes (a) an AFFILIATE of; or
(b) merged with; or (c) acquired by: or (d) an acquirer of, a third party having
a market capitalization equal to, or greater than ten billion dollars ($10B) at
the time of such AFFILIATE formation or merger or acquisition, then NET SALES as
defined in the first sentence of this Article shall be redefined to mean the
total gross invoice amount (not dependent on whether the invoices were actually
paid) on the sale of LICENSED PRODUCT in the TERRITORY by Tanox and its
AFFILIATES, SUBLICENSEES and DISTRIBUTOR(S) to third parties, less the items
recited in the first sentence of this Article. All other provisions of the
definition of NET SALES shall remain unaffected by such AFFILIATE formation,
merger or acquisition.

1.10   "PATENTS" shall mean: (a) the patent applications and patents listed in
       Appendix A to this Agreement, any extensions, supplemental protection
       certificates, reissues, renewals, re-examinations, divisionals,
       continuations or continuations-in-part thereof, any foreign counterparts
       thereof, any patent issuing from any of the foregoing, which Biogen
       presently or hereafter owns and (b) such other patent applications and
       patents which Biogen presently or hereafter owns or controls that is
       required for the manufacture, use or sale of LICENSED PRODUCT.

1.11   "PROTEIN DESIGN LABS PATENTS" shall mean the patents and patent
       applications listed in Appendix B hereto.


                                       5
<PAGE>
1.12   "ROYALTY QUARTER" shall mean the three (3) months ending on the last day
       of March, June, September and December of each year.

1.13   "SUBLICENSEES" shall mean a third party (but not an AFFILIATE of Tanox)
       licensed by Tanox to make, use, import, offer for sale and sell LICENSED
       PRODUCT.

1.14   "TECHNOLOGY" shall mean any data, know-how, or other information, or any
       material, reagent or other substance relating to LICENSED PRODUCT or to
       anti-CD4 monoclonal antibodies which may be useful in the discovery,
       research, development, manufacture, use or sale of LICENSED PRODUCT or to
       anti-CD4 monoclonal antibodies and which is known to, and/or in the
       possession of, Biogen on the Effective Date and to which Biogen has a
       transferable right.

1.15   "TERRITORY" shall mean the entire world.

1.16   "VALID CLAIM" shall mean (i) any claim(s) in an issued, unexpired patent
       which has not been held unenforceable, unpatentable, or invalid by a
       court or other governmental agency of competent jurisdiction, in a
       decision that is unappealable or unappealed, within the time allowed for
       appeal, and which has not been abandoned or admitted to be invalid or
       unenforceable through reissue or disclaimer or (ii) a claim of a pending
       patent application which is pending as of the Effective Date and for
       which examination has been requested or, in the case of Japan and Canada,
       will be timely requested, and which claim shall not have been canceled,
       withdrawn, abandoned or rejected by an administrative agency from which
       no appeal can be taken. If in the TERRITORY there should be two or more
       such decisions conflicting with respect to the validity of the same
       claims, the decision of the higher or highest tribunal shall thereafter
       control. However, should the tribunals be of equal rank, then the
       decision or decisions upholding the claim shall prevail


                                       6
<PAGE>
       when the conflicting decisions are equal in number, and the majority of
       decisions shall prevail when conflicting decisions are unequal in number.

2.     LICENSES AND TECHNOLOGY TRANSFER

2.1    Biogen hereby grants Tanox a TERRITORY-wide, exclusive, royalty-bearing
       license under the TECHNOLOGY and PATENTS to make, have made, import, use,
       offer for sale, and sell LICENSED PRODUCT for use in the FIELD. As soon
       as reasonably possible following execution of this Agreement, Biogen will
       transfer all TECHNOLOGY listed on Appendix C that is in its control or
       possession to Tanox, and shall cooperate with Tanox in its initial use of
       the TECHNOLOGY to develop a LICENSED PRODUCT by making Biogen personnel
       with knowledge of the TECHNOLOGY available for initial meetings at Biogen
       as agreed, not to exceed two working days, and subsequent telephone
       conference(s) with Tanox during Biogen's normal business hours under the
       following conditions:

       (a) Biogen personnel are given at least reasonable advance notice of such
       conference(s);

       (b) Tanox shall direct all telephone calls to a Technology Liaison who
       will direct Tanox's attention to the appropriate person responsible for a
       particular TECHNOLOGY. Biogen shall provide Tanox with all available
       TECHNOLOGY within 3 months from the Effective Date of this Agreement;

       (c) Telephone conferences shall not exceed 5 hours per month for the
       first three months,

       (d) Any time spent by Biogen personnel on retrieval of information
       requested shall, except for information previously requested and not
       provided, be limited to the three month period after the Effective Date
       and shall be reasonably based upon pre-existing commitments and the time
       required to complete the tasks requested by Tanox; and

       (e) Telephone conferences subsequent to the time period of subpart (b)
       (other than for pursuing information or TECHNOLOGY previously requested
       but not provided) shall not exceed 1 hour per month.


                                       7
<PAGE>
2.2    The term "exclusive" in Article 2.1 shall mean that Biogen cannot grant
       further licenses hereunder for LICENSED PRODUCT in the TERRITORY in the
       FIELD, subject only to:

      (a) United States Government rights, if any, that may be created by the
use of LICENSED PRODUCT by Dr. Keith Reimann, Beth Israel Hospital-RE-113,
Boston, MA 02215, pursuant to existing National Institute of Health ("NIH")
contract 1R01 HL 59747-01. Biogen warrants and represents that none of the
PATENTS were conceived and/or reduced to practice with any United States
Government funding and that neither Dr. Reimann nor any third party has any
rights to commercialize LICENSED PRODUCT. Biogen, upon Tanox's request, agrees
to provide Tanox with all data generated during the course of Dr. Reimann's NIH
contract (data generated as of December 1996 are attached as Exhibit D); and

      (b) Biogen's reserved right to use the TECHNOLOGY and PATENTS for internal
research and educational purposes.

2.3    The license granted to Tanox hereunder shall include the right to grant a
       sublicense to one SUBLICENSEE in each country. A copy of the sublicense
       shall be provided to Biogen. Tanox shall ensure that its AFFILIATE(S) and
       SUBLICENSEES to whom Tanox has extended or sublicensed its rights under
       this Article 2, shall comply with all of the terms of this Agreement to
       which Tanox is bound.

      Any sublicense granted by Tanox under this Agreement shall be subject and
subordinate to the terms and conditions of this Agreement except that:

      (a) the sublicense terms and conditions shall reflect that the
SUBLICENSEES shall not have the right to further sublicense;

      (b)the sublicense shall include a requirement that the SUBLICENSEES use
the same efforts to bring the subject matter of the sublicense into commercial
use as those efforts of Tanox under Article 9.1 of this Agreement; and

      (c) the sublicense shall expressly provide for the transfer of all
obligations, including the payment of royalties specified in the sublicense, to
Biogen or its designee, in the event that the present Agreement is terminated.


                                       8
<PAGE>
2.4    Except as expressly provided herein, nothing in this Agreement shall be
       deemed to grant either party any rights or license to any patent, patent
       application, technology, know-how or invention of the other party.

3. PAYMENTS AND REPORTING

   In consideration of the license rights granted to Tanox under this Agreement,
Tanox shall make the following payments to Biogen:

3.1                                    *

3.2    Tanox shall pay Biogen a royalty on NET SALES of LICENSED PRODUCT sold by
       Tanox, its AFFILIATES, SUBLICENSEES and DISTRIBUTOR(S) in the TERRITORY
       at the following rates:


    PORTION OF
    ANNUAL NET SALES                      ROYALTY RATE    OFFSET (ARTICLE 3.3)
    ----------------                      ------------    --------------------
           *                                    *                   *

                                       9
<PAGE>
3.3    If Tanox licenses PROTEIN DESIGN LABS PATENT(S) to make, have made, use,
       sell, offer for sale, or import LICENSED PRODUCT, then so long as a VALID
       CLAIM of a PROTEIN DESIGN LABS PATENT encompasses the LICENSED PRODUCT in
       the United States, the royalty otherwise payable to Biogen under Article
       3.2 on sales in the respective countries in which there are such VALID
       CLAIMS shall be reduced by the amounts set forth in the above Table of
       Article 3.2 under the heading "Offset" determined by reference to the
       amount of annual NET SALES in such countries.

3.4    As further consideration of the rights granted to Tanox under this
       Agreement, Tanox shall make the following nonrefundable, noncreditable
       payments to Biogen upon the first achievement of each of the following
       milestones.

   MILESTONE                                                    PAYMENT
   ---------                                                    -------
   Upon filing an IND or equivalent
   filing for first LICENSED PRODUCT                              *

   Commencement of Phase III Clinical
   Trial (or equivalent pivotal trial)
   of first LICENSED PRODUCT                                      *

   Filing BLA/MAA or equivalent filing
   for first LICENSED PRODUCT                                     *

   Regulatory approval anywhere
   in the TERRITORY of first LICENSED
   PRODUCT                                                        *

                                       10
<PAGE>
3.5    If, after executing this Agreement, Tanox becomes (a) an AFFILIATE of; or
       (b) merged with; or (c) acquired by: or (d) an acquirer of, a third party
       having an equal or greater number of employees than Biogen at the time of
       such AFFILIATE formation or merger or acquisition, then Tanox shall be
       obligated to make additional milestone payments in addition to those
       recited above in Article 3.4. Following such a merger or acquisition, the
       additional nonrefundable, noncreditable retroactive milestones are due
       thirty (30) days after the later of: (i) being triggered by the events
       described in the Table below or (ii) the date of the acquisition, or
       merger transaction and are as follows:

   MILESTONE                                                        PAYMENT
   ---------                                                        -------
   Commencement of Phase II

   Clinical Trial of first LICENSED PRODUCT                            *

   Commencement of Phase III
   Clinical Trial (or equivalent pivotal trial)
   of first LICENSED PRODUCT                                           *

   Regulatory approval by FDA of first LICENSED PRODUCT                *

   Regulatory approval by EMEA of first LICENSED PRODUCT               *


                                       11
<PAGE>
3.6    All royalties accrued pursuant to this Article 3 shall be paid to Biogen
       on a quarterly basis within forty five (45) days after the end of each
       calendar quarter with respect to NET SALES on sales of LICENSED PRODUCT
       made in such quarter.

3.7    Together with each royalty payment due under this Article 3, Tanox shall
       provide Biogen with a signed written statement certifying, separately for
       each type of LICENSED PRODUCT, the following information: (i) gross sales
       by Tanox, its AFFILIATES, SUBLICENSEES, and DISTRIBUTOR(S), by country;
       (ii) NET SALES separately by country and in total; (iii) quantity sold by
       Tanox, its AFFILIATES, SUBLICENSEES, and DISTRIBUTOR(S); and (iv) average
       sales price in each country. Tanox shall maintain, and shall use
       reasonable efforts to ensure that its AFFILIATES, SUBLICENSEE and
       DISTRIBUTOR(S) maintain, appropriate books of account and records of all
       sales of LICENSED PRODUCT in any calendar year for a period of three (3)
       full years after such calendar year. At Biogen's request, Tanox shall
       make such books of account and records available for inspection during
       normal business hours by independent public accountants appointed by
       Biogen for the purpose of verification of the amounts paid to Biogen
       under this Agreement. Biogen shall not conduct more than one audit in any
       calendar year.

   The cost of such audit shall be borne by BIOGEN unless it is established by
the audit that there has been an error which has caused Tanox to underpay by ten
percent (10%) or more for the period under audit, in which case the cost of such
audit shall be borne by Tanox. Tanox shall pay to Biogen any underpaid
compensation that is confirmed by the audit promptly and with interest at a rate
not to exceed the interest rate defined in Article 3.9 hereunder.

3.8    The amounts computed or specified under this Article 3 as due to Biogen
       are the actual amounts to be received by BIOGEN and shall not be reduced
       in any way, including but


                                       12
<PAGE>
       not limited to, withholding taxes and reduction by any liabilities
       incurred by Tanox or its SUBLICENSEES or DISTRIBUTOR(S) on Tanox's behalf
       (but not on Biogen's behalf) upon remittance to BIOGEN of the payments
       due hereunder, provided, however, that if required, Tanox shall be
       allowed to withhold taxes incurred by Biogen.

3.9    All payments made to either party hereunder shall be paid in U.S.
       Dollars. Monetary conversion from the currency of a foreign country into
       U.S. currency shall be made at the exchange rate in force on the last
       business day of the quarter in which the payment obligations were
       incurred as reported in The Wall Street Journal, or on such other basis
       as mutually agreed upon by both parties. Any amounts due under this
       Agreement that are not paid when due shall bear interest at the lesser of
       (i) *.

3.10   The obligation to pay royalties shall continue on a country-by-country
       basis from the date of first sale of LICENSED PRODUCT in that country
       until the later of (i) twelve (12) years from the date of FIRST
       COMMERCIAL SALE of such LICENSED PRODUCT in that country or (ii) the date
       on which the manufacture, use, sale, offer for sale or import of LICENSED
       PRODUCT is no longer covered by a VALID CLAIM of any PATENT in such
       country or in the country of manufacture.

4.   THE TANOX INTERFERON PROGRAM

As further consideration for the exclusive rights granted to Tanox hereunder,
Tanox agrees that it shall provide a written submission to Biogen of all IN VIVO
data using one or more Tanox interferon-Fc fusion proteins that demonstrate
"proof of concept" (such data to include, but not limited to, an animal model of
cancer or EAE). In furtherance thereof,


                                       13
<PAGE>
Tanox hereby grants to Biogen an exclusive option to obtain an exclusive,
worldwide license of Tanox's interferon-fusion proteins at commercially
reasonable terms and conditions, including royalties. Upon receipt of the Tanox
"proof of concept" submission, a 180 day period (the "Option Period") shall
commence within which Tanox and Biogen shall enter into good faith negotiations
for the exclusive license described in the previous sentence. If Tanox and
Biogen cannot mutually agree on terms of such a license during the Option
Period, then Tanox shall be free to license or otherwise transfer its rights in
any of its interferon-fusion proteins to a third party, provided that for a
period of 180 days after the end of the Option Period, Tanox shall not offer any
such third party terms for a license for an interferon-fusion protein that are
materially different from those last offered to Biogen, without first offering
such different terms to Biogen.

5. PATENT PROSECUTION AND LITIGATION

5.1    Biogen shall be solely responsible for prosecution and maintenance of the
       PATENTS. Tanox shall bear the cost of all matters relating to the
       maintenance and prosecution of the PATENTS, such costs to be creditable
       against any payments due Biogen. Biogen shall promptly notify Tanox of
       all information received by Biogen relating to the prosecution and
       maintenance of PATENTS, including, without limitation, any lapse,
       revocation, surrender, invalidation or abandonment of any of the PATENTS.

         Biogen may, in its sole discretion, decide to refrain from, or cease to
       prosecute, or maintain any of the PATENTS. In such an event, Biogen shall
       notify Tanox promptly and in sufficient time to permit Tanox at its sole
       discretion to continue such prosecution or maintenance at Tanox's
       expense. If Tanox elects to continue such prosecution or maintenance,
       Biogen shall execute such documents and perform such acts at Biogen's
       expense as may be reasonably necessary for Tanox to so continue such
       prosecution or maintenance.


                                       14
<PAGE>
5.2    In the event either party or its AFFILIATES, DISTRIBUTORS (or Tanox's
       SUBLICENSEES) becomes aware of any actual or probable infringement of a
       PATENT claim licensed to Tanox under this Agreement, it shall notify the
       other party in writing of the details to the extent known of such
       infringement. Tanox, in its sole discretion and at its sole expense, may
       take action against any alleged infringer but would be required to take
       such action in the name of Biogen, if legally permissible, and if Biogen
       consents thereto. In determining whether to bring an action to enforce
       any such PATENT, Tanox shall act in a commercially reasonable manner,
       giving due consideration to the threat represented by the infringement
       and the potential risk to the PATENT involved. In the event Tanox
       declines within six (6) months of notification of such infringement to
       either (i) cause infringement to cease such as, for example, by
       settlement, or (ii) initiate legal proceedings against the infringer.
       Biogen may, but is not obligated to (upon notice to Tanox) initiate legal
       proceedings against the infringer, at Biogen's expense and in its own
       name. Biogen, under the circumstances of the previous sentence, is not
       obligated to initiate proceedings against more than one infringer at a
       time.

5.3    In the event either Tanox or Biogen shall initiate or carry out legal
       proceedings to enforce any of the PATENTS licensed under this Agreement
       against an alleged infringer, the party not initiating or carrying out
       such proceedings shall fully cooperate with, and supply all reasonable
       assistance requested by, the other party. Except as described hereunder,
       any party that institutes any suit to protect or enforce any such PATENTS
       shall have control of that suit and shall bear the reasonable expenses
       incurred by the non-initiating party in providing such assistance and
       cooperation as is requested pursuant to this Article.

5.4    Any recovery obtained by Tanox as the result of legal proceedings
       initiated and paid for by Tanox to enforce any of the PATENTS licensed
       under this Agreement against an


                                       15
<PAGE>
       alleged infringer, whether obtained by settlement or otherwise, shall
       (after reimbursement of all otherwise unreimbursed legal fees and
       expenses incurred by either Tanox or Biogen) be paid 100% to Tanox, and
       such recovery obtained by Tanox shall be treated as NET SALES so that
       Tanox shall pay a royalty to Biogen commensurate with the recovery as
       specified under Article 3.2. Any recovery obtained by Biogen as the
       result of legal proceedings initiated and paid for by Biogen to enforce
       such PATENTS against an alleged infringer, whether obtained by settlement
       or otherwise, shall (after reimbursement of all otherwise unreimbursed
       legal fees and expenses incurred by either Biogen or Tanox) be paid 100%
       to Biogen.

6. INDEMNIFICATION

6.1    Tanox and its AFFILIATES and its SUBLICENSEES assume all risk of damage
       or injury to persons or property arising out of the clinical testing,
       manufacture, use, marketing, promotion, distribution, or sale of LICENSED
       PRODUCT(S). Tanox shall hold harmless and indemnify Biogen, its officers,
       directors, agents, shareholders and employees (the "Biogen Indemnitees")
       from and against any and all liabilities, damages, losses, costs and
       expense incurred or imposed upon Biogen Indemnitees or any one of them in
       connection with any claims, suits, actions, demands, proceedings, causes
       of action or judgments resulting from arising out of: (i) the
       development, design, preclinical or clinical testing, manufacture, use,
       marketing, promotion, distribution or sale of the LICENSED PRODUCT(S) by
       Tanox or any of its AFFILIATES, SUBLICENSEES or DISTRIBUTOR(S) or any of
       their respective agents or employees; (ii) any other activities carried
       out by Tanox or any of its AFFILIATES, SUBLICENSEES or DISTRIBUTOR(S) or
       any of their respective agents or employees, including failure to comply
       with applicable law.

   Biogen shall give prompt notice to Tanox of any claim that may be subject to
indemnification upon Biogen's receipt of notice to such claim, and Tanox shall


                                       16
<PAGE>
assume the defense thereof, including the employment of counsel reasonably
satisfactory to Biogen, provided, however, that Tanox shall act reasonably and
in good faith with respect to all matters related to settlement or disposition
of any claim as the settlement or disposition thereof relates to Biogen, and
further provided that Tanox shall not settle or otherwise dispose of any claim
without prior written notice to Biogen. Biogen shall have the right to employ
separate counsel in any such action and to participate in the defense thereof,
but the fees and expenses in this situation shall be Biogen's.

6.2    Following the FIRST COMMERCIAL SALE, Tanox shall purchase and maintain in
       effect, and require its AFFILIATES and SUBLICENSES to purchase and
       maintain in effect, a policy of product liability insurance in the amount
       of at least $10 million dollars (combined single limit) covering all
       claims with respect to any LICENSED PRODUCT used, made, sold, imported,
       licensed or otherwise distributed by Tanox or any of its AFFILIATES,
       DISTRIBUTOR(S) or SUBLICENSES within the term of this Agreement. Each
       policy obtained under this Article shall specify Biogen as an additional
       insured and Tanox shall furnish to Biogen upon Biogen's request, a
       certificate evidencing such insurance.

7.     REPRESENTATIONS, WARRANTIES AND LIABILITY

7.1    BIOGEN warrants that it owns title to the PATENTS listed in Appendix A
       and the TECHNOLOGY and has the right to enter into this Agreement. BIOGEN
       MAKES NO REPRESENTATION OR WARRANTY AS TO THE VALIDITY OF THE PATENTS.

7.2    BIOGEN MAKES NO REPRESENTATION OR WARRANTY THAT THE MANUFACTURE, USE,
       IMPORTATION OR SALE OF LICENSED PRODUCTS BY TANOX OR ITS SUBLICENSEES OR
       THEIR CUSTOMERS WILL NOT CONSTITUTE AN INFRINGEMENT OF THE INTELLECTUAL
       PROPERTY RIGHTS OF OTHERS.


                                       17
<PAGE>
7.3    BIOGEN MAKES NO REPRESENTATIONS, EXTENDS NO WARRANTIES OF ANY KIND,
       EITHER EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE IMPLIED
       WARRANTIES OF MERCHANT ABILITY OR FITNESS FOR A PARTICULAR PURPOSE, AND
       ASSUMES NO RESPONSIBILITY WHATEVER WITH RESPECT TO DESIGN, DEVELOPMENT,
       MANUFACTURE, USE, SALE, IMPORTATION OR OTHER DISPOSITION OF LICENSED
       PRODUCT BY TANOX OR ITS AFFILIATES, SUBLICENSEES OR DISTRIBUTOR(S) TO
       THEIR RESPECTIVE CUSTOMERS.

7.4    The entire risk as to performance of LICENSED PRODUCTS is assumed by
       Tanox and its AFFILIATES, DISTRIBUTOR(S) and SUBLICENSEES. Except as set
       forth under Article 6, in no event shall either party be responsible or
       liable to the other, its AFFILIATES or DISTRIBUTOR(S) (or Tanox's
       SUBLICENSEES), end users (or any other individual or entity regardless of
       legal theory), for any DIRECT, INDIRECT, SPECIAL, INCIDENTAL OR
       CONSEQUENTIAL DAMAGES OR LOST REVENUES OR PROFITS arising out of this
       Agreement. The provisions of this Article 7.4 shall apply even though a
       party may have been advised of the possibility of such damage.

7.5    Tanox covenants and agrees that in conducting activities contemplated
       under this Agreement, it shall comply with all applicable laws and
       regulations including those related to the manufacture, use, labeling,
       importation and marketing of LICENSED PRODUCT.


                                       18

<PAGE>
7.6    Tanox shall make no statements, representations or warranties or accept
       any liabilities or responsibilities to, or with regard to any person or
       entity, which are inconsistent with any disclaimer or provisions of this
       Article 7 and Tanox shall take reasonable steps to ensure that its
       AFFILIATES and its SUBLICENSEES do not do so.

7.7    Tanox and Biogen agree that, except for the obligations contained within
       this Agreement, there are no other express and/or implied obligations on
       either party that can be created by the activities contemplated
       hereunder.

8.     CONFIDENTIALITY

8.1    During the term of this Agreement, and for a period of seven (7) years
       after termination, Biogen and Tanox shall treat all confidential
       information (including confidential TECHNOLOGY) received from the other
       hereunder as the exclusive property of the disclosing party and each
       party agrees not to use or disclose to any third party any such
       information, except as permitted hereunder, without first obtaining the
       disclosing party's written consent. Each party further agrees to take all
       practicable steps to ensure that any such information shall not be used
       by its directors, officers, employees, or agents and that it shall be
       kept fully private and confidential by them.

8.2    The above provision of confidentiality shall not apply to that part of
       such information which a receiving party is clearly able to demonstrate:

   (a)   was fully in its possession prior to receipt from the other; or

   (b)   was in the public domain at the time of receipt from the other; or

   (c)   became part of the public domain through no fault of the party
         receiving such information, its director, officers or employees;

   (d)   was lawfully received without obligations of confidentiality or non-use
         from some third party having a right of further disclosure; or

   (e)   other than information submitted pursuant to obtaining regulatory
         approval for LICENSED PRODUCT, is required to be disclosed by law or
         applicable government or European Community regulations; provided,
         however, that the disclosing party is given prior written notice of
         such required disclosure and afforded an opportunity to participate in
         drafting a protective order or otherwise limiting the disclosure to the
         extent possible.


                                       19
<PAGE>
9.     COMMERCIALIZATION

9.1    Tanox undertakes to use reasonable commercial efforts to diligently
       develop and market LICENSED PRODUCT in the major market countries for the
       LICENSED PRODUCT in the TERRITORY and, with Biogen's reasonable
       assistance, to diligently obtain regulatory approval for LICENSED PRODUCT
       in the major market countries for the LICENSED PRODUCT in the TERRITORY.
       Tanox shall provide Biogen with summaries of such efforts, including the
       clinical development status of LICENSED PRODUCTS in the FIELD, before
       January 1 of each calendar year and shall provide Biogen with notice of
       the date Tanox and/or its SUBLICENSEES makes the FIRST COMMERCIAL SALE of
       LICENSED PRODUCT. For the purposes of this Article 9.1, "reasonable
       commercial efforts" means the usual practice followed by a
       biopharmaceutical company in pursuing commercialization of its products.

9.2    Tanox shall take reasonable steps to ensure the compliance of its
       SUBLICENSEES with all applicable laws and regulations, including, without
       limitation any labeling requirements relating to the sale of LICENSED
       PRODUCT by the SUBLICENSEES.

10.   PUBLICITY


                                       20
<PAGE>
10.1   Neither Tanox nor its AFFILIATES nor its SUBLICENSEES shall make any use
       of the name of Biogen in connection with the exercise of its rights
       hereunder (including in any advertising, promotional or sales
       literature), without the prior written consent of Biogen, except as
       required by law or regulation. Upon request, Tanox or its AFFILIATES or
       its SUBLICENSEES shall ensure that LICENSED PRODUCT will be labeled "sold
       under license" from Biogen.

10.2   Any initial announcements or similar publicity with respect to this
       Agreement shall be at such time and in such manner and such form as
       Biogen and Tanox shall mutually agree. Thereafter, either party may
       subsequently publicize the terms and subject matter of this Agreement in
       its sole discretion as long as the content of subsequent disclosures is
       consistent with the approved form. To the extent that any such
       publication or the terms and subject matter of this Agreement is
       inconsistent with the agreed announcement AND/or includes additional
       disclosure relating thereto, the party submitting any such subsequent
       announcement or similar publicity shall first send it to the other party
       for review. The other party agrees to review and return such announcement
       or similar publicity to the sending party within 24 hours of receipt.

11.    PATENT EXTENSIONS

11.1   Subject to the applicable governmental laws and regulations in the
       TERRITORY regarding extension of patent terms, Tanox and its SUBLICENSEES
       shall cooperate fully with Biogen in providing Biogen, at Biogen's
       request, all facts and documentation which may assist Biogen in its
       procurement of term extension for the PATENTS. Biogen shall be
       responsible for, and shall bear the expense, of obtaining such patent
       term extension as to patent rights encompassing LICENSED PRODUCT.


                                       21
<PAGE>
11.2   Upon termination of this Agreement by Biogen pursuant to Article 12.2,
       information related to government approvals for LICENSED PRODUCT and
       safety, efficacy, and toxicity studies of the LICENSED PRODUCT (provided
       that the above is accessible to Tanox and/or its SUBLICENSEES in the
       TERRITORY) shall be shared by Tanox and/or its SUBLICENSEES with Biogen
       and such information may be transmitted to a governmental agency for use
       by Biogen if necessary.

12.    TERM AND TERMINATION

12.1   This Agreement shall commence on the Effective Date and shall continue
       until Tanox's obligation to pay royalties pursuant to Article 3
       terminates.

12.2   If the parties agree that this Agreement has been breached as to a
       material covenant, undertaking, representation or obligation and that the
       allegedly breaching party has not pursued steps to correct or cure such
       breach within sixty (60) days of notification from the other party, or if
       a court of competent jurisdiction so determines in a decision that is
       unappealable or unappealed within the time allowed for appeal, or if the
       decision is affirmed on appeal, by the highest court with jurisdiction,
       then the non-breaching party shall have the right, by notice in writing,
       to terminate this Agreement. A party shall also have the right to
       terminate this Agreement in the event that the other party shall enter
       into any arrangement or composition with its creditors, or enter or be
       put into voluntary or compulsory liquidation or bankruptcy (except for
       the purpose of any reorganization reasonably acceptable to the other
       party), or have its business enjoined into receivership by executive or
       judicial authorities.

12.3   Tanox shall have the right to terminate this Agreement on thirty (30)
       days written notice to Biogen, provided that Tanox supplies to Biogen
       within 180 days of termination hereunder, and sooner if feasible, all
       preclinical, clinical and other data reasonably related to Biogen's


                                       22
<PAGE>
       relicensing of the LICENSED PRODUCT as well as a royalty-free,
       nonexclusive license to any Tanox-owned patents necessary to make, use,
       or sell the LICENSED PRODUCT. Any termination under this Article 12 shall
       be without prejudice to the rights of either party against the other then
       accruing or otherwise accrued under the Agreement.

12.4   Expiration of this Agreement pursuant to Article 12.1 shall result in the
       exclusive license to Tanox under Article 2.1 being converted to a
       non-exclusive and cost and royalty-free license. Both expiration of the
       Agreement under Article 12.1 and termination of this Agreement by either
       party pursuant to Articles 12.2 and 12.3 shall terminate all outstanding
       obligations and liabilities between Biogen and Tanox arising from this
       Agreement except:

       (a)  obligations to pay royalties and other sums accruing hereunder up to
            the day of such termination or expiration;

       (b)  obligations for record keeping and accounting reports for so long as
            LICENSED PRODUCT is sold pursuant to this Agreement up to the date
            of termination or expiration. Tanox shall render a final report
            along with any royalty payment at such time after termination or
            expiration of this Agreement;

       (c)  Biogen's right to inspect books and records up to the date of
            termination or expiration as in Article 3.7;

       (d)  obligations of defense and indemnity under Article 6;

       (e)  any cause of action or claim of Tanox or Biogen accrued as of the
            date of termination or expiration because of any breach or default
            by the other party hereunder;

       (f)  the confidentiality provisions of Article 8;

       (g)  the disclosure obligations of Article 11.2, as applicable.

       (h)  all other terms, provisions, representations, rights and obligations
            contained in this Agreement that by their sense and context are
            intended to survive until performance thereof by either or both
            parties; and

       (i)  the right to complete the manufacture and sale of LICENSED PRODUCTS
            which qualify as "work in progress" under generally accepted cost
            accounting standards or which are in stock at the date of
            termination, and the obligation to pay royalties on NET SALES of
            such LICENSED PRODUCTS.


                                       23
<PAGE>
13.    NOTICES

13.1   Any notice required or permitted to be given hereunder shall be sent in
       writing by registered or certified airmail, postage prepaid, return
       receipt requested, or by telecopier, air courier or hand delivery,
       addressed to the party to whom it is to be given as follows:

   If to BIOGEN:   Biogen, Inc.
                   14 Cambridge Center
                   Cambridge, MA 02142
                   Telephone (617) 679-2000; Fax (617) 679-2838
                   Attention: Vice President-General Counsel
   If to TANOX:
                   Tanox Biosystems, Inc.
                   10301 Stella Link
                   Houston, TX 77025
                   Telephone: (713) 664-2288; Fax: (713) 664-8914
                   Attention: Nancy T. Chang, Ph.D., President
                   and CEO

   or to such other address or addresses as may from time to time be given in
   writing by either party to the other pursuant to the terms hereof.


                                       24
<PAGE>
13.2   Any notice sent pursuant to this Article shall be deemed delivered within
       five (5) days if sent by registered or certified airmail and within
       twenty-four (24) hours if sent by telecopier, air courier or hand
       delivery.

14.    EXPORT LAWS AND REGULATIONS OF THE UNITED STATES
      The Export regulations of the United States Department of Commerce
prohibit the exportation from the United States of certain types of technical
data and commodities unless the exporter (i.e., Tanox, AFFILIATES,
DISTRIBUTOR(S) or the SUBLICENSEES) has received the required license. In
addition, the exporter may be required to obtain certain written assurances
regarding re-export from the foreign importer for certain types of technical
data and commodities. Tanox agrees to comply with (and shall take reasonable
steps to ensure the compliance of its AFFILIATES, DISTRIBUTOR(S) and its
SUBLICENSEES with) the Export Administration Regulations of the United States
Department of Commerce.

15.    MISCELLANEOUS

15.1   ENTIRE AGREEMENT:

       This Agreement constitutes the entire understanding between the parties
with respect to the subject matter between the parties with respect to the
subject matter hereof, and supersedes and replaces all prior agreements,
understandings, writings and discussions between parties relating to said
subject matter.

15.2  AMENDMENTS: WAIVERS:
      This Agreement may be amended and any of its terms or conditions may be
waived only by a written instrument executed by both parties, or, in the case of
a waiver, by the party waiving compliance. The failure of either party at any
time to require performance of any provision hereof shall in no manner affect
its rights a later time to enforce the same. No waiver by either party of any
condition or term in any instance shall be construed as a further or continuing
waiver of such condition or term or of another condition or term.

                                       25
<PAGE>
15.3  NO AGENCY:
      The relationship between Tanox and Biogen is that of independent
contractor. Nothing herein shall be deemed to constitute Tanox, on the one hand,
or Biogen, on the other hand, as the agent or representative of the other, or as
master and servant, employer and employee, joint venturers or partners for any
purpose.

15.4  ASSIGNMENT:
      This Agreement shall not be assigned by Tanox without the prior written
consent of Biogen, except to an AFFILIATE or a successor Tanox's entire
business. This Agreement shall be binding upon and inure to the benefit of and
be enforceable by the parties hereto and their respective successors and
permitted assigns.

15.5  LAW OF THE CONTRACT:
      This Agreement shall be governed by and construed and interpreted in
accordance with the law of the Commonwealth of Massachusetts.

15.6  SEVERABILITY:
      In the event one or more provisions of this Agreement should for any
reason be held by any court or authority having applicable jurisdiction to be
invalid, illegal or unenforceable, such provision(s) shall either be reformed to
comply with applicable law or stricken if not so conformable, so as not to
affect the validity or enforceability of the remainder of this Agreement.

                                       26
<PAGE>
15.7  AGREEMENT TO PERFORM NECESSARY ACTS:
      Each party agrees to perform further acts and execute and deliver any and
all further documents, agreements, and/or instruments which may be reasonable to
carry out or effect the provisions of this Agreement.

15.8  COUNTERPARTS:
      This Agreement may be executed in counterparts, and each such counterpart
shall be deemed an original for all purposes.

   IN WITNESS WHEREOF, the parties hereto have caused this Agreement to be
executed by their duly authorized officers on the date and year first above
written.



BIOGEN, INC.                              TANOX BIOSYSTEMS, INC.

By: /s/ MICHAEL J. ASTRUE                 By: /s/ NANCY T. CHANG, Ph.D.

Name: Michael J. Astrue                   Name: Nancy T. Chang, Ph.D.

Title: Vice President-General Counsel     Title: President and CEO

Date: June 18, 1998                       Date: June 23, 1998



                                       27
<PAGE>
                                   APPENDIX A
<TABLE>
<CAPTION>
<S>             <C>
COUNTRY          NUMBER          FILED       ISSUED #      EXPIRES       BIOGEN NO.

Australia          *            11/27/91      662891      11/27/011          *

Canada             *            11/27/91        --           --              *

EPO*            92903295.1      11/27/91      512112       11/27/011         *

Japan              *            11/27/91        --           --              *

United          07/916,098      11/27/91        --                           *
States           to issue
Q2  1998

</TABLE>

   *Austria, Belgium, Switzerland, Germany, Denmark, Spain, France, Great
Britain, Greece, Italy, Liechtenstein, Luxembourg, Netherlands, Sweden


                                       28
<PAGE>
                                   APPENDIX B

   The following are patents and patent applications defined as PROTEIN DESIGN
LABS PATENTS and shall expressly include any United States continuations,
continuations-in-part or divisions thereof or any substitute applications
therefor; or foreign counterparts thereof, any patents issued with respect to
such patent applications, any reexaminations, reissues, extensions or patent
term extensions of any such patents.

   1. United States Patent Numbers 5,585,089, 5,693,761, 5,693,762, and U.S.
patent divisional application numbers 08/477,728, 08/474,040 and 08/487,200 of
issued United States Patent No. 5,530,101.

   2. European Patent 0451216

   3. Japanese Patent application No. 4-503758


                                       29
<PAGE>
                                   APPENDIX C

                       TECHNOLOGY TO BE PROVIDED BY BIOGEN

      1. Purified murine antibody 5A8 (10mg) and its complete characterization
information, including:

         a. effect of 5A8 on immune functions;

         b. effect of 5A8 on apoptosis of CD4 T lymphocytes; and

         c. neutralization data on HIV-1 primary isolates.

      2. Purified humanized 5A8 (10mg) and its complete characterization
information, including:

         a. molecular design of the humanized version;

         b. procedures of testing and selecting the humanized version; and

         c. neutralization data on HIV-1 primary isolates.

      3. Purified humanized or human IgG4 irrelevant control (10mg).

      4. Purified recombinant soluble CD4 (5mg).

      5. Purified recombinant HIV-1 gp120 (5mg).

      6. Sera from monkeys immunized with humanized 5A8 for anti-id response
studies.

      7. Cell lines:

         a. murine hybridoma producing 5A8; and

         b. production cell line for humanized 5A8.

                                       30
<PAGE>
      8. Plasmids containing the antibody genes of humanized 5A8 and complete
information on their construction.

      9. Production medium for humanized 5A8 (powder, 20 liters).

      10. Preclinical data:

         a. data on the analysis of anti-id response in monkeys immunized with
humanized 5A8;

         b. complete reports for all toxicology studies (monkeys and rodents)
and any other pre-clinical safety studies performed;

         c. complete report for human tissue cross-reactivity; and

         d. complete reports of all pharmacology studies.

      11. Process descriptions and manufacturing batch records:

         a. cell blank preparation and characterization;

         b. cell line testing reports;

         c. cell culture process (culture medium formulation and preparation,
and cell growth conditions);

         d. recovery downstream process (buffer compositions and purification
methodologies);

         e. formulation of the final product and stability studies;

         f. filling and vialing; and

         g. release testing specifications and testing protocols.

                                       31
<PAGE>
FAX TRANSMISSION

To:    Dr. Linda Burkly
       Biogen, Inc.

Date:  December 11, 1996

From:  Keith A. Reimann
       Division of Viral Pathogenesis
       Department of Medicine
       Beth Israel Hospital - RE-113
       330 Brookline Avenue
       Boston, MA 02215

       Phone-       617-667-4583
       Fax          617-667-8210
       E-mail       [email protected]

Re:    Hu5A8 IN VIVO summary

Attached is the experimental protocol and two figures showing data to date. In
one monkey we get an 80% reduction in viral load; in the other >95% reduction.
In the monkey with the greatest reduction in viral load, we saw a substantial
increase in CD4 count (don't know what this means since we ALWAYS see CD4
increases....even in uninfecteds).

With AZT monotherapy there is usually less than 1 log decrease in HIV RNA. With
protease inhibitor monotherapy there is about 1-2 log decrease. Based on these
data, I think we're in the ball park of efficacy as compared with conventional
anti-retrovirals. We have additional specimens as the indicated time points that
have NOT been analyzed for RNA.

Let me know what you think.

Keith

<PAGE>
HUMANIZED 5A8 (HU5A8) THERAPEUTIC EFFECT, EXPERIMENT 3.

EXPERIMENTAL PROTOCOL

OBJECTIVE

These studies are a pilot experiment to assess the antiviral activity of hu5A8
in a chronic SIVmac infection model. Two SIVmac-infected rhesus monkeys will be
treated four times with hu5A8 (3 mg/kg) I.V. over 10 days and changes in plasma
viral RNA levels will be assessed.

ANTIBODY

Humanized 5A8.3 - Lot 2927 1.20.1993
6.6 mg/ml

ANIMAL PAIR 2:

Mm 74-84 (SIVmac infected on May 28, 1996)
Mm 67-85 (SIVmac infected on May 28, 1996)

Sampling time points:

         TIME                         DATE        PLASMA        CBC/PHENOTYPING
         -----------------------    ---------    ---------    ------------------
         Day  -8                     04 Nov          X                 X
   o     Day  -4                     08 Nov          X                 X

   o     Day  0; pre                 12 Nov          X                 X
         Day  0; 10-15 min post      12 Nov          X                 X

   o     Day  2; pre                 14 Nov          X                 X
         Day  2; 10-15 min post      14 Nov          X                 X

   o     Day  6; pre                 18 Nov          X                 X
         Day  6; 10-15 min post      18 Nov          X                 X

         Day 10; pre                 22 Nov          X                 X
         Day 10; 10-15 min post      22 Nov          X                 X

   o     Day 13                      25 Nov          X                 X
         Day 20                      02 Dec          X                 X

         Day 27                      09 Dec          X                 X
         Day 41                      23 Dec          X                 X
<PAGE>
HUMANIZED 5A8 (HU5A8) THERAPEUTIC EFFECT, EXPERIMENT 3.

TREATMENT NOTES

Day  -8            04 Nov  Weights:
                           Mm 174-84  10.6 kg
                           Mm 167-85  10.6 kg

Day  -4            08 Nov  Dosage calculation:  10.6 kg x 3mg/kg = 31.8 mg
                                                 31.8mg/6.6mg/mi = 4.8 mi
                           Mm 174-84  10.6 kg
                           Mm 167-85  10.5 kg

Day  0             12 Nov  Antibody given

Day  2             14 Nov  Antibody given

Day  6             18 Nov  Antibody given

Day 10             22 Nov  Antibody given
<PAGE>
                                     [INSERT GRAPH HERE]

                                     [INSERT GRAPH HERE]

FIG 11 - Hu5A8 dramatically decreases viral RNA and increases CD4 cells in
SIVmac-infected monkeys. Two rhesus monkeys received 3 mg/kg injections of hu5A8
as indicated by arrows. CD4 cells in blood were measured (A) and viral RNA was
quantitated by bDNA assay (B).
<PAGE>
HUMANIZED 5A8 (hu5A8) THERAPEUTIC EFFECT, EXPERIMENT 3.

SPECIMENS COLLECTED/ANALYSES PERFORMED

Plasma --      EDTA plasma will be collected within 4 hours of draw. One aliquot
               of 1 mL (accurately measured) for viral RNA measurement will be
               stored at -70 C. Any remaining plasma will be stored at -70 C as
               well.

               It is important that plasma be completely separated from cells
               and that it is quickly stored at -70 C. Thawing and refreezing
               should be avoided.

CBC --         A complete blood count with automated partial differential will
               be performed on a Coulter T540 analyzer.

Phenotype --   PBL will be phenotyped using the following antibody combinations:

                  anti-human IgG4-FITC (coating)*
                  CD3/CD4
                  CD3/CD8

                   *anti-human IgG4 will be used starting on Day 0.

SIV RNA --     Viral RNA is plasma will be measured by Chiron Diagnostics using
               a branched-chain DNA assay modified to detect SIV gag RNA.

<PAGE>
AIDS RESEARCH AND HUMAN RETROVIRUSES
Volume 13, Number 11, 1997
Mary Ann Liebert, Inc.

A HUMANIZED FORM OF A CD4-SPECIFIC MONOCLONAL ANTIBODY EXHIBITS
DECREASED ANTIGENICITY AND PROLONGED PLASMA HALF-LIFE IN RHESUS MONKEYS
WHILE RETAINING ITS UNIQUE BIOLOGICAL AND ANTIVIRAL PROPERTIES

KEITH A. REIMANN(1), WENYU LIN(1), SARAH BIXLER(2), BETH BROWNING(2), BARBARA N.
EHRENFELS(2), JODIE LUCCI(2), KONRAD MIATKOWSKI(2), DIAN OLSON(2), THOMAS H.
PARISH(2), MARGARET D. ROSA(2), FREDERICK B. OLESON(2), YEN MING HSU(2), EDUARDO
A. PADLAN(3), NORMAN L. LETVIN(1), and LINDA C. BURKLY(2)


ABSTRACT

Certain monoclonal antibodies (MAbs) directed against CD4 can efficiently block
HIV-1 replication IN VITRO. To explore CD4-directed passive immunotherapy for
prevention or treatment of AIDS virus infection, we previously examined the
biological activity of a nondepleting CD4- specific murine MAb, mu5A8. This MAb,
specific for domain 2 of CD4, blocks HIV-1 replication at a post-gp120-CD4
binding step. When administered to normal rhesus monkeys, all CD4+ target cells
were coated with antibody, yet no cell clearance or measurable immunosuppression
occurred. However, strong anti-mouse Ig responses rapidly developed in all
monkeys. In the present study, we report a successfully humanized form of mu5A8
(hu5A8) that retains binding to both human and monkey CD4 and anti-AIDS virus
activity. When administered intravenously to normal rhesus monkeys, hu5A8 bound
to all target CD4+ cells without depletion and showed a significantly longer
plasma half-life than mu5A8. Nevertheless, an anti-hu5A8 response directed
predominantly against V region determinants did eventually appear within 2 to 4
weeks in most animals. However, when hu5A8 was administered to rhesus monkeys
chronically infected with the simian immunodeficiency virus of macaques,
anti-hu5A8 antibodies were not detected. Repeated administration of hu5A8 in
these animals resulted in sustained plasma levels and CD4+ cell coating with
humanized antibody for 6 weeks. These studies demonstrate the feasibility of
chronic administration of CD4-specific MAb as a potential means of treating or
preventing HIV-1 infection.

                                  INTRODUCTION

THE CD4 MOLECULE IS a high-affinity receptor for the envelope glycoprotein of
human immunodeficiency virus type 1 (HIV-1) and is, therefore, a potential
target for the prevention or treatment of AIDS(1). Certain CD4-specific
monoclonal antibodies (MAbs) can effectively block HIV-1-induced syncytium
formation and infection of lymphocytes and macrophages IN VITRO with extreme
efficiency(2-4), suggesting that CD4-directed MAb may have utility as an AIDS
therapy. We have studied extensively one such MAb, mu5A8, that binds similarly
to human and rhesus monkey CD4(5). This antibody maps to domain 2 of CD4 and
efficiently inhibits HIV-1 replication and virus- induced cell fusion acting at
a post-CD4-gp120 binding step(6,7). The IN VITRO antiviral activity of

<PAGE>
mu5A8 is similar when tested against the related virus, simian immunodeficiency
virus of macaques (SIVmac)(5).

   Previously we have shown that this MAb binds to all target CD4+ lymphocytes
without inducing cell clearance when administered intravenously to rhesus
monkeys.5 In fact, there is a transient increase in circulating CD4+ cells
following administration of the MAb. However, in normal rhesus monkeys, a strong
anti-mouse immunoglobulin response developed soon after administration that
blocked the mu5A8-CD4 binding, induced rapid plasma clearance, and, thus,
precluded its further use.

   In an effort to reduce the antigenicity of this MAb, we have developed a
"humanized" form of the mu5A8 MAb (hu5A8). Here we show that hu5A8 retains the
biological activity of the murine MAb, including similar binding to human and
nonhuman primate CD4 and potent antiviral activity against HIV-1 and SIVmac.
This humanized antibody, however, has a significantly longer plasma half-life
than the murine form and plasma levels could be maintained in normal rhesus
monkeys for more than 2 weeks. Although the immune response against hu5A8 was
reduced, a response eventually developed that was directed entirely against the
murine V region determinants. Interestingly, anti-hu5A8 responses were not
detected when hu5A8 was administered for 6 weeks to monkeys chronically infected
with the immunosuppressive virus SIVmac. These studies indicate that alteration
of MAbs to decrease their antigenicity can positively affect the
pharmacokinetics without altering the biological activity.

                              MATERIALS AND METHODS

CONSTRUCTION AND EXPRESSION OF hu5A8

   CLONING OF MURINE 5A8 HEAVY AND LIGHT CHAIN VARIABLE REGIONS. The mu5A8 heavy
chain variable (VH) region was amplified from genomic DNA of the murine
hybridoma cell line by polymerase chain reaction (PCR) using primers identical
in sequence to VH1BACK and VH1FOR as previously described(8), except that the
primer corresponding to VH1FOR lacked the two 3' nucleotides. The PCR
product was subcloned by blunt end ligation into a pUC vector and designated
pMDR904, and encodes amino acids 2-122 (AA(2)-AA(122)) of the 5A8 VH region. The
numbering system for immunoglobulin amino acids used throughout is that of Kabat
ET AL.(9) By comparison to known complementarity-determining regions (CDRs) and
framework (FR) sequences, the CDRs for the mu5A8 VH region are identified as
follows: CDR1 is AA(31)-AA(35), CDR2 is AA(50)-AA(66), and CDR3 is
AA(99)-AA(111). The mu5A8 light chain variable (V1) region was PCR amplified
from cDNA using primers ACE149 and ACE150, with cDNA first prepared from
poly(A)+ RNA of the murine hybridoma line by reverse transcription (RT) with the
same primers. The PCR fragment encoding AA1-AA(111) of the mu5A8 VL region was
subcloned by blunt end ligation into a pUC expression vector and designated
pMDR927. Mu5A8 VL CDRs are as follows: CDR1 is AA(24)-AA(40). CRD2 is
AA(56)-AA(62), and CDR3 is AA(95)-AA(102).

   HUMANIZATION OF THE 5A8 MONOCLONAL ANTIBODY. The amino acid sequences of
mu5A8 VH and VL regions were compared to the known human immunoglobulin
sequences to find the human FR sequences most closely matching the mu5A8 FR
sequences. Humanized versions were then

<PAGE>
designed by grafting the CDRs of the mu5A8 VH and VL sequences onto these human
FRs, MO30 and VJI, respectively.10,11 A small number of residues in the human
FR, which we believe will probably be critical to the three-dimensional
structure of the antibody combining site,12 were altered in order to match the
corresponding sequence of the mu5A8 FR. These hu5A8 VH and hu5A8 VL sequences
were then fused to genomic DNA encoding the human IgG4 constant region and the K
constant (CK) region, respectively. The 5A8 VH and VL regions were humanized by
synthesizing a series of oligonucleotides that would span the entire CDR-grafted
VH and VL sequences when ligated together. Eleven oligonucleotides (oligos) were
kinased, combined, and ligated to construct the VH region (oligos 312-120 to
312-131) and 12 oligos (312-132 to 312-143) were used to construct the VL region
with restriction sites contained in the flanking oligos to facilitate
subcloning. For the VH region, ligated oligos were digested with PSTI and BSTE
II and a 326-bp fragment subcloned into pLCB7, thereby substituting hu5A8 VH for
mu5A8 VH sequence, fusing the hu5A8 VH (at the PSTI site) 3' of a heavy chain
signal sequence and (at the BSTE II site) 5' of a splice site, generating
pMDR1032 and used to construct an hu5A8 VH expression vector. For the VL region,
ligated oligos were digested with ECORV and BGL II and a 330-bp fragment
isolated and subcloned into a pUC vector, generating pBAG176. After the sequence
was confirmed, the ECOR V-BGL II fragment encoding hu5A8 VL (AA1-AA112) was
isolated and used to construct an hu5A8 VL expression vector. Figure 1 shows the
deduced amino acid sequences from the hu5A8 VH and VL regions aligned with the
mu5A8 VH and VL sequences and the human antibody sequences with framework
regions that most closely match the murine sequences. The framework sequences of
hu5A8 VH and VL retained 12 and 5 murine-derived residues, respectively.

   CONSTRUCTION OF GLUTAMINE SYNTHETASE EXPRESSION VECTOR FOR THE hu5A8
MONOCLONAL ANTIBODY. A single expression vector containing separate
transcription units for the hu5A8 MAb heavy and light chains and carrying the
glutamine synthetase (GS) selection marker was constructed using the pEE6 and
pEE12 vectors developed and provided by CellTech Limited (Slough, UK).13 The
pEE6 and pEE12 vectors were each modified by insertion of a novel NOTI site into
the SMAI cloning site with NOTI linker pGCCGGCACT (New England Biolabs, Beverly,
MA) and designated pEE6.NOTI and pEE12.NOTI, respectively.

   The hu5A8 light-chain transcription unit was constructed by inserting a
1693-bp NOTI fragment encoding a K signal sequence fused to the hu5A8 VL and CK
regions into NOTI-linearized pEE12.NOTI, generating pMDR1042. This 1693-bp NOTI
insert was derived from pBAG177, which had been previously constructed by fusing
DNA containing the human K signal sequence (a 572-bp AatII-ECOR V fragment), the
hu5A8 VL (ECOR V-BGLII fragment of pBAG176), and the CK region (1276-bp
BCLI-AATII fragment) in 5' to 3' order, with NOTI sites flanking the K signal
and CK sequences. The K signal and CK sequences were in turn derived as follows.
A prototype signal sequence for the hu5A8 VL expression vector was constructed
by ligating oligos 360-81 and 360-82 followed by subcloning into a pUC vector,
generating pMDR985. AATII-ECOR V digestion of pMDR985 then released a DNA
fragment containing the K signal sequence. The CK region was cloned by PCR
amplification of a 2.5-kb ECORI fragment from human placental genomic DNA with
primers 370-54 and 370-55, with VK AA112 (lysine) and a splice site constructed
at the 5' end. The 1240-bp PCR fragment was subcloned into a pUC vector,
generating pSAB153, and further PCR amplified with primers 360-83 and 370-55 in
order to create a BCLI site at the 5' end upstream of VK AA112. The resultant
1276-bp PCR fragment was subcloned into a pUC vector (generating

<PAGE>
pMDR986) and DNA containing the CK region (AA108-AA214 according to Kabat amino
acid numbering) released by BCLI-AATII digestion.

   The hu5A8 heavy chain transcription unit was constructed in pEE6.NOTI by
ligating a NOTI- HINDIII fragment from pMDR1032 (encoding the H chain signal
sequence, hu5A8 VH region, and splice site) and a HINDIII-NOTI fragment encoding
the huIgG4 constant region together with NOTI- linearized pEE6.NOTI, thereby
generating pMDR1035. The human IgG4 constant region was previously cloned by PCR
amplification from human genomic placental DNA with primers 370-38 and 370-40,
the 2109-bp PCR fragment cloned by blunt ligation into a pUC vector (designated
pBAG101), and this construct further modified (pMDR1033) to remove BGLII and
BAMHI sites in the constant region sequence contained on a HINdIII-NOTI
fragment. To generate a GS vector carrying transcription units for both the
hu5A8 heavy and light chains, the BAMHI-BGLII fragment containing the H chain
transcription unit from pMDR1035 was inserted into the BAMHI site of pEE12.NOTI
carrying the hu5A8 L chain cassette, finally constructing pMDR1045.

     OLIGONUCLEOTIDES. Primers used for PCR amplification of the mu5A8 VH DNA
sequences were VHIBACK and VHIFOR, and for VL DNA sequences were ACE 149 and ACE
150. See Fig. 2 for sequences of primers used in this study.

   GENERATION OF HU5A8-PRODUCING CELL LINE. Plasmid DNA pMDR1045 containing
hu5A8 H and L chain sequences in the GS expression vector was linearized with
SALI and introduced into NS/0 murine myeloma cells(14) provided to Biogen
(Cambridge, MA) by CellTech Limited using the electroporation protocol of
Bebbington ET AL(13). Cells were routinely maintained in Iscove's modified
Dulbecco's medium (IMDM) (Sigma Chemical Company, St. Louis, MO) supplemented
with 10% heat-inactivated fetal bovine serum and 4 mM L-glutamine. After
transfection, cells capable of growth in glutamine-free IMDM selection medium
were selected. Clones were screened for hu5A8 production with an enzyme-linked
immunosorbent assay (ELISA) similar to that described below, detecting hu5A8 mAb
levels binding to recombinant soluble CD4 (rsCD4)-coated plates. Minor
differences were that plates were blocked with phosphate-buffered saline-1%
bovine serum albumin (BSA)-0.05% Tween 20, and 5A8 MAbs were detected with
rabbit anti-human IgG Fc (Jackson ImmunoResearch, West Grove, PA) followed by
horseradish peroxidase (HRP)-conjugated goat anti-rabbit immunoglobulin
(Bio-Rad, Hercules, CA), with each of these steps carried out for 1 hr at room
temperature. Tetramethylbenzidine (TMB) was added as substrate (420 MM), the
reaction stopped after dark blue color developed with the highest concentration
of standard and plates read at 450 mm. hu5A8 purified from medium after
transient expression in Cos7 cells was used as a standard. Positive clones were
selected and expanded for production, and hu5A8 was purified from culture
supernatant by protein A affinity chromatography. hu5A8 production by NS/0
transfectants achieved levels of at least 50 mg/liter.

   mu5A8 was produced and purified as described previously(6). Human IgG4 (TSI
Center for Diagnostic Products, Milford, MA) was used as a control antibody for
IN VIVO studies.

ANIMALS AND ANTIBODY ADMINISTRATION

<PAGE>
   The rhesus monkeys (MACACA MULATTA) used in this study were maintained in
accordance with the guidelines of the Committee on Animals for the Harvard
Medical School and the GUIDE FOR THE CARE AND USE OF LABORATORY ANIMALS.15 In
some experiments, monkeys were previously infected by intravenous inoculation
with uncloned simian immunodeficiency virus of macaques (SIVmac), strain 251,
which had been propagated in human peripheral blood mononuclear cells (PBMCs).

   Monkeys were administered either mu5A8, hu5A8, or a control human IgG4
diluted to 1-2 mg/ml in PBS by intravenous injection over approximately 1 min.
In experiments where hu5A8 was administered chronically, monkeys received
intravenous injections every 7 days. Monkeys were anesthetized with ketamine
hydrochloride for all procedures.

ANTIBODY BINDING TO HUMAN AND MONKEY CD4

   The binding of mu5A8 and hu5A8 to human CD4 was compared using the
CD4-expressing cell line, Jurkat (American Type Culture Collection, Rockville,
MD). Cells were incubated for 30 min at 37(degree)C with mu5A8 or hu5A8 that had
been serially diluted in PBS-0.5% BSA. Cells were washed and then stained with
either goat anti-mouse IgG or goat anti-human IgG antisera conjugated to
fluorescein isothiocyanate (FITC) and relative fluorescence determined on a flow
cytometer. To assess binding of these MAbs to rhesus monkey CD4, peripheral
blood lymphocytes (PBLs) from normal rhesus monkeys were isolated by
Ficoll-ditrizoate density gradient centrifugation, incubated with serially
diluted hu5A8 or mu5A8 as described previously, and stained with goat anti-human
or anti-mouse immunoglobulin. To permit gating on CD4+ monkey PBLs, cells were
stained with noncompeting CD4 domain 3-specific antibody conjugated to
phycoerythrin (OKT4-PE; Ortho Diagnostic Systems, Raritan, NJ).(6) However,
prior to staining with OKT4-PE, cells were incubated with mouse immunoglobulin
to saturate any unoccupied goat anti-mouse immunoglobulin binding sites that
could potentially bind OKT4-PE. Relative binding of hu5A8 and mu5A8 on CD4+ PBLs
was assessed flow cytometrically using the phycoerythrin channel to gate on CD4+
lymphocytes and the fluorescein channel to determine relative binding of
antibody. Data were expressed as a percentage of the maximum fluorescence
intensity measured.

INHIBITION OF HIV-1-INDUCED SYNCYTIUM FORMATION

   The antibodies mu5A8 and hu5A8 were tested for their ability to block
syncytium formation between HTLV-IIIB-infected H9 cells and uninfected C8166
cells using the procedure described previously.(6,16) Results were expressed as
percentage inhibition relative to the maximum number of syncytia per well in the
absence of monoclonal antibody.

INHIBITION OF SIVMAC REPLICATION in vitro

   The ability of mu5A8 and hu5A8 to suppress SIVmac replication in monkey
lymphocytes was tested using an IN VITRO viral outgrowth assay similar to that
previously described.5 Briefly, lymphocytes isolated from peripheral blood of
rhesus monkey chronically infected with SIVmac were depleted of CD8+ cells using
monoclonal antibody and immunomagnetic beads. CD8-depleted cultures were
activated with concanavalin A (5 Mg/ml) and cultured for 2 weeks in the presence
of varying concentrations of mu5A8, hu5A8, or an isotype-matched murine antibody
of irrelevant

<PAGE>
specificity. Virus replication in these cultures was determined by measuring
SIVmac p27 core antigen in culture supernatants using a commercial kit (SIV p27
core antigen kit; Coulter Corp., Miami, FL).

SERUM MONOCLONAL ANTIBODY LEVELS

   mu5A8 MAb levels in serum were measured as previously described.5 Serum
levels of hu5A8 were determined by coating microtiter plates with human
recombinant soluble CD4 at 5 Mg/ml in 0.5 M bicarbonate buffer (pH 9.0), 50
Ml/well overnight at 4(degree)C. Plates were washed with PBS, blocked with
PBS-2% nonfat dry milk for 2 hr at room temperature, washed again, and monkey
serum diluted in PBS-2% milk was added at 50 Ml/well for 2 to 3 hr at room
temperature. After washing, hu5A8 MAb levels were detected with HRP-conjugated
anti-human IgG4 at a 1:5000 dilution, 50 Ml/well, for 1 hr at room temperature.
After final washes, O-phenyldiamine substrate (OPD; Calbiochem, La Jolla, CA)
was added at 100 Ml/well for 20 min, the reaction stopped with 1 N H2SO4 (100
Ml/well), and absorbance read at 490 nm on a microplate reader. Data are
expressed as micrograms per milliliter using purified hu5A8 as a standard.

IMMUNOPHENOTYPING OF MONKEY PERIPHERAL BLOOD LYMPHOCYTES

   The absolute number of CD4+ lymphocytes in peripheral blood was determined
using human CD4-specific monoclonal antibodies, whole-blood lysis technique, and
routine flow cytometric analysis as described for immunophenotyping rhesus
monkey leukocytes.(17) To determine whether circulating PBLs were coated with
hu5A8, cells were stained with FITC-conjugated sheep anti- human IgG4 (The
Binding Site, Birmingham, UK) and counterstained with a CD4 domain 3- specific
antibody as described previously.

ANTI-IMMUNOGLOBULIN LEVELS

   Microtiter plates were coated with hu5A8, human IgG4 specific for VLA4
(generously provided by R. Lobb, Biogen), or with mu5A8 to measure the humoral
response in monkeys directed against the hu5A8 MAb, as well as to determine the
specificity of the response against the human immunoglobulin constant region and
against the 5A8 idiotype. All proteins were used to coat plates at 5 Mg/ml in
0.5 M bicarbonate buffer (pH 9.0), 50 Ml/well overnight at 4(degree)C. Plates
were washed with PBS, blocked with PBS-2% milk, washed again, and monkey serum
added as described above. Anti-hu5A8 serum levels were detected with
HRP-conjugated anti-human IgG1 + IgG2 + IgG3 (Zymed Laboratories, South San
Francisco, CA) at 1:1000 dilution and OPD substrate then employed as described
above. Data are expressed as the reciprocal of the highest serum dilution that
gave a signal greater than 2 standard deviations over the signal obtained from
normal monkey serum.

   As an alternative means of determining the fine specificity of the
anti-immunoglobulin response, we employed the method of Cobbold, ET AL.(18)
Briefly, hu5A8 (1 Mg/ml) was immobilized on microtiter plates and used to
capture hu5A8-specific plasma antibodies. Wells were then treated with
HRP-conjugated hu5A8 capable of binding to the plasma immunoglobulin second
binding site. The specificity of the captured plasma immunoglobulin was assessed
by determining whether

<PAGE>
mu5A8 or control human IgG4 could inhibit binding of the HRP-conjugated hu5A8 to
captured plasma immunoglobulin. Inhibition was measured by routine ELISA similar
to that described above.

                                     RESULTS

hu5A8 RETAINS AFFINITY FOR HUMAN AND RHESUS MONKEY CD4

   Previously we had shown that mu5A8 had similar affinity for human and rhesus
monkey CD4.5 To determine whether humanization altered antigen recognition, we
compared the binding of mu5A8 and hu5A8 to a human CD4+ cell line using an
indirect immunofluorescence assay. Both MAbs bound to human CD4 with the
concentration yielding 50% maximal binding (EC50) of 10 to 25 ng/ml (Fig. 3A).
The ability of hu5A8 and mu5A8 to compete for binding to human CD4+ cells was
also equivalent (data not shown). To assess relative binding to monkey CD4 we
used a similar assay on monkey PBLs. As shown in Fig. 3B, the use of either the
murine or humanized antibody resulted in similar binding curves with an EC50 of
2 to 20 ng/ml providing an estimate for binding affinity of 10-100 pM. These
data indicate that the binding activity of humanized 5A8 for both human and
monkey CD4 is retained.

HU5A8 IS AS EFFECTIVE AS MU5A8 IN INHIBITING HIV-1-INDUCED SYNCYTIUM FORMATION
AND BLOCKIN SIVMAC REPLICATION in vitro

   To determine whether humanization had affected the potent IN VITRO antiviral
properties of this antibody, we assessed the ability of both mu5A8 and hu5A8 to
inhibit HIV-1-induced syncytium formation in an infectable T cell line. As shown
in Fig. 4, mu5A8 and hu5A8 were equally effective in blocking virally induced
syncytium formation between HIV-1-infected H9 cells and uninfected C8166 cells.
To compare the efficiency of mu5A8 and hu5A8 to inhibit SIVmac, we utilized a
virus outgrowth assay in which CD8-depleted PBLs from a chronically
SIVmac-infected monkey were cultured in the presence of either antibody or an
irrelevant isotype-matched murine MAb (Fig. 5). Both mu5A8 and hu5A8 completely
inhibited virus replication in these cultures at antibody concentrations of 1.0
and 10 Mg/ml. Partial inhibition of replication was observed at the 0.1-Mg/ml
concentration for both antibodies. High levels of replication were present in
cultures that contained MOPC-21, a control murine MAb, at all three
concentrations. Comparable results were observed when antiviral activity was
assessed against primary HIV-1 isolates (data not shown).

hu5A8 HAS PROLONGED PLASMA HALF-LIFE

   Single intravenous injections of hu5A8 were given to normal rhesus monkeys
and the disappearance of MAb from blood was measured as described. The results
in animals receiving 1, 3, and 30 mg of MAb per kilogram are shown in Fig. 6A.
The beta phase of clearance, which represents excretion rather than
redistribution, was 5.2 days for the 3-mg/kg dose and 5.6 days for the 30-mg/kg
dose. This was significantly longer than that observed for the murine form of
the antibody, which had a beta phase T1/2 of approximately 28 hr (Fig. 6B and
Ref. 5).

hu5A8 BINDS TO CIRCULATING AND LYMPH NODE CD4 CELLS WITHOUT INDUCING CLEARANCE

<PAGE>
   The original murine form of this antibody exhibited the favorable property IN
VIVO of binding to all potential target CD4+ cells without inducing significant
clearance of these coated cells. Coating of all circulating CD4+ lymphocytes
with MAb was sustained until the eventual appearance of the anti-mouse
immunoglobulin response when coating was no longer detected. Because the
constant regions of this newly engineered antibody were quite distinct from the
parent murine antibody, we wished to ascertain that this IN VIVO biological
effect was retained in hu5A8. CD4 cells were quantified in the blood of rhesus
monkeys before and periodically following a single intravenous injection of
hu5A8 at 1, 3, and 30 mg/kg. As illustrated in Fig. 7, all three dosage levels
resulted in coating of CD4+ lymphocytes and no clearance of CD4 cells was
observed during the 2-week period postadministration. In fact, at all dosage
levels, there was a transient increase in the absolute number of circulating
lymphocytes immediately after hu5A8 administration owing predominantly to an
increase in the number of circulating CD4 cells. This transient increase in CD4
cells was identical to the effect observed following administration of mu5A8 to
rhesus monkeys(5).

   To determine whether intravenous administration of hu5A8 could reach CD4+
cells within lymphoid organs, we performed lymph node biopsies 3 days after
administration of 3 mg of hu5A8 per kilogram body weight. Immunophenotypic
analyses showed that all CD4(+) lymphocytes within peripheral lymph nodes had
human IgG4 antibody on their surface (data not shown).

ANTIBODY RESPONSES ARISE AGAINST hu5A8 AND ARE ENTIRELY ANTIIDIOTYPE

   All monkeys that received 3-mg/kg doses of hu5A8 developed strong humoral
anti-hu5A8 responses at approximately 2 weeks postinjection. Similar results
were observed in monkeys that received the 30-mg/kg dose; three of four animals
developed antibodies against hu5A8 in approximately the same time frame. One
monkey at this dosage level failed to develop anti-hu5A8 antibodies. Of two
monkeys that received the 1-mg/kg dose, one failed to develop a response and the
other exhibited a delayed response 5 weeks post hu5A8 mAb. Typical responses
elicited in animals administered 3 mg/kg hu5A8 are illustrated in Fig. 8A. The
appearance of this anti-hu5A8 response corresponded to an abrupt loss of CD4
binding activity and was associated with a loss of coating of CD4+ lymphocytes
with hu5A8.

   To determine the fine specificity of this response, plasma from monkeys
treated with 3 mg of hu5A8 per kilogram were assayed by ELISA for reactivity
against hu5A8, mu5A8, and human IgG4. Representative results are shown in Fig.
8B. All plasma that recognized hu5A8 also reacted with an equivalent titer
against mu5A8. However, recognition of human IgG4 was never observed with any
plasma. The fine specificity of plasma antibodies from monkeys that received 3
mg of hu5A8 per kilogram was further confirmed using immobilized hu5A8 to
capture plasma antibodies that were capable of binding soluble HRP-conjugated
hu5A8 with their second antibody combining site. In these assays, murine 5A8
completely abolished binding of soluble hu5A8 to the monkey plasma antibodies.
By contrast, there was no effect of soluble human IgG4 on the binding hu5A8
(data not shown). Thus the major antibody response against hu5A8 was directed
against the murine V region determinants of the humanized antibody.

hu5A8 COATS CD4 CELLS IN SIV(mac)-INFECTED MONKEYS FOR >5 WEEKS

<PAGE>
   To determine the feasibility of using hu5A8 as a therapy in AIDS virus
infection, we administered weekly doses of hu5A8 or human IgG4 antibody at 3
mg/kg to rhesus monkeys chronically infected with SIV mac. We reasoned that
virally induced immunosuppression in these animals may permit a longer treatment
window before anti-hu5A8 antibodies developed. Plasma from all monkeys was
assayed for anti-hu5A8 activity prior to the weekly administrations. Antibodies
against hu5A8 were not detected in either of two monkeys (Fig. 9B) and treatment
was continued for a total of 6 weeks. Trough hu5A8 levels were maintained at 0.6
to 2.0 mg/ml for the entire 6-week period. Whereas circulating CD4+ lymphocyte
counts were lower in chronically SIVmac-infected monkeys than in normal monkeys,
administration of hu5A8 was not associated with any further CD4 cell depletion.
In fact, one of two treated monkeys showed a transient threefold increase in
circulating CD4+ cells (Fig. 9A). Studies were performed to ensure that CD4+
lymphocytes bound hu5A8 throughout the treatment period. Peripheral blood
lymphocytes from treated monkeys were dual labeled with FITC-conjugated
anti-human IgG4 and phycoerythrin-conjugated, noncompeting anti-CD4. Both
monkeys treated with hu5A8 maintained detectable humanized antibody on CD4+ PBLs
through the last treatment. Figure 10 illustrates this dual staining of
hu5A8-treated animals, but not control-treated or untreated animals on
experimental day 33. Other untoward effects of this extended treatment were not
observed.

                                   DISCUSSION

   Previously we explored the IN VIVO biological activity in rhesus monkeys of a
unique, CD4 domain 2-specific monoclonal antibody that was a potent inhibitor of
HIV-1 replication.5 In contrast to the action of many other T cell-specific MAbs
when administered to humans19-22 or nonhuman primates,23-26 this MAb was
nondepleting and failed to induce measurable immunosuppression. All CD4+
lymphocytes remained coated with this MAb until development of a monkey
anti-mouse immunoglobulin response. Here we report the successful humanization
of this MAb and explore its biological activity and potential utility IN VIVO
using nonhuman primates.

   The humanized form of this antibody retained its binding to human and rhesus
monkey CD4, as well as its potent IN VITRO antiviral activity against HIV-1 and
SIVmac. Like the parental murine MAb, the humanized form was nonmodulating and
nondepleting of circulating CD4+ lymphocytes. In addition, the plasma half-life
was significantly longer for the humanized MAb than for the murine MAb,
increasing its potential as a therapeutic agent.

   Despite a marked decrease in antigenicity following humanization, a humoral
response to hu5A8 did eventually develop in most normal monkeys and resulted in
loss of CD4 binding activity. However, the response was directed entirely
against V region determinants because no reactivity with human IgG4 was
observed. Responses showing a similar specificity for murine determinants have
been seen in macaque monkeys that received humanized forms of anti-CD4
(OKT4A),27 anti-CD25 (anti-Tac),28 or anti-human tumor necrosis factor A29
antibodies. Antibody responses to murine immunoglobulin, whether elicited in
humans or monkeys, have been difficult to block using conventional modes of
immunosuppression.30-32 However, preliminary results in other laboratories
indicate that some humanized MAb may be nonantigenic when administered to

<PAGE>
humans at high doses or in conjunction with immunosuppressive agents.(29,32-34)
Thus, chronic administration of a therapeutic, humanized MAb remains a realistic
goal.

   Interestingly, monkeys infected with the nonhuman primate AIDS virus, SIVmac,
failed to develop anti-hu5A8 antibodies. The lack of an idiotype-specific immune
response in these animals was probably due to the immunosuppressed state of
SIV-infected animals, where an AIDS-like disease is induced in macaque
monkeys.35 This allowed us an opportunity to evaluate the effect of chronic
hu5A8 administration in a relevant animal model of AIDS. Two SIVmac-infected
monkeys that received six weekly injections of hu5A8 maintained circulating
hu5A8 levels and hu5A8 coated CD4+ lymphocytes without any decrease in CD4+ cell
number throughout this entire period. Previously we showed that administration
of the murine form of 5A8 to SIVmac-infected monkeys could decrease provirus
load.36 On the basis of the data reported here, the humanized form of this
antibody could have distinct advantages over the murine MAb owing to its
decreased antigenicity and extended plasma half-life, and most importantly,
long-term administration could have a more profound antiviral effect.

   The potential immunomodulatory effects of chronically administered hu5A8 were
not directly assessed in these studied. However, the ability of the murine form
of 5A8 to block immunologic responses has been measured both IN VITRO and IN
VIVO. Although we have previously found that mu5A8 can exhibit some suppression
of antigen-specific proliferative responses IN VITRO, this inhibition was not
consistently observed (our unpublished results). By contrast, antibodies such as
OKT4A33 consistently showed strong inhibition in the same assays. Furthermore,
when mu5A8 was administered to rhesus monkeys, a dosage sufficient to coat all
CD4+ lymphocytes for 9 days failed to inhibit various T cell-dependent
responses.(5) In experiments performed to date, we find that the IN VITRO
activity of hu5A8 is similar to that of mu5A8, showing some inhibition of cell
proliferation in about half of antigen-stimulated cultures (our unpublished
results). However, any potential immunomodulatory effects of hu5A8 will be best
addressed by further IN VIVO analyses.

   Passive immunotherapy directed against CD4 has been proposed for both the
prevention and treatment of HIV-1 infection(37-40). This therapeutic modality
may have use as a monotherapy or may demonstrate more potent activity in
combination with conventional antiretroviral agents. IN VITRO experiments have
indicated that the antiviral activity of mu5A8 is synergistic with anti-HIV-1
gp120 antibodies.(41) The results reported here support the feasibility of using
CD4-directed passive immunotherapy for the treatment of AIDS.

                                 ACKNOWLEDGMENTS

   The authors thank Jim Estrella for performing the pharmacokinetic assays and
Brenda Emergian for executing the ELISA to detect monkey anti-hu5A8 antibodies.

   This work was supported by PHS Grants RR00168 and RR00055 and by funds from
Biogen, Inc.

<PAGE>
                                   REFERENCES

1.  Sattentau QJ and Weiss RA: The CD4 antigen: Physiological ligand and HIV
    receptor. Cell 1988;52:631-633.

2.  Dalgleish AG, Beverley PCL, Clapham PR, Crawford DH, Greaves MF, and Weiss
    RA: The CD4(T4) antigen is an essential component of the receptor for the
    AIDS retrovirus. Nature (London) 1984;312:763-767.

3.  Klatzman D, Champagne E, Chamaret S, Gruest J, Guetard D, Hercend T,
    Gluckman J-C, and Montagnier L: T-lymphocytes T4 molecule behaves as the
    receptor for human retrovirus LAV. Nature (London) 1984;312:767-768.

4.  McDougal JS, Kennedy MS, Sligh JM, Cort SP, Mawle A, and Nicholson JKA:
    Binding of HTLV-III/LAV to T4+ T cells by complex of the 110K viral protein
    and the T4 molecule. Science 1986;231:382-385.

5.  Reimann KA, Burkly LC, Burrus B, Waite BCD, Lord CI, and Letvin NL: IN VIVO
    administration to rhesus monkeys of a CD4-specific monoclonal antibody
    capable of blocking AIDS virus replication. AID Res Hum Retroviruses
    1993;9:199-207.

6.  Burkly LC, Olson D, Shapiro R, Winkler G, Rosa JJ, Thomas DW, Williams C,
    and Chisholm P: Inhibition of HIV infection by a novel CD4 domain 2-specific
    monoclonal antibody. Dissecting the basis for its inhibitory effect on
    HIV-induced cell fusion. J Immunol 1992;149:1779-1787.

7.  Moore JP, Sattentau QJ, Klasse PJ, and Burkly LC: A monoclonal antibody to
    CD4 domain 2 blocks soluble CD4-induced conformational changes in the
    envelope glycoproteins of human immunodeficiency virus type 1 (HIV-1) and
    HIV-1 infection of CD4+ cells. J Virol 1992;66:4784-4793.

8.  Orlandi R, Gussow DH, Jones PT, and Winter G: Cloning immunoglobulin
    variable domains for expression by the polymerase chain reaction. Proc Natl
    Acad Sci USA 1989;86:3833-3837.

9.  Kabat EA, Wu TT, Reid-Miller M, Perry HM, and Gottesman KS: SEQUENCES OF
    PROTEINS OF IMMUNOLOGICAL INTEREST, Vol. 4, 5th Ed. U.S. Department of
    Health and Human Services, Bethesda, Maryland, 1991.

10. Klobeck HG, Bornkamm GW, Combriato G, Mocikat R, Pohlenz HD, and Zachau HG:
    Subgroup IV of human immunoglobulin k light chains is encoded by a single
    germline gene. Nucleic Acids Res 1985;13:6515-6529.

11. Larrick JW, Danielsson L, Brenner CA, Abrahamson M, Fry KE, and Borrebaeck
    CA: Rapid cloning of rearranged immunoglobulin genes from human hybridoma
    cells using mixed primers and polymerase chain reaction. Biochem Biophys Res
    Commun 1989;160:1250-1256.

12. Padlan EA: Anatomy of the antibody molecule. Mol Immunol 1994;31:169-217.

13. Bebbington CR, Renner G, Thomson S, King D, Abrams D, and Yarranton GT: High
    level expression of a recombinant antibody from myeloma cells using a
    glutamine synthetase gene as an amplifiable selectable marker. Biotechnology
    1992;10:169-175.

14. Galfre G and Milstein C: Preparation of monoclonal antibodies: Strategies
    and procedures. Methods Enzymol 1981;73:3-46.

15. National Institutes of Health: GUIDE FOR THE CARE AND USE OF LABORATORY
    ANIMALS, Rev. Ed. Department of Health and Human Services Publication No.
    (NIH) 85-23. National Institutes of Health, Bethesda, Maryland, 1985.

<PAGE>
16. Walker BD, Kowalski M, Goh WC, Kozarsky K, Krieger M, Rosen C, Rohrschneider
    L, Haseltine WA, and Sodroski J: Inhibition of human immunodeficiency virus
    syncytium formation and virus replication by castanospermine. Proc Natl Acad
    Sci USA 1987;84:8120-8124.

17. Reimann KA, Waite BCD, Lee-Parritz DE, Lin W, Uchanska-Ziegler B, O'Connell
    MJ, and Letvin NL: Use of human leukocyte-specific monoclonal antibodies for
    clinically immunophenotyping lymphocytes of rhesus monkeys. Cytometry
    1994;17:102-108.

18. Cobbold SP, Rebello PRUB, Davies HFS, Friend PJ, and Clark MR: A simple
    method for measuring patient anti-globulin responses against isotopic or
    idiotypic determinants. J Immunol Methods 1990;127:19-24.

19. Norman DJ: Mechanisms of action and overview of OKT3. Ther Drug Monitoring
    1995;17:615-620.

20. Shizuru JA, Alters SE, and Fathman CG: Anti-CD4 monoclonal antibodies in
    therapy: Creation of nonclassical tolerance in the adult. Immunol Rev
    1992;129:105-130.

21. Riethmuller G, Rieber EP, Kiefersauer S, Prinz J, van der Lubbe P, Meiser B,
    Breedveld F, Eisenberg J, Kruger K, Deusch K, ET AL.: From antilymphocyte
    serum to therapeutic monoclonal antibodies: First experiences with a
    chimeric CD4 antibody in the treatment of autoimmune disease. Immunol Rev
    1992;129:81-104.

22. Moreland LW, Bucy RP, Tilden A, Pratt PW, LoBuglio AF, Khazaeli M, Everson
    MP, Daddona P, Ghrayeb J, Kilgarriff C, Sanders ME, and Koopman WJ: Use of a
    chimeric monoclonal anti-CD4 antibody in patients with refractory rheumatoid
    arthritis. Arthritis Rheumatism 1993;36:307-318.

23. Rose LM, Alvord EC, Hruby S, Jackevicius S, Petersen R, Warner N, and Clark
    EA: IN VIVO administration of anti-CD4 monoclonal antibody prolongs survival
    in longtailed macaques with experimental allergic encephalomyelitis. Clin
    Immunol Immunopathol 1987;45:405-423.

24. Jonker M, Goldstein G, and Balner H: Effects of IN VIVO administration of
    monoclonal antibodies specific for human T cell subpopulations of the immune
    system in a rhesus monkey model. Transplantation 1983;35:521-526.

25. Cosimi AB, Burton RC, Kung PC, Colvin R, Goldstein G, Lifter J, Rhodes W,
    and Russell PS: Evaluation in primate renal allograft recipients of
    monoclonal antibody to human T-cell subclasses. Transplantation Proc
    1981;13:499-503.

26. Jonker M, Slingerland W, Treacy G, van Eerd P, Pak KY, Wilson E, Tam S,
    Bakker K, LoBuglio AF, Rieber P, ET AL.: IN VIVO treatment with a monoclonal
    chimeric anti-CD4 antibody results in prolonged depletion of circulating
    CD4+ cells in chimpanzees. Clin Exp Immunol 1993;93:301-307.

27. Delmonico FL, Cosimi AB, Kawai T, Cavender D, Lee W-H, Jolliffe LK, and
    Knowles RW: Nonhuman primate responses to murine and humanized OKT4A.
    Transplantation 1993;55:722-728.

28. Schneider WP, Glaser SM, Kondas JA, and Hakimi J: The anti-idiotypic
    response by cynomolgus monkeys to humanized anti-Tac is primarily directed
    to complementarity-determining regions H1, H2, and L3. J Immunol
    1993;150:3086-3090.

29. Stephens S, Emtage S, Vetterlein O, Chaplin L, Bebbington C, Nesbitt A,
    Sopwith M, Athwal D, Novak C, and Bodmer M: Comprehensive pharmacokinetics
    of a humanized antibody and analysis of residual anti-idiotypic responses.
    Immunology 1995;85:668-674.

<PAGE>
30. Jaffers GJ, Fuller TC, Cosimi AB, Russell PS, Winn HJ, and Colvin RB:
    Monoclonal antibody therapy: Anti-idiotypic and non-anti-idiotyic antibodies
    to OKT3 arising despite intense immunosuppression. Transplantation
    1986;41:572-578.

31. Lowder JN, Miller RA, Hoppe R, and Levy R: Suppression of anti-mouse
    immunoglobulin antibodies in subhuman primates receiving murine monoclonal
    antibodies against T cell antigens. J Immunol 1987;138:401-406.

32. Khazaeli MB, Conry RM, and LoBuglio AF: Human immune response to monoclonal
    antibodies. J Immunother 1994;15:42-52.

33. Pulito VL, Roberts VA, Adair JR, Rothermel AL, Collins AM, Varga SS,
    Martocello C, Bodmer M, Jolliffe LK, and Zivin RA: Humanization and
    molecular modeling of the anti-CD4 monoclonal antibody. OKT4A. J Immunol
    1996;156:2840-2850.

34. Anasetti C, Hansen JA, Waldmann TA, Appelbaum FT, Davis J, Deeg HJ, Doneyu
    K, Martin PJ, Nash R, Storb R, and Strom TA: Treatment of acute
    graft-versus-host disease with humanized anti-Tac: An antibody that binds to
    the interleukin-2 receptor. Blood 1994;84:1320-1327.

35. Letvin NL and King NW: Immunologic and pathologic manifestations of the
    infection of rhesus monkeys with simian immunodeficiency virus of macaques.
    J Acquir Immune Defic Syndr 1990;3:1023-1040.

36. Reimann KA, Cate RL, Wu Y, Palmer L, Olson D, Waite BCD, Letvin NL, and
    Burkly LC: IN VIVO administration of CD4-specific monoclonal antibody:
    Effect on provirus load in rhesus monkeys chronically infected with the
    simian immunodeficiency virus of macaques. AIDS Res Hum Retroviruses
    1995;11:517-525.

37. Attanasio R, Allan JS, and Kennedy RC: Monoclonal anti-CD4 as
    immunoprophylactic agents for human immunodeficiency virus infection. J
    Infect Dis 1993;168:515-516.

38. Rieber EP, Federle C, Reiter C, Krauss S, Gurtler L, Eberle J, Deinhardt F,
    and Riethmuller G: The monoclonal CD4 antibody M-T413 inhibits cellular
    infection with human immunodeficiency virus after viral attachment to the
    cell membrane: An approach to postexposure prophylaxis. Proc Natl Acad Sci
    USA 1992;89:10792-10796.

39. Dhiver C, Olive D, Rousseau S, Tamalet C, Lopez M, Galindo J-R, Mourens M,
    Hirn M, Gastaut J-A, and Mawas C: Pilot phase I study using zidovudine in
    association with a 10-day course of anti-CD4 monoclonal antibody in seven
    AIDS patients. AIDS 1989;3:835-842.

40. Reiber EP, Reiter C, Guntler L, Deinhardt F, and Riethmuller G: Monoclonal
    CD4 antibodies after accidental HIV infection. Lancet 1990;336:1007-1008.

41. Burkly L, Mulrey N, Blumenthal R, and Dimitrov DS: Synergistic inhibition of
    human immunodeficiency virus type 1 envelope glycoprotein-mediated cell
    fusion and infection by an antibody to CD4 domain 2 in combination with
    anti-gp120 antibodies. J Virol 1995;69:4267-4273.

                                                    Address reprint requests to:
                                                                KEITH A. REIMANN
                                                  DIVISION OF VIRAL PATHOGENESIS
                                            BETH ISRAEL DEACONESS MEDICAL CENTER
                                                                          RE-113
                                                            330 BROOKLINE AVENUE
                                                     BOSTON, MASSACHUSETTS 02215

<PAGE>
(1) Division of Viral Pathogenesis, Department of Medicine, Beth Israel
Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts 02215.

(2) Biogen, Inc., Cambridge, Massachusetts 02142.

(3) Laboratory of Molecular Biology, National Institute of Diabetes and
Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland
20892.

FIG. 1. Amino acid sequences of the V(H) and V(L) regions of mu5A8 and hu5A8,
and human antibody V(H) (MO30) and V(L) (VJI). MO30 and VJI contain the human
framework sequences most homologous to the murine V(H) and V(L) sequences,
respectively. The sequences are displayed in segments revealing those regions
corresponding to the four framework (FR) and three complementarity-determining
regions (CDRs). Dots in the hu5A8 VH and VL sequences indicate identity with
MO30 and VJI, respectively.

FIG. 2.  Oligonucleotides used in this study.

FIG. 3. hu5A8 and mu5A8 bind similarly to human and rhesus monkey CD4. The
relative binding abilities of hu5A8 and mu5A8 to human and rhesus monkey CD4+
cells were compared. A human CD4+ cell line (A) and rhesus monkey PBLs (B) were
incubated with increasing concentrations of either antibody and binding to cells
determined by indirect immunofluorescence. (F) mu5A8; ( ) hu5A8.

FIG. 4. hu5A8 inhibits syncytium formation in HIV-1-infected cells as well as
mu5A8. H9 cells chronically infected with HIV-1 were cocultured with uninfected
C8166 cells in the presence of varying concentrations of mu5A8 (F), hu5A8 (..),
or a control murine immunoglobulin ( ). Syncytia were counted in each well and
expressed as percentage inhibition by comparing values with control
immunoglobulin-treated wells.

FIG. 5. hu5A8 suppresses SIVmac replication as efficiently as the parental
murine monoclonal antibody. PBLs were isolated from the blood of a monkey
infected with SIVmac, activated with concanavalin A, and cultured in the
presence of hu5A8, mu5A8, or an isotype-matched control murine antibody
(MOPC-21) at 0.1 mg/ml (F), 1 mg/ml (F), or 10 mg/ml (G). SIVmac p27Gag antigen
was quantitated in the culture supernatant at four time points after initiating
cultures.

FIG. 6. Plasma half-life of hu5A8 is significantly longer than mu5A8. (A) A
single intravenous injection of hu5A8 was administered on day 0 to normal rhesus
monkeys at 1 mg/kg (F), 3 mg/kg (..), or 30 mg/kg (F). Plasma levels were
determined serially thereafter. (B) Clearance of hu5A8 (..) and mu5A8 ( ) at 3
mg/kg are compared. Each line represents an individual monkey.

FIG. 7. Administration of hu5A8 results in a transient increase in circulating
CD4+ lymphocytes. Circulating CD4+ lymphocytes were enumerated in the blood of
normal rhesus monkeys using OKT4-PE after a single intravenous injection of
hu5A8 at the indicated dose. Each line represents an individual animal. Arrow
indicates time of injection on day 0. Bar indicates time when cells coated with
hu5A8 were detected using anti-human IgG4-FITC.

<PAGE>
FIG. 8. Monkeys develop an anti-hu5A8 response that is predominantly
antiidiotype. (A) Two normal rhesus monkeys that received 3 mg of hu5A8 per
kilogram body weight developed antibodies that recognized hu5A8 approximately 2
weeks after a single intravenous injection. Monkey 1 (G); monkey 2 ( ). (B) Fine
specificity of antibodies in the same two hu5A8-treated monkeys. Plasma
recognized hu5A8 and parental mu5A8, but not another human IgG4. All values
correspond to the highest dilution that gave a positive signal as measured by
ELISA.

FIG. 9. Monkeys infected with simian immunodeficiency virus of macaques
(SIV(mac)) could be treated with hu5A8 for 6 weeks without developing anti-hu5A8
antibodies. Two SIV(mac)-infected rhesus monkeys received weekly intravenous
injections (indicated by arrows) of 3 mg of hu5A8 per kilogram body weight. (A)
CD4+ lymphocyte counts in peripheral blood of two treated monkeys (.,o,o) showed
no loss of target cells. Values from an untreated, SIVmac-infected animal are
also shown ( ). (B) Anti-hu5A8 antibody titers remained low in plasma of treated
monkeys assayed weekly during hu5A8 treatment. As a positive control, plasma
from a similarly treated, uninfected animal was assayed in parallel.

FIG. 10. Humanized 5A8 continues to binds to circulating CD4+ lymphocytes of
SIV(mac)-infected rhesus monkeys for more than 4 weeks during continuous
treatment. SIV(mac)-infected rhesus monkeys received 3 mg of hu5A8 or a control
antibody per kilogram body weight weekly for 3 weeks as described in Fig. 9.
Circulating lymphocytes were assessed for surface-bound hu5A8 on experimental
day 33 by indirect immunofluorescence with FITC-conjugated anti-human IgG4. Cell
were also colabeled with a phycoerythrin-conjugated, noncompeting anti-CD4
antibody (OKT4-PE) and fluorescence determined flow cytometrically. (A)
Untreated control animal; (B) human IgG4 control treated; (C and D) two
hu5A8-treated animals.

<PAGE>
AIDS RESEARCH AND HUMAN RETROVIRUSES
Volume 9, Number 3, 1993
Mary Ann Liebert, Inc., Publishers

      IN VIVO ADMINISTRATION TO RHESUS MONKEYS OF A CD4-SPECIFIC MONOCLONAL
               ANTIBODY CAPABLE OF BLOCKING AIDS VIRUS REPLICATION
       KEITH A. REIMANN,* LINDA C. BURKLY,+ BEATRICE BURRUS,+ BARRY C. D.
                  WATTE,* CAROL I. LORD,* and NORMAN L. LETVIN*

ABSTRACT

Monoclonal antibodies (mAbs) specific for CD4 are potent inhibitors of HIV
replication IN VITRO. These agents may be useful prophylactically or in chronic
HIV infection if they can be administered without inducing immunosuppression. In
the present study, we explored the safety of a CD4-specific murine mAb in rhesus
monkeys. The mAb 5A8, which binds to domain 2 of the CD4 molecule, inhibits AIDS
virus replication noncompetitively at a postvirus binding step. This antibody,
which had a similar affinity for rhesus monkey and human CD4 cells, efficiently
inhibited IN VITRO replication of both HIV-1 and the simian immunodeficiency
virus of macaques. A single 3-mg/kg injection of mAb 5A8 into normal rhesus
monkeys coated all circulating and lymph node CD4 cells for 4-6 days. CD4 cells
were not cleared from circulation nor was the CD4 molecule modulated from the
lymphocyte surface. In fact, administration of mAb 5A8 resulted in an
approximately one- to twofold increase in absolute number of circulating CD4
cells. Repeated administration in normal rhesus monkeys resulted in CD4
lymphocyte coating with mAbs for greater than 9 days without CD4 cell clearance
or modulation. While coated with mAbs, PBLs of these monkeys retained normal IN
VITRO proliferative responses to mitogens and these animals generated normal
humoral responses IN VIVO to tetanus toxoid. Loss of cell coating with mAbs in
normal monkeys corresponded to the appearance of anti-mouse immunoglobulin
antibodies. Thus, administration of certain anti-CD4 mAbs capable of blocking
HIV replication can achieve coating of the entire CD4 cell pool in rhesus
monkeys without inducing significant cell loss or immunosuppression.

                                  INTRODUCTION

THE CD4 MOLECULE IS A high-affinity receptor for the envelope glycoprotein of
HIV.(1-3) Thus, certain anti-CD4 monoclonal antibodies (mAbs) can block
HIV-induced syncytium formation and infection of lymphocytes and macrophages IN
VITRO.(1-3) The antiviral activity of various anti-CD4 mAbs has been ascribed to
steric interference with virus-CD4 binding,(1,2) inhibition of postbinding
conformational changes in CD4 required for fusion,(4,5) and CD4-mediated
inhibition of cell activation.(6)

      Monoclonal antibodies are being assessed as therapeutic agents in a
variety of clinical settings: as cancer therapies,(7,8) for immunomodulation in
autoimmune disorders,(9) in blocking allograft rejection,(9,10) and to bind
endotoxin in gram-negative bacteremia.(11,12) Yet in spite of their ability to
inhibit HIV replication IN VITRO, mAbs that bind CD4 have received little
attention as a potential AIDS therapy.(13) We(14,15) and others(16) have
demonstrated that antibodies to self-CD4 can be
<PAGE>
generated IN VIVO without inducing immune dysfunction. We therefore wished to
explore the feasibility of using anti-CD4 mAbs as passive immunotherapy that may
have utility in HIV prophylaxis or therapy.

      We have employed rhesus monkeys in this study because many human
leukocyte-specific monoclonal antibodies cross-react with conserved
determinants, including CD4, on monkey cells.(17,18) In addition, the simian
immunodeficiency virus of macaques (SIVmac), a lentivirus similar to HIV both
genetically and in its CD4 cell tropism, causes an AIDS-like disease in rhesus
monkeys.(19,20) The phylogenetic proximity of humans to the rhesus monkey and
the similarities of the immunopathogenesis of SIV(mac)-induced disease in the
monkey and HIV-induced disease in humans make this animal model uniquely suited
to evaluate immune-based therapies for AIDS. We selected the anti-CD4 mAb 5A8
for study IN VIVO because it is a potent inhibitor of HIV infection and cell
fusion.(21) Moreover, 5A8 may prove more useful as a therapeutic agent than
other anti-CD4 mAbs because of its ability to inhibit HIV infection/fusion in a
noncompetitive fashion, blocking postvirus/CD4 binding steps of
infection.(21,22) We sought to determine whether this anti- CD4 mAb could be
administered parenterally to rhesus monkeys without compromising immune
function.

                              MATERIALS AND METHODS

ANIMALS

      The rhesus monkeys (MACACA MULANA) used in this study were maintained in
accordance with the guidelines of the Committee on Animals for the Harvard
Medical School and the GUIDE FOR THE CARE AND USE OF LABORATORY ANIMALS
(Department of Health and Human Services Publication No. NIH 85-23, revised
1985). Monkeys were anesthetized with ketamine-HCl for all procedures.

PREPARATION OF MONOCLONAL ANTIBODIES

      The anti-CD4 mAb 5A8 was isolated and characterized as described
previously.(21,22) 5A8 and an isotype-matched control mAb. MOPC-21, were
purified by protein A affinity chromatography from tissue culture supernatants.
Purified mAbs contained only 2.2 and 1.4 endotoxin units/mg for 5A8 and MOPC-21,
respectively.

CULTURING OF HUMAN AND MONKEY CELLS

      Blood samples from normal rhesus monkeys and from normal human donors were
collected in heparinized syringes and peripheral blood lymphocytes (PBLs) were
isolated by density gradient centrifugation. Human concanavalin A (Con A) blasts
were prepared by incubating normal PBLs in medium with 5 mg of Con A (Sigma
Chemical Co., St. Louis, MO) per milliliter for 12-24 hr. H9 cells were obtained
from NIH AIDS Research and Reference Reagent Program (Rockville, MD). Cells were
cultured routinely in complete medium, which consisted of RPMI 1640 supplemented
with penicillin (50 U/ml), gentamicin (50 mg/ml), N-2-
hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES) buffer (10 mM),
L-glutamine (2 mM), and 10% heat-inactivated fetal bovine serum

<PAGE>
(ICN, Inc., Costa Mesa, CA) at 37(degree)C in a 5% Co(2), humidified atmosphere.
All human PBL cultures were supplemented with 20 U/ml of human recombinant
interleukin 2 (IL-2) (Hoffman-La Roche, Nutley, NJ).

AFFINITY STUDIES

      Isolated PBLs were incubated with varying concentrations of mAb 5A8
diluted in phosphate-buffered saline (PBS)-0.1% bovine serum albumin (BSA) (2 x
10(4) cells/100 ml) for 20 min at room temperature. Cells were then washed and
incubated with goat anti-mouse IgG- fluorescein isothiocyanate (FITC) [F(ab)(2)
fragment] for 10 min at room temperature, washed again, and fixed with PBS-1%
formalin. Mean fluorescence of the CD4+ PBLs was determined for each sample by
flow cytometry and binding curves for monkey and human cells were compared.

IN VITRO BLOCKING OF HIV AND SIV REPLICATION

      The ability of the mAb 5A8 to block AIDS virus infection of cells IN VITRO
was assessed by incubating either H9 cells with SIV(mac), or human PBL Con A
blasts with HIV-1(MN), in the continuous presence of 5A8 or an isotype-matched
control antibody. After a 12-hr incubation with virus, cells were washed once
and cultured as described above. Every 3 to 4 days an aliquot of medium was
collected to assay for viral antigen and the cell number in the cultures was
adjusted to approximately 5 x 10(5)/ml with fresh medium.

      To determine whether 5A8 could block virus outgrowth from PBLs of
SIV(mac)-infected monkeys or HIV-infected humans, mononuclear cells were
isolated from the blood of infected subjects and activated overnight with 5 mg
of Con A per milliliter of complete medium. CD8 cells were then depleted from
these cultures by using an anti-CD8 antibody (7PT3F9, provided by Dr. S.
Schlossman, Dana Farber Cancer Institute, Boston, MA) and immunomagnetic beads.
These CD8- depleted cultures were then cultured routinely in the presence of 5A8
as described above. Culture medium collected every 3 to 4 days was assayed for
the presence of either SIV p27 or HIV p24 antigen, using commercially available
kits (SIV core antigen assay, HIV-1 core antigen assay, Coulter Corp., Hialeah,
FL).

INTRAVENOUS ADMINISTRATION OF MONOCLONAL ANTIBODIES

      Monkeys were anesthetized and administered 3 mg of mAb 5A8 per kilogram or
a control antibody diluted to 1-2 mg/ml in PBS by intravenous injection over
approximately 1 min. In experiments in which multiple administrations were used,
this same dosage was given every 2 days.

IMMUNOPHENOTYPING BLOOD AND LYMPH NODE LYMPHOCYTES

      Biopsied lymph nodes were placed in complete medium and gently teased with
forceps to place cells in suspension. This suspension was then filtered through
112-mm nylon mesh and the cell number was adjusted to 2 x 10(6) nucleated cells
per milliliter in Hanks' balanced salt solution with 2.5% fetal bovine serum.
Both the lymph node lymphocytes and PBLs were stained with cell- specific mAbs
and analyzed by flow cytometry.
<PAGE>
      Ethylenediaminetetraacetic acid (EDTA)-anticoagulated blood was washed
three times with PBS-0.1% BSA to remove plasma and then cells were resuspended
in PBS-0.1% BSA at the original blood volume. Fifty microliters of blood cell or
lymph node cell suspension was added to 100 ml of PBS-0.1% BSA that contained an
appropriate amount of mAb. Monoclonal antibodies used were anti-CD4 [OKT4-FITC
(Ortho Diagnostic Systems, Raritan, NJ)], anti-CD8 [T8-FITC (Dako Corporation,
Carpinteria, CA)], and anti-CD45 [LCA (Dako Corp.)]. Cells were incubated for 30
min at room temperature and then washed once with PBS. To determine the extent
of IN VIVO cell coating with mAb 5A8 and in the stains for CD45, an indirect
staining technique was used. Cells were incubated, additionally, with a 1:50
dilution of FTTC-conjugated goat anti-mouse immunoglobulin [F(ab)2 fragment]
(Jackson ImmunoResearch, West Grove, PA) in PBS-0.1% BSA for 20 min at room
temperature and then washed with PBS. Red blood cells in all samples were lysed
by using a commercial RBC lysing kit (Immunolyse; Coulter Corp., Hialeah, FL),
washed in PBS, and resuspended in 0.4 ml of PBS-1% formalin. Samples were
analyzed routinely on an Epics-C flow cytometer, (Coulter Corp., Hialeah, FL)
using forward light scatter, 90(degree) light scatter, and CD45 fluorescence to
identify lymphocytes.

TETANUS TOXOID ANTIBODY TITERS

      Ninety-six-well microtiter plates (Immunolon: Dynatech, Chantilly, CA)
were coated with tetanus toxoid (Massachusetts State Laboratory, Boston, MA) at
5 m/ml in PBS, 50 ml/well overnight at 4(degree)C. Plates were washed with
PBS-0.5% Tween 20 and wells were blocked with PBS- 2% nonfat dry milk, 200
ml/well for 2 hr at room temperature. Wells were washed again and monkey serum
samples diluted in PBS-2% milk were added at 50 ml/well and incubated for 2-3 hr
at room temperature. After washing, horseradish peroxidase (HRP)-conjugated
anti-human immunoglobulin (Zymed Laboratories, San Francisco, CA) or
HRP-conjugated goat anti-human IgG Fc (Jackson ImmunoResearch, West Grove, PA)
was added at 50 ml/well for 1-2 hr at room temperature. After final washes,
O-phenyl-diamine substrate (Calbiochem, La Jolla, CA) was added at 100 ml/well
for 20 min. the reaction stopped with 1 N H2SO4 (100 ml/well), and absorbance
read at 490 nm on a microplate reader. Data are expressed as units total
immunoglobulin per milliliter, or IgG per milliliter, relative to a polyclonal
immune serum standard.

ANTI-MOUSE IMMUNOGLOBULIN LEVELS

      Microtiter plates were coated with mAb 5A8 at 5 mg/ml in bicarbonate
buffer (pH 9.0) overnight at 4(degree)C, washed with PBS, blocked with PBS-2%
milk, washed again, and monkey serum added as described above. Anti-mouse
immunoglobulin anti-bodies were detected with HRP- conjugated goat anti-human
immunoglobulin. Data are expressed as units immunoglobulin per milliliter
relative to a polyclonal immune serum standard.

MOUSE IMMUNOGLOBULIN SERUM LEVELS

      Microtiter plates were coated with goat anti-mouse IgG
(Cappel/Organon-Teknika Corp., Westchester, PA) at 5 mg/ml in bicarbonate buffer
(pH 9.0), blocked with PBS-2% milk, and monkey serum added at 50 ml/well as
described above. Mouse immunoglobulin was detected with

<PAGE>
HRP-conjugated rabbit and anti-mouse IgG (Cappe1/Organon-Teknika). Data are
expressed as micrograms mouse immunoglobulin per milliliter, using purified mAb
5A8 as a standard.

IN VITRO PROLIFERATION ASSAYS

      The proliferative responses of PBLs to pokeweed mitogen (PWM) and in a
mixed lymphocyte reaction (MLR) were measured at various time points in monkeys
that received mAb. Ficoll-isolated PBLs were washed and cultured in triplicate
in 96-well, round-bottomed polystyrene plates with 10(5) cells/well in 200
microliters of complete medium. For PWM proliferations, wells were supplemented
with PWM (GIBCO Bethesda Research Laboratories, Grand Island, NY) at a final
dilution of 1:300. For the MLR, 10(3) mitomycin C-treated B cells from a
xenogeneic Epstein-Barr virus (EBV)-transformed cell line was added to each
well. Peripheral blood lymphocytes cultured in medium alone served as
unstimulated controls. Cultures were maintained at 37 (degrees) C in a
humidified atmosphere with 5% CO(2). After 3 days for PWM-stimulated cultures
and 4 days for the MLR, cells were pulse labeled with 1 microliter of
[METHYL-(3)H]THYMIDINE for 4 hr. Cells were then harvested by an automated cell
harvester and thymidine incorporation was quantified by standard liquid
scintilography.

                                     RESULTS

      THE ANTI-CD4 mAb 5A8 HAD SIMILAR AFFINITY FOR MONKEY AND HUMAN CD4(+)
CELLS AND BLOCKED HIV AND SIV (MAC) REPLICATION IN VITRO. The HIVs and SIVs must
bind to membrane-expressed CD4 molecules to initiate a cellular infection. To
assess the ability ofmAb 5A8 to block these infections, the affinity of 5A8 for
monkey and human CD4 cells was first compared. The increase in fluorescence that
occurred as mAb concentration increased was similar for human and monkey CD(4+)
PBLs (Fig. 1 ). The concentrations of 5A8 that yielded 50% saturation of binding
sites were similar, approximately 0.8 micrograms/ml for human PBLs and 0.6
micrograms/ml for monkey PBLs.

      To assess directly the ability of this mAb to block AIDS virus infection.
CD4-bearing cells were inoculated with either SIV(mac) or HIV-(1)(MN) in the
presence of this antibody. As shown in Table 1, blocking of both HIV and SIV
infection was complete at an antibody concentration of 10 micrograms/ml. Partial
blocking was seen at 1 and 0.1 micrograms/ml. Outgrowth of virus from
CD8-depleted PBLs from HIV-l-infected humans and SIV (max)-infected monkeys was
completely inhibited at 10 and 1 micrograms/ml (Table 1). Thus, 5A8 can inhibit
IN VITRO infection and replication of both HIV and SIV with similar efficiency.

      PARENTERALLY ADMINISTERED mAb 5A8 RESULTED IN COATING OF CD4 CELLS WITHOUT
CLEARANCE FROM CIRCULATION. To determine the effect that parenteral
administration of this antibody would have on circulating CD4 lymphocytes, two
normal rhesus monkeys received a single intravenous administration of mAb 5A8.
As shown in Fig. 2A, the administration of 3 mg of antibody per kilogram
resulted in peak serum mouse immunoglobulin levels of 40-50 micrograms/ml.
Monoclonal antibody 5A8 remained detectable in the serum for at least 4 days in
both monkeys. The pharmacokinetics of its disappearance were consistent with a
two-phase clearance of mAb, with an (alpha) phase T (1/2) of approximately 2 hr
and a (Beta) phase T (1/2) of approximately 28 hr.
<PAGE>
      Following antibody administration, there was no evidence of a decrease in
percentage (Fig. 2C) or absolute number (Fig. 2B) of CD4(+) PBLs. In fact, 2
days following mAb treatment, total blood lymphocytes increased from 1600 to
2500/microliters in one and from 3100 to 6900/microliters in the other monkey.
This was due largely to an increase in circulating CD4 cells, which rose
modestly in one monkey (800 to 1400/microliters) and markedly in the other (1100
to 3000/micro1iters) (Table 2). The increase in circulating CD4 cell number
persisted as long as cell coating with mAb was evident By 5-6 days following
treatment, circulating lymphocytes had returned to pretreatment levels in both
monkeys, although one developed a CD4 lymphocytosis again in the second week
following treatment There were no significant changes in the other peripheral
Dlood leukocytes in treated monkeys.

      The single administration of anti-CD4 antibody resulted in coating of all
CD4 cells in the monkeys for a period of 4-6 days (Fig. 2D). As expected,
monkeys that received mAb developed humoral responses to the foreign mouse
protein (Fig. 2E). The appearance of this response appeared to correspond with
the disappearance of mouse immunoglobulin from the surface of monkey CD4
lymphocytes. No clinical signs were associated with the emergence of this
anti-mouse immunoglobulin response.

      ADMINISTERED mAb 5A8 COATED ALL CD4 CELLS IN SECONDARY LYMPHOID ORGANS.
Our previous studies with other T cell-specific mAbs in monkeys showed that
antibody dosages of at least 2 mg/kg were necessary to coat lymphocytes in
secondary lymphoid tissues.(23) To ensure that all CD4 lymphocytes in lymphoid
organs were coated with mAb 5A8, biopsies of peripheral lymph nodes were
performed in those two monkeys that received the single 3-mg/kg injection of
antibody. Lymph node lymphocytes from these biopsies were assessed by flow
cytometry for the presence of mouse immunoglobulin on their cell surface before
and after IN VITRO addition of mAb 5A8. No difference in the percentage of cells
staining positively following addition of mAb 5A8 indicated ; that all CD4 1ymph
node cells had been coated IN VIVO. As shown in Fig. 3, all CD4 cells were
coated with mouse mAb for 5 days after this single treatment.

      PERIPHERAL BLOOD LYMPHOCYTES OF MONKEYS THAT RECEIVED REPEATED
ADMINISTRATIONS OF 5AB RETAINED A NORMAL IN VITRO PROLIFERATIVE CAPACITY AND THE
MONKEYS GENERATED NORMAL ANTIBODY RESPONSES. We next examined the effects of
longer-term coating with mAb 5A8 on CD4 cell function. Two normal rhesus monkeys
were given intravenous mAb 5A8 (3 mg/kg) every other day for three treatments.
As controls, an additional two monkeys received an isotype-matched irrelevant
mAb, using the same dosing regimen. These administrations resulted in peak
plasma mouse immunoglobulin levels of 80-100 micrograms/ml in the 5A8-treated
and 250-300 microgram/ml in the control-treated monkeys, with detectable levels
remaining for at least 9 days.

      Circulating CD4 cells in the 5A8-treated monkeys remained coated with
mouse antibody for at least 9 days. The effect of repeated mAb 5A8
administration on circulating cell number was similar to the effect observed in
the monkeys receiving single injections. Increases in absolute number of
lymphocytes were observed, with a preferential increase reflected in the CD4(+)
subset. The increase in CD4(+) PBLs correlated with cell coating with mAb (Table
2, Fig. 4). Monkeys receiving the control mAb showed no consistent change in the
number of both total and CD4(+) PBLs over this period. Thus, prolonged coating
of circulating CD4 cells with mAb 5A8 did not result in their
<PAGE>
clearance from circulation. Moreover, during this period, there was no
detectable decrease in staining intensity for CD4 on PBLs, indicating that mAb
5A8 caused no significant CD4 modulation. A modest, transient decrease In CD4
cell number was noted in one monkey in coincidence with the appearance of the
anti-mouse immunoglobulin antibody response.

      To assess the effect that mAb 5A8 coating of CD4 cells might have on
immune function. T lymphocyte functional assays were performed on PBLs obtained
from monkeys receiving mAb. No consistent difference in responsiveness to PWM
(Fig. 5A) or an MLR (Fig. 5B) was observed between PBLs of monkeys given mAb 5A8
or control mAb. One anti-CD4-treated monkey did have a decreased MLR response on
day 14. However, this corresponded with the presence of an anti- mouse
immunoglobulin antibody response.

      The ability of the 5A8-treated monkeys to generate a humoral immune
response was also assessed. Monkeys were immunized with tetanus toxoid both
during and after mAb treatment As shown in Fig. 6, anti-tetanus immunoglobulin
responses were first detected in all monkeys by day 14 and were of similar
magnitude by day 21, despite continual CD4 cell coating with antibody for at
least 9 days. Similar results were obtained when tetanus-specific IgG was
measured (data not shown) Therefore, coating of CD4 lymphocytes with mAb 5A8
failed to induce any measurable abnormality in immune function.

                                   DISCUSSION

      Lymphocyte-specific monoclonal antibodies have been evaluated IN VIVO as
candidate immunosuppressive agents. The degree of immunosuppression induced in
animal models or humans has generally correlated with the ability of the mAb to
clear circulating cells or modulate functionally important molecules from cell
surfaces.(24) Moreover, the duration of immunosuppression has depended on the
length of time these effects could be maintained. In rodent models, rat
anti-mouse CD4 mAbs can completely and persistently clear circulating CD4
cells,(24-26) severely compromising the ability of the host to mount an immune
response. Other rat anti-mouse CD4 mAbs or mAb fragments that are nondepleting
but may modulate CD4 from the cell surface can also effectively inhibit immune
reactivity IN VIVO.(24,27) In addition, coadministration of depleting or
nondepleting anti-CD4 mAbs with a foreign antigen can induce a prolonged state
of antigen-specific tolerance, inhibiting the immune response to the mAbs
themselves as well as to the antigen.(24,26-29)

      CD4-specific mAbs have proved less predictable immunomodulators when
administered to nonhuman primates or to humans. Some mouse or mouse-human
chimeric antibodies have cleared peripheral blood CD4 cells(30-32) or induced
CD4 modulation from the surface of these cells(13,31,33) resulting in transient
suppression of immune responsiveness. Other anti-CD4 mAbs have caused no change
or minor transient decreases in PELs with varying degrees of immunosuppression.
(34-36) In the present study, treatment of normal monkeys with the mAb 5A8
neither cleared circulating CD4 cells nor induced CD4 modulation. The
lymphocytes of the monkeys retained their IN VITRO responsiveness to mitogens
and these monkeys generated normal humoral responses IN VIVO to an antigenic
challenge despite the coating of their CD4 cells with mAb. Thus, certain
CD4-specific
<PAGE>
mAbs can be given without inducing circulating cell clearance. CD4 modulation or
immunosuppression.

      The mAb used in these studies differs from most other CD4-specific mAbs
that have been previously evaluated IN VIVO in primates. Not only does mAb 5A8
not clear circulating CD4 cells or modulate the CD4 molecule from lymphocyte
surface, but administration ofmAb 5A8 resulted in an increase in circulating CD4
cells. These increases occurred within 1-3 days of the initial treatment. In
experiments not shown, mAb 5A8 did not affect the viability or growth IN VITRO
of normal or virus-infected PBL in 1 to 2-week cultures. The rapidity with which
mAb 5A8 increased the absolu1te number of circulating CD4 lymphocytes suggests
that this antibody may affect the trafficking of lymphocytes between circulating
and noncirculating pools. In addition to its high affinity for both human and
rhesus monkey CD4, this mAb was selected for these studies because it is a
po1tent inhibitor of an infection and cell fusion IN VITRO. This antibody also
has an unusual specificity, binding within domain 2 of CD4 and limiting
infection and fusion post virus binding.(21) We reasoned that this mAb might be
particularly useful as a blocking agent because it does not directly compete
with HIV for the CD4 domain 1 virus binding site, but rather inhibits
confonmational changes that may be required for HIV-induced fusion.(22)

      The appearance of an anti-mouse immunoglobulin humoral response limited
the effective duration of treatment with the mAb 5A8. A response of this type is
usually seen within 7-14 days of mouse mAb administration in nonhuman primates
or in humans.(37,38) Due to this response, mAb 5A8 was unable to coat
circulating CD4 cells when it was administered to a monkey 14 days after the
first treatment (data not shown). Thus, there was clear evidence for the
immunogenicity of this murine: protein in normal monkeys. However, preliminary
results have suggested that the humoral response to a foreign immunoglobulin may
be delayed or absent in monkeys with SIV((mac)-induced immunodeficiency.
Moreover, the antigenicity of a mAb might be minimized by utilizing mouse-human
chimeric antibodies or complementarity-determining region (CDR)-grafted forms.

      We have previously induced anti-CD4 autoantibodies by immunizing nonhuman
primates with recombinant forms of autologous or xenogeneic CD4.(14,15,39) This
antibody response correlated with an antiviral effect IN VITRO and IN VIVO. The
use of passive immunization would ensure both the appropriate antibody
specificity and uniform therapeutic levels of antibody. Such a form of therapy
could have utility as a postexposure prophylaxis in needle stick injuries, for
example. In addition, should maternal-fetal transmission of HIV occur during the
perinatal period, as in hepatitis B infection(40,41) then passive immunotherapy
with CD4-specific antibodies might effectively block this transmission.
Moreover, anti-CD4 antibodies could potentially decrease HIV replication in
chronically infected individuals.

      These studies demonstrate that anti-CD4 mAb administration can be
tolerated by normal monkeys and support the feasibility of using antibodies
directed against CD4 in HIV infection. Studies currently underway will evaluate
the ability of this mAb to inhibit replication IN VIVO and to block AIDS virus
infection using the rhesus monkey/SIV_animal model.

                                 ACKNOWLEDGMENT
<PAGE>
      The authors wish to thank Werner Meier, Konrad Miatkowski, and Renee
Shapiro for production and purification of the 5A8 and MOPC-21 antibodies used
in this study. We also thank Jennifer Blake, Dian Olson, and N. Mulrey for
excellent technical assistance and Shelley Kotlikoff for assistance in preparing
this manuscript. This work was supported by NIH Grants AI-20729. CA-51039, and
RR-000168 and by funds from Biogen, Inc. K.AR. is the recipient of a Special
Emphasis Research Career Award RR-OOOO55.

                                   REFERENCES

1.    Dalgleish AG, Beverley PCL, Chapman PR, Crawford DH, Greaves MF , and
      Weiss RA: The CD4(T4) antigen is an essential component of the receptor
      for the AIDS retrovirus. Nature (London) 1984;312:763-767.

2.    Klatzman D, Champagne E, Chamaret S, Gruest J, Guetard D, Hercend T,
      Gluckman J-C, and Montagnier L: T-lymphocyte T4 molecule behaves as the
      receptor for human retrovirus LAV.Nature (London) 1984;312:767-768.

3.    McDougal JS, Kennedy MS, Sligh IM, Con SP, Mawle A, and Nicholson JKA:
      Binding of HTLV-III/LAV to T4+T cells by complex of the 110K viral protein
      and the T4 molecule. Science 1986;231:382-385.

4.    Celada F, Cambiaggi C, Maccari J, Burastero S, Gregory T, Patzer E, Porter
      J, McDanal C, and Matthews T: Antibody raised against soluble CD4-pg120
      complex recognizes the CD4 moiety and blocks membrane fusion without
      inhibiting CD4-gp120 binding. I Exp Med 1990;172:1143-1150.

5.    Healey D, Dianda L, Moore JP, McDougal JS, Moore MJ, Estess P, Buck D,
      Kwong PD, Beverley PC, and Sartentau QJ: Novel anti-CD4 monoclonal
      antibodies separate human immunodeficiency virus infection and fusion of
      CD4+ cells from virus binding. J Exp Med 1990;172:1233-1242.

6.    Bank I and Chess L:Perturbation of the T4 molecule transmits a negative
      signal to T cells. J Exp Med 1985;162:1294-1303.

7.    Houghton AN and Larson S: Monoclonal antibodies for the treatment of
      cancer: Therapeutic strategies. Curr Opin Onco1 1989;1:258-265.

8.    Dillman, RO: Monoclonal antibodies for treating cancer. Ann Intern Med
      1989;111:592-603.

9.    Seimlan WE and Wofsy D: Selective manipulation of the immune repsonse IN
      VIVO by monoclonal antibodies. Annu Rev Med 1988;39:231-241.

10.   Dantal J and Soulillou JP: Use of monoclonal antibodies in human
      transplantation. Curr Opin Immunol 1991;3:740-747.

11.   Ziegler EJ, Fisher CJ Jr., Sprung CL, Straube RC, Sadoff JC, Foulke GE,
      Wortel CH, Fink MP, Dellinger RP , Teng NN, Allen IE, Berger HJ, Knatterud
      GL, LoBuglio AF, Smith CR, and the HA-1A Sepsis Study Group: Treatment of
      gram-negative bacteremia and septic shock with HA-1A human monoclonal
      antibody against endotoxin. New Engl J Med 1991;324:429-436.

12.   Greenman RL, Schein RM, Martin MA, Wenzel RP , MacIntyre NR, Emmanuel G,
      Chmel H, Kohler RB, McCarthy M, Plouffe J, Russell JA, and the XOMA Sepsis
      Study Group: A controlled clinical trial ofE5 murine monoclonal IgM
      antibody to endotoxin in the treatment of gram-negative sepsis. J Am Med
      Assoc 1991;266:1097-1102.
<PAGE>
13.   Dhiver C, Olive D, Rousseau S, Tamalet C, Lopez M, Galindo J-R, Mourens M,
      Hira M, Gastaut J-A, and Mawas C: Pilot phase I study using zidovudine in
      association with a 10-day course of anti-CD4 monoclonal antibody in seven
      AIDS patients. AIDS 1989;3:835-842.

14.   Waltanabe M, Chen ZW, Tsubota H, Lord CI, Levine CG, and Letvin NL:
      Soluble human CD4 elicits an antibody response is rhesus monkeys that
      inhibits simian immunodeficiency virus replication. Proc Natl Acad Sci USA
      1991;88:120-124.

15.   WaLtanabe M, Boyson JE, Lord CI, and Letvin NL: Recombinant soluble CD4
      immunized chimpanzees develop anti-self CD4 antibody responses with
      anti-HIV activity. Proc Natl Acad Sci USA 1992;89;5103-5107.

16.   Cassatt DR, Sweet RW, Arthos JA, and Truneh A: Immunization with soluble
      murine CD4 induces an anti-self antibody response without causing
      impairment of immune function. J Immunol 1991;147:1470-1476.

17.   Haynes BF, Dowell BL, Hensley LL, Gore I, and Metzgar RS: Human T cell
      antigen expression by primate T cells. Science 1982;215:298-300.

18.   Letvin NL, Todd III RF, Palley LS, Schlossman SF, and Griffin JD: T
      lymphocyte surface antigens in primates. Eur J Immunol 1983;13:345- 347.

19.   Desrosiers RC, Daniel MD, and Li Y:HIV-related lentiviruses of nonhuman
      primates. AIDS Res Hum Retroviruses 1989;5:465-473.

20.   Letvin NL and King NW: Immunologic and pathologic manifestations of the
      infection of rhesus monkeys with simian immunodeficiency virus of
      macaques. J Acquir Immune Defic Syndr 195)0;3:1023-1040.

21.   Burkly LC, Olson D, Shapiro R, Winkler G, Rosa JJ, Thomas DW, Williams C,
      and Chisholm P: Inhibition ofHIV infection by a novel CD4 domain
      2-specific monoclonal antibody. J Immunol 1992;149:1779-1787.

22.   Moore JP, Sattentau QJ, Klasse PJ, and Burkly LC: A monoclonal antibody to
      CD4 domain 2 blocks soluble CD4-induced conformational changes in the
      envelope glycoproteins of human immunodeficiency virus type I(HIV-1)
      and HIV-1 infection of CD4+ cells. J Virol 1992;66:4784-4793.

23.   Letvin NL, Chalifoux LV, Reimann KA, Ritz J, Schlossman SF, and Lambert
      JM: IN VIVO administration of lymphocyte-specific monoclonal antibodies in
      nonhuman primates. Delivery of ribosome-inactivating proteins to spleen
      and lymph node T cells. J Clin Invest 1986;78:666-673.

24.   Waldmann H: Manipulation of T-cell responses with monoclonal antibodies.
      Annu Rev Immuno1 1989;7:407-444.

25.   Alters SE, Sakai K, Steinman L, and Oi VT: Mechanisms of anti-CD4-mediated
      depletion and immunotherapy. A study using a set of chimeric anti-CD4
      antibodies. J Immunol 1990;144:4587-4592.

26.   Goronzy J, Weyand CM, and Fathman CG: Long-term humoral unresponsiveness
      IN VIVO induced by treatment with monoclonal antibody against L3T4. J Exp
      Med 1986;164:911-925.

27.   Carteron NL, Wofsy D, and Seaman WE: Induction of immune tolerance during
      administration of monoclonal antibody to L3T4 does not depend on depletion
      ofL3T4+ cells. J Immunol 1988;140:713-716.

28.   Shizuru JA, Taylor-Edwards C, Banks BA, Gregory AK, and Fathman CG:
      Immunotherapy of the nonobese diabetic mouse: Treatment with an antibody
      to T-helper lymphocytes. Science 1988;240:659-662.
<PAGE>
29.   Benjamin RJ and Waldman H: Induction of tolerance by monoclonal antibody
      therapy. Nature (London) 1986;320:449-451.

30.   Horneff G, Burmester GR, Ernmrich F, and Kalden JR: Treatment of
      rheumatoid arthritis with an anti-CD4 monoclonal antibody. Arthritis Rheum
      1991;34:129-140.

31.   Jonker M, Neuhaus P, Zurcher C, Fucello A, and Goldstein G: OKT4 and OKT4A
      antibody treatment as immunosuppression for kidney transplantation in
      rhesus monkeys. Transplantation 1985;39:247-253.

32.   Prinz J, Braun-Falco 0, Meurer M, Daddona P, Reiter C, Reiber P, and
      Riethmu1ler G: Chimaeric CD4 monoclonal antibody in treatment of
      generalized pustular psoriasis. Lancet 1991;338:320-321.

33.   Cosimi AB, Delmonic FL, Wright JK, Wee SL, Preffer FI, Jolliffe LK, and
      Colvin RB: Prolonged survival of non-human primate renal allograft
      recipients treated only with anti-CD4 monoclonal antibody. Surgery
      1990;108:406-413.

34.   Reiter C, Kakavand B, Rieber EP, Schattenkirchner M, Riethmuller G, and
      Kruger K: Treatment of rheumatoid arthritis with monoclonal CD4 antibody
      M-T151. Arthritis Rheum 1991;34:525-536.

35.   Hafter DA, Ritz I, Schlossman SF, and Weiner HL: Anti-CD4 and Anti-CD2
      monoclonal antilbody infusions in subjects with multiple sclerosis. J
      lmmunol 1988;141:131-138.

36.   Rose LM, Alvord JR EC. Hruby S, Jackevicius S, Petersen R, Warner N. and
      Clark EA: IN VIVO administration of anti-CD4 monoclonal antibody prolongs
      survival in longtailed macaques with experimental allergic
      encephalomyelitis. Clin Immunol lmmunopathol 1987;45:405-423.

37.   Reimann KA, Turner S, Lambert JM, Reed MH, Schlossman SF, and Letvin NL:
      IN VIVO administration of lymphocyte-specific monoclonal antibodies in
      nonhuman primates. V. Evidence that humoral immune response to monoclonal
      antibodies and immunotoxin conjugates abrogates their cytotoxic activity.
      Transplantation 1989;48:906-912.

38.   Jaffers GJ, Fuller TC, Cosimi AB, Russell PS, Winn HJ, and Colvin RB:
      Monoclonal antibody therapy: Anti-idiotypic and non-anti-idiotypic
      antibodies to OKT3 arising despite intense immunosuppression.
      Transplantation 1986;41:572-578.

39.   Watanabe M, Levine CG, Shen L, Fisher RA, and Letvin NL: Immunization of
      simian immunodeficiency virus-infected rhesus monkeys with soluble human
      CD4 elicits an antiviral response. Proc Natl Acad Sci USA
      1991;88:4616-4630.

40.   Yeoh EK: Hepatitis B virus infection in children. Vaccine
      1990;8(Suppl):S29-S30.

41.   Wright R: Viral hepatitis: Comparative epidemiology. Br Med Bull
      1990;46:548-558.

                                                    Address reprint requests to:
                                                                KEITH A. REIMANN
                                    NEW ENGLAND REGIONAL PRIMATE RESEARCH CENTER
                                                          HARVARD MEDICAL SCHOOL
                                                                   P.O. BOX 9102
                                          SOUTHBOROUGH, MASSACHUSETTS 01772-9102


*New England Regional Primate Research Center, Harvard Medical School, One Pine
Hill Drive- .Southborough, Massachusetts 01772.
(T)BiogEn, Inc., 14 Cambridge Center, Cambridge, Massachusetts 02142.

<PAGE>
FIG. 1. Monoclonal antibody 5A8 has similar affinity for human and Thesus monkey
CD4(+) PBLs. Peripheral blood lymphocytes from normal humans or rhesus monkeys
were stained with varying concentrations of 5A8 by an indirect technique and
analyzed by flow cytometry. Mean fluorescence +/- SD, (n)=2.(o) Human PBLs; (.)
rhesus monkey PBLs.

FIG. 2. A single intravenous administration of anti-CD4 monoclonal antibody 5A8
coats circulating CD4 lymphocytes without causing CD4(+) cell clearance. Two
monkeys received 3 mg of 5A8 per kilogram intravenously on day 0 (arrow). Data
points from day 0 represent samples collected prior to treatment. (A) Serum
levels of mouse immunoglobulin (micrograms/ml): (B) absolute number of CD4(+)
PBLs per microliter: (C) percentage ofPBLs that were CD4(+); (D) percentage of
CD4(+) PBLs that were coated with 5A8; (E) monkey anti-mouse immunoglobulin
titer.

FIG. 3. A single intravenous administration of anti-CD4 monoclonal antibody 5A8
coats all CD4(+) cells within peripheral lymph nodes. Peripheral lymph node
biopsies were obtained on the indicated days following a single 3-mg/kg
intravenous administration of 5A8 and assessed for the presence of surface-bound
5A8 by staining with FITC-conjugated goat anti-mouse immunoglobulin and analyzed
by flow cytometry(left). To determine the total number ofCD4(+) cells, samples
were also incubated with additional 5A8 and then stained with FITC-conjugated
goat anti-mouse immunoglobulin(right). The background fluorescence in each
sample is indicated by the unfilled tracing.

FIG. 4. Repeated administration of anti-CD4 monoclonal antibody 5A8 resulted in
continuous coating of CD4 lymphocytes for 9 days without clearing cells from
circulation. Two monkeys were intravenously administered 3 mg of 5A8 (.) per
kilogram or a control antibody (...) on days 0, 2, and 4 (treatments indicated
by arrows). (A) Percentage of CD4(+) cells in PBLs. (B) Absolute number of
CD4(+) cells per microliter. Mean +/- SD. Shaded bar represents time during
which CD4 cells were coated with mAb.

FIG. 5. Peripheral blood lymphocytes from monkeys receiving three intravenous
administrations of anti-CD4 monoclonal antibody had normal IN VITRO
proliferative responses. Peripheral blood lymphocytes were obtained on the
indicated days from monkeys receiving 5A8 (black bars) or a control antibody
(shaded bars), cultured with PWM(A) or in a xenogeneic MLR(B) and IN VITRO
proliferation was assessed. An experimental and control monkey were paired for
each experiment.

FIG. 6. Monkeys receiving three intravenous administrations of anti-CD4
monoclonal antibody elicit normal humoral responses to primary immunization with
tetanus toxoid. Monkeys that received three administrations of 5A8 or control
antibody (treatments indicated by lower arrows) were immunized with tetanus
toxoid on day 3 and day 21 (TT). Anti-tetanus serum immunoglobulin liters were
assessed as indicated. (o) 5A8-treated monkeys; (") control-treated monkeys.
Shaded bar represents time during which CD4 cells were coated with mAb.

TABLE I. ANTI-CD4 mAb 5A8 SUPPRESSES HIV-1 AND SIV(mac) REPLICATION.

                                          HIV p24 or SIV p27 (ng/ml)
<PAGE>
<TABLE>
<CAPTION>
                                       In vitro infection of human                               In vitro infection of H9
                                            PBLs with HIV(MN)                                       cells with SIV(mac)

<S>                               <C>                   <C>                <C>                <C>                <C>       <C>
Antibody               Day 3(a)                Day 7             Day 10             Day 3              Day 7               Day 10
added to
cultures
No mAb             greater than 0.5(b) greater than 0.5   greater than 0.5   greater than 1.0   greater than 1.0   greater than 1.0
Irrelevant mAb            NT(c)                NT                 NT         greater than 1.0   greater than 1.0   greater than 1.0
mAb 5A8
0.1 micrograms/ml     less than 0.5           0.1          less than 0.5            0.5         greater than 1.0   greater than 1.0
1.0 micrograms/ml     less than 0.5      less than 0.05    less than 0.05           0.6         greater than 1.0    less than 0.1
10.0 micrograms/ml    less than 0.5      less than 0.05    less than 0.05      less than 0.1      less than 0.1     less than 0.1


                            CD8-depleted PBLs from                                          CD8-depleted PBLs from
                             HIV-1-infected human                                           SIV(mac)-infected monkey

                          Day 3              Day 8                                  Day 3              Day 5           Day 10
No mAb              greater than 0.5   greater than 0.5                      greater than 1.0   greater than 1.0   greater than 1.0
Irrelevant mAb      greater than 0.5   greater than 0.5                             NT                 NT                NT
mAb 5A8
0.1 micrograms/ml         0.47         greater than 0.5                      greater than 1.0          0.6               0.3
1.0 micrograms/ml         0.08          less than 0.05                              1.0                0.3               0.1
10.0 micrograms/ml        0.12          less than 0.05                       greater than 1.0          0.3               0.2
</TABLE>

(a) Cultures were established as described in Materials and Methods. Culture
    medium was assayed, with a commercial kit, on the indicated days for HIV p24
    or SIV p27.

(b) Sensitivity of assay was 0.05 ng/ml for HIV p24 and 0.1 ng/ml for SIV p27.

(c) NT, Not tested.

<PAGE>
TABLE 2. CHANGE IN ABSOLUTE PERIPHERAL BLOOD LYMPHOCYTE NUMBER FOLLOWING
         ANTI-CD4 ADMINISTRATION
<TABLE>
<CAPTION>
                    Cells/microliters (percentage change)(a)

                          Lymphocytes                         CD4(+)lymphocytes

<S>           <C>    <C>          <C>         <C>       <C>     <C>        <C>
Treatment(b)  Day 0  Day 2(c)     Day 4       Day 6     Day 0   Day 2      Day 4
Single        1634   2546(+56)   2380(+46)   1540(-6)     801   1375(+72)  1214(+52)
Single        3060   6902(+125)  3119(+2)    1449(-53)   1102   3037(+176) 1560(+42)
Multiple      1836   3135(+71)   2938(+60)   6976(+280)   973   1850(+90)  1704(+75)
Multiple      2580   2745(+6)    5166(+100)  2624(+2)    1290   1702(+32)  3152(+144)
</TABLE>

Percentage change was calculated by dividing the posttreatment value by the
pretreatment value.
Monkeys received either a single 3-mg/kg intravenous administration of anti-CD4
mAb, or three administrations (multiple) of 3
on days 0,2, and 4. In multiple infusion experiments, blood samples for analysis
were drawn prior to treatment.
Values in bold-face type represent time points when CD4 cells were coated with
monoclonal antibody.


<PAGE>
AIDS RESEARCH AND HUMAN RETROVIRUSES
Volume 11, Number 4, 1995
Mary Ann Liebert, Inc., Publishers

      IN VIVO ADMINISTRATION OF CD4-SPECIFIC MONOCLONAL ANTIBODY: EFFECT ON
      PROVIRUS LOAD IN RHESUS MONKEYS CHRONICALLY INFECTED WITH THE SIMIAN
                       IMMUNODEFICIENCY VIRUS OF MACAQUES
  KEITH A. REIMANN(1), RICHARD L. CATE(2), YAMING WU(2), LOUISE PALMER(2), DIAN
   OLSON(2), BARRY C.D. WAITE(1), NORMAN L. LETVIN(1), and LINDA C. BURKLY(2)

ABSTRACT

Since monoclonal antibodies (MAb) specific for CD4 are potent inhibitors of HIV
and SIV replication IN VITRO, we explored their potential usefulness IN VIVO as
an AIDS therapy. The anti-CD4 MAb 5A8 binds to domain 2 of the CD4 molecule and
inhibits virus replication and virus-induced cell fusion at a postvirus binding
step. Administration of this MAb to normal rhesus monkeys coats all circulating
and lymph node CD4 cells and induces neither CD4 cell clearance nor measurable
immunosuppression. In the present study, monkeys chronically infected with the
simian immunodeficiency virus of macaques (SIVmac) had stable levels of SIVmac
provirus in PBMC prior to treatment as measured by a quantitative polymerase
chain reaction technique. Six infected monkeys treated with anti-CD4 MAb
demonstrated a significant decrease in SIVmac provirus level after 9 days. Of
these monkeys, 3 had >800 CD4 cells/Ml and developed strong antimouse Ig
responses that prevented further treatment. The remaining 3 monkeys had <800 CD4
cell/Ml and failed to develop antimouse Ig antibody responses. When treatment
was continued for 12-21 days in these monkeys, a sustained or further decrease
in SIVmac provirus load occurred over the extended treatment period. Four
monkeys that received a control MAb of irrelevant specificity for 9-22 days
showed either no significant change or a transient increase in SIVmac provirus.
Thus, the passive administration of anti-CD4 MAb may exert a specific antiviral
effect in controlling immunodeficiency virus infection IN VIVO.


                                  INTRODUCTION

The CD4 molecule that acts as a high-affinity receptor for the envelope
glycoprotein of HIV is a potential target for therapeutic intervention in HIV
infection.1-4 Indeed, certain anti-CD4 monoclonal antibodies (MAbs) can
efficiently block HIV-induced syncytia formation and infection of lymphocytes
and macrophages(1,2,5) or spread of infection among CD4+ target cells IN
VITRO.(6,7) However, this mode of passive immunotherapy has received little
attention.(6-9)

      The simian immunodeficiency virus of macaques (SIVmac) is a lentivirus
similar to HIV both genetically and in its CD4 cell tropism and induces an
AIDS-like disease in rhesus monkeys(10,11). Additionally, many monoclonal
antibodies directed against the human CD4 molecule also react with rhesus monkey
CD4 due to the phylogenetic proximity of man and the rhesus monkey(12,13)


<PAGE>
These features make this animal model uniquely suited to evaluate CD4-directed
therapies for AIDS.

      Recently, PCR technology has been employed to quantitate the HIV provirus
levels in HIV-infected individuals offering a powerful alternative to
quantitation of viral burden by serum antigenemia or virus culture from
blood.14,15 Although a clear correlation between DNA provirus and antiretroviral
therapy is not yet established, some have reported decreases in HIV provirus in
response to nucleoside analogs.16-19 By analogy, we sought to apply quantitative
DNA PCR to assess the SIV proviral burden in chronically SIV-infected rhesus
monkeys.

      Previously we have explored the safety of IN VIVO administration of
CD4-specific MAbs in normal rhesus monkeys.20 This anti-CD4 MAb 5A8 is a potent
inhibitor of HIV and SIV infection and cell fusion IN VITRO20,21 and appears to
inhibit HIV infection/fusion in a noncompetitive fashion, blocking postvirus/CD4
binding steps of infection.21,22 When administered intravenously to normal
rhesus monkeys, this MAb bound to all CD4+ lymphocytes in the peripheral blood
and lymphoid organs. Despite coating with MAb, CD4 cells were not cleared from
circulation, but rather increased transiently in number. Neither did this
antibody induce any measurable immunodeficiency. However, the duration of
treatment was limited by the appearance of an antimouse Ig antibody
response.(20)

      In the present study, we explored the feasibility of using anti-CD4 MAb as
passive immunotherapy in the treatment of AIDS employing rhesus monkeys
chronically infected with SIVmac. We show that chronic administration of a
CD4-specific MAb results in 5- to 10-fold decreases in virus load as measured by
changes in SIV provirus.


                              MATERIALS AND METHODS

PREPARATION OF MONOCLONAL ANTIBODIES

      The anti-CD4 MAb 5A8 was isolated and characterized as described
previously.(21,22) 5A8 and isotype-matched control MAb, MOPC-21, were purified
by protein A affinity chromatography from tissue culture supernatants. Purified
MAbs contained less than 3 endotoxin units/mg.

ANIMALS AND ANTIBODY ADMINISTRATION

      The rhesus monkeys (MACACA MULATTA) used in this study were maintained in
accordance with the guidelines of the Committee on Animals for the Harvard
Medical School and the Guide for the Care and Use of Laboratory Animals
[Department of Health and Human Services Publication No. (NIH) 85-23, revised
1985]. All monkeys were infected by intravenous inoculation with uncloned simian
immunodeficiency virus of macaques (SIVmac), strain 251, which was propagated in
human PBMC. Monkeys were anesthetized with ketamine-HCl for all procedures.

      Monkeys were administered 3 mg/kg of MAb 5A8 or a control antibody diluted
to 1-2 mg/ml in phosphate-buffered saline (PBS) by intravenous injection over
approximately 1 min. Antibody was

<PAGE>
administered every 3 days until monkeys developed a significant antimouse Ig
titer. The minimum number of injections given was 4 and the maximum was 8. The
eighth injection was given on day 22 rather than day 21.

IMMUNOPHENOTYPING OF MONKEY PBL

      Unfractionated cells from EDTA anticoagulated blood were washed three
times with PBS/0.1% bovine serum albumin (BSA) to remove plasma and previously
administered MAb. Then, cells were resuspended in PBS/0.1% BSA at the original
blood volume and immunophenotyped as previously described.23 Briefly, 50 Ml of
blood cell suspension was added to 100 Ml of PBS/0.1% BSA that contained an
appropriate amount of MAb. MAbs used were anti-CD4 (OKT4-FITC; Ortho Diagnostic
Systems, Raritan, NJ) and anti-CD45 (LCA, Dako Corp., Carpenteria, CA) Cells
were incubated for 30 min at room temperature and then washed once with PBS. In
the stains for CD45, an indirect staining technique was used. Cells were
incubated, additionally, with a 1:50 dilution of FITC-conjugated goat antimouse
Ig [F(ab)2 fragment] (Jackson Immuno-Research, West Grove, PA) in PBS/0.1% BSA
for 20 min at room temperature and then washed with PBS. RBC in all samples were
lysed using a commercial RBC lysing kit (Whole Blood Lysing Reagent Kit; Coulter
Corp., Hialeah, FL), washed in PBS, and resuspended in 0.4 ml of PBS/1%
formalin. Samples were analyzed routinely on a flow cytometer using forward
light scatter, 90(degree) light scatter, and CD45 fluorescence to identify
lymphocytes.

ASSAY FOR ANTIMOUSE IG LEVELS

      Titer of antimouse Ig in monkey plasma was determined as described
previously using an ELISA in which 5A8 was adsorbed to microtiter plates and
binding monkey Ig was detected using an HRP-conjugated antihuman Ig antiserum
that cross reacts with rhesus monkey Ig.20 Antimouse Ig levels were determined
prior to treatment and following treatment on the days indicated.

QUANTITATION OF IN VIVO SIVMAC PROVIRUS BY PCR

      PBMC isolated on Ficoll gradient were washed with PBS and frozen as cell
pellets (1-3 x 106 cells) in liquid nitrogen. Samples were thawed and cell
pellets were disrupted after adding 0.4 ml of lysis buffer (0.5 M EDTA, pH 8.0,
0.5% Sarkoysyl, 100 Mg/ml proteinase K). Lysates were incubated for 4 hr at
50(degree)C, and extracted two times with equal volumes of phenol/chloroform
(1:1). DNA was precipitated by adding 0.9 volumes of room temperature ethanol
followed by centrifugation at room temperature for 2 min in an Eppendorf
centrifuge. The DNA pellets were resuspended in TE (10 mM Tris, pH 8.0, 1 mM
EDTA) and precipitated a second time with 3 volumes of ethanol, followed by
resuspension in 100 Ml TE. The total cellular DNA was quantitated on a 0.7%
agarose gel.

      Two sets of PCR primers were used to quantitate the level of SIVmac
provirus in the DNA samples:

      SIV1 5_GACCATGTTATGGCCAAATG3_and

<PAGE>
      SIV2 5_GGCTTCTCTCTGCTTTCTCT3_;

      RCD1 5_TTTCCAGAAGGCCTCCAGCA3_and

      RCD2 5_AGGTTCACTTCCTGATGCAA_3.

Primers SIV1 and SIV2 are from the region of the SIVmac-251 viral genome where
the POL and GAG gene products overlap and produce a 200 base pair PCR product.
Primers RCD1 and RCD2 produce a 333 base pair PCR product from the rhesus monkey
CD4 gene, which serves as a reference gene present in DNA derived from PBMC. PCR
was performed at a final concentration of 1 x PCR buffer (10 mM Tris-HCl, pH
8.3, 50 mM KCl, 1.5 mM MgCl2, 0.01% gelatin), 0.2 mM dNTPs, 0.25 MM primers
(SIV1, SIV2, RCD1, RCD2), 2.5 units of THERMUS AQUATICUS DNA polymerase (TAQ
polymerase, Perkins-Elmer/Cetus, Norwalk, CT), and 200 ng genomic DNA in a final
volume of 100 Ml. Genomic DNA and primers were heat denatured for 2 min and
quick-chilled on ice prior to setting up the PCR reaction. The mixture was
overlaid with mineral oil and amplified 24 cycles in a thermal cycler
(Perkin-Elmer/Cetus). The amplification profile involved denaturation at
93(degree)C for 1 min. primer annealing at 50(degree)C for 1 min. and extension
at 72(degree)C for 1 min. On the last cycle, the extension time was increased to
8 min. Twenty microliters of each PCR reaction was electrophoresed on 2% agarose
gels in Tris- acetate/EDTA buffer. The DNA was transferred to nylon membranes
(Gene Screen; Dupont, Boston, MA), and fixed by UV crosslinking.(24)

      The nylon membranes were hybridized with two oligomers, SIV3, which
hybridized to the 200 base pair SIV PCR fragment, and RCD3, which hybridized to
the 333 base pair CD4 PCR fragment:

      SIV3 5_TCTTTAGCAGATCCACAGCTGGGT3_

      RCD3 5_GAGCTTCTTGCCCATCTGGAGCTT3_

The two oligomers were labeled with [y-32P]ATP (6000 Ci/mmol; Dupont) using
polynucleotide kinase and separated from unincorporated nucleotides by
electrophoresis on a 20% acrylamide gel.(25) The membranes were prehybridized 30
min at 50(degree)C in 1% crystalline grade bovine serum albumin, 0.5 M sodium
phosphate, pH 7.2, 7% SDS, 1 mM EDTA.(26) Hybridization was performed at
50(degree)C for 12 hr in 100 ml of the same buffer containing 20 pmol of the
32P-labeled SIV3 oligomer, 10-20 fmol of the 32P-labeled RCD3 oligomer, and 20
pmol of the unlabeled RCD3 oligomer. PCR products were detected with the
SIV-specific oligomer and 1000- to 2000-fold less 32P-labeled CD4-specific
oligomer in order to avoid overexposure of the CD4 bands when detecting the SIV
PCR products. After hybridization, the membranes were washed four times for 5
min at 50(degree)C with 5 x SSC/1% SDS and two times for 5 min with 3.2 M
tetramethylammonium chloride (TMAC1)/1% SDS at 55(degree)C. Membranes were
exposed to Kodak XAR-5 film for 1-4 days at -70(degree)C using intensifying
screens. Band intensity was determined using a densitometer (Molecular Dynamics
Model 300A, Sunnyvale, CA). The provirus level in PBMC was calculated using the
ratio of SIV gene PCR product/CD4 gene PCR product expressed as a percentage
after correcting for the specific activity of the CD4 probe.

<PAGE>
      To determine the precision and reproducibility of this assay, both the
intraassay and interassay variation were measured. In 74 samples run as
replicates within the same assay, the median coefficient of variation was 21%
with a range of 5-51%. In 50 samples run twice in independent assays, the median
coefficient of variation was 22% with a range of 3-76%. Thus, the variation was
similar whether replicates were run in a single assay or if the sample was
analyzed in independent assays. Further, these results indicate that the assay
can detect differences in SIV provirus levels greater than 2-fold.

STATISTICAL ANALYSIS

      Each value used as an estimate of SIV provirus was obtained as a mean of 2
assays performed on the same blood sample. Pretreatment mean values were derived
from duplicate assays that were performed on 2 independent blood sampling time
points. Differences in SIVmac provirus levels between control and experimental
groups were determined using ANOVA (balanced design, one group factor, one
repeated measures factor). Pairwise comparisons between posttreatment values and
the pretreatment mean value were made using Neuman-Keul's multiple range test.
For all analyses, P < 0.05 was considered significant.



                                     RESULTS

ADMINISTRATION OF MAb TO SIVMAC-INFECTED MONKEYS

      Ten rhesus monkeys that were chronically infected with SIVmac were
administered the anti-CD4 MAb (n = 6), or an isotype-matched control MAb (n = 4)
every third day by intravenous injection. In our previous studies using this
antibody in normal rhesus monkeys, a humoral immune response to mouse Ig
appeared in the serum between 9 and 12 days after the first administration.20
Further administration of 5A8 to monkeys with high antimouse Ig titers resulted
in a failure of 5A8 to bind to CD4+ lymphocytes and in an acute systemic
allergic reaction. Therefore, in the present study, we measured the antimouse Ig
titer prior to each treatment after day 9 to determine whether additional
treatments could be performed. Four of ten monkeys rapidly developed high-titer
antimouse Ig responses after 4 MAb injections by day 12 and further treatments
could not be administered to these animals (Fig. 1). In the 6 remaining monkeys,
antimouse Ig responses remained orders of magnitude lower. Thus, treatments were
continued in 4 monkeys for a total of 5-8 injections (Table 1). When circulating
CD4 counts were examined, all 4 monkeys with rapidly appearing, antimouse Ig
responses had CD4 counts greater than 800/microliters. In contrast, only 1 of 6
monkeys with low or delayed antimouse Ig responses had a CD4 count
>800/microliters. Therefore, monkeys with lower CD4 cell counts and presumably
more marked immune dysfunction could be treated longer with mAb.

CHANGES IN PBMC IN RESPONSE TO TREATMENT WITH MAb

      We have shown previously that treatment of normal rhesus monkeys with MAb
5A8 results in a transient increase in circulating CD4 cell number.(20) This
increase appears very soon after treatment suggesting that it results from
changes in trafficking of CD4+ lymphocytes rather than from an

<PAGE>
actual increase in total CD4 cell number. A similar transient increase in
circulating CD4 cell number was noted in 4 of 6 SIVmac-infected monkeys treated
with 5A8 (Fig. 2) while no change in PBMC phenotype was noted in monkeys treated
with the irrelevant MAb (data not shown). In no case was a sustained decrease in
CD4+ cells observed. In addition, changes in monocyte number did not correlate
with MAb treatment (Table 1).

QUANTITATIVE PCR FOR DETECTION OF SIV PROVIRUS LOAD

   We sought to measure changes that occurred in the quantity of provirus in
PBMC during the MAb treatment of this cohort of chronically SIVmac-infected
rhesus monkeys. Serum antigenemia and virus isolation by cocultivation of PBMC
from infected monkeys with SIVmac-permissive cells were not consistently
detectable. Thus, a sensitive, quantitative PCR assay was employed. DNA from
chronically SIVmac-infected H9 cells was diluted into DNA from uninfected
rhesus monkey PBMC at varying ratios (1:250, 1:500, 1:1000, 1:2000) for use as
an assay standard. Figure 3A shows the level of SIV proviral DNA and that of a
reference gene (rhesus CD4) after PCR amplification of these samples.
Densitometric quantitation allowed the ratio of the SIV/CD4 PCR products to be
calculated and these values are plotted for each input DNA sample as shown in
Figure 3B. SIV/CD4 PCR products of equal intensity were expected at a 1/2000
ratio of SIV/CD4 input DNA since the specific activity of the CD4 probe was
2000-fold less than the SIV probe. Thus, these data demonstrate that the ratio
of the PCR products reflects the SIV/CD4 ratio in the corresponding input DNA
and that the PCR amplification performed under these conditions is reproducible,
linear and sensitive to 2-fold differences. The coefficient of variation in this
assay ranged from 8 to 35% and thus was similar to the variation observed in
assays of PBMC from infected monkeys.

PROLONGED 5A8 MAB TREATMENT OF CHRONICALLY SIV-INFECTED MONKEYS DECREASES SIV
MAC PROVIRUS LEVELS

   SIVmac provirus levels were evaluated by quantitative PCR in SIV
mac-infected monkeys treated either with 5A8 or an isotype-matched control Ig.
SIVmac provirus was consistently detected in the PBMC of all 10 infected
monkeys studied. Figure 4 illustrates the autoradiographs obtained for provirus
quantitation from 5 representative monkeys. The relative SIV provirus levels for
all monkeys are shown in Figure 5.

   Provirus was quantitated at 2 or 3 times in each monkey before treatment.
While variation in provirus level occurred between monkeys, these pretreatment
values varied less than 2-fold on average within each individual. Statistical
analysis confirmed that there were no differences between replicate samples
obtained at the time points before treatment or between mean pretreatment values
in the control vs experimental groups.

   The 6 monkeys that received the MAb 5A8 every 3 days for 9 days exhibited a
significant decrease in SIV provirus levels as compared to the 4 control treated
monkeys (ANOVA, balanced design, one group factor, one repeated measures factor)
(Fig. 6). Pairwise comparisons between pre- and posttreatment means showed
significantly lower SIV provirus level in experimental animals on day 12
(Neuman-Keuls multiple range test). Power calculations on these data indicated
that

<PAGE>
increasing the experimental n by 2- or 3-fold would result in statistically
significant differences between pre- and posttreatment values and between
experimental and control groups at 9 and 15 days as well.(27)

   Three of these 6 5A8-treated monkeys failed to develop a high-titer antimouse
Ig response and these monkeys were treated for a total of 12 to 22 days. All
showed sustained or further reductions in SIV provirus level over this extended
treatment period. Monkey number 163 exhibited a 5-fold decrease through day 15
and numbers 81 and 152 both achieved 10-fold reductions through day 30 (Fig.
5C). These decreases in provirus level in the CD4-depleted group persisted for
at least 5-7 days after the last MAb administration. In all monkeys, provirus
levels tended to return to pretreatment values after treatment was discontinued.

   A similar decrease in SIV provirus was not observed in monkeys treated with a
control MAb. Rather control monkeys exhibited no significant change in SIV
provirus level whether treated short term (9 days, monkeys 239, 107, 410) or
long term (22 days, monkey 177) (Figs. 5A and 6). In fact, the increased
variation in mean provirus levels on day 6 and day 9 reflects a transient
increase in SIV provirus in monkey 177. Thus, provirus levels were markedly and
reproducibly reduced relative to pretreatment levels in these 5A8-treated
monkeys, whereas the corresponding control Ig-treated animals exhibited no
significant change.

                                   DISCUSSION

   We have shown that monoclonal antibodies specific for CD4 can be administered
to SIVmac-infected rhesus monkeys without clearing of circulating CD4 cells.
This murine MAb could be administered for over 3 weeks in some animals when an
AIDS virus-induced immunodeficiency modulated the immune response to the mouse
Ig. To assess the efficacy of this treatment in controlling SIVmac replication,
we developed a quantitative assay to measure SIVmac provirus. SIVmac DNA was
readily detected and generally varied only 2-fold within individuals in repeated
samplings obtained prior to treatment. Surprisingly, one monkey (177) that
received an irrelevant MAb developed an increase in SIVmac provirus in the PBMC.
The paradoxical increase in SIVmac provirus seen in the monkey treated with an
irrelevant MAb may simply be due to increased virus replication as a result of
immune cell activation by treatment with foreign protein. Activation of infected
CD4 cells increases virus replication and may serve to facilitate infection of
other CD4 cells in an individual(28). Conversely, when an anti-CD4 MAb was
administered, SIVmac provirus levels decreased. Most notably, SIVmac-infected
animals that were more severely compromised (CD4 counts <800/microliters) and
could be treated for a longer period of time had a marked and sustained decrease
in measured proviral load. This decrease in SIVmac provirus appeared to be
specific since treatment of control monkeys with a similar disease profile for
the same duration did not show a proviral reduction.

   This decrease in SIV provirus in PBMC was not simply due to clearance of CD4+
lymphocytes from the circulation. Lymphocytes from normal monkeys that bound 5A8
IN VIVO were not cleared from the circulation but, in fact, increased in number.
This same transient increase in circulating CD4 cells was seen in some
SIV-infected monkeys treated with 5A8. Since in our provirus assay

<PAGE>
we did not adjust for this increased percent CD4+ cells, we may have actually
underestimated the decrease in provirus at the early time points.

   Our method of quantitating virus load measures provirus only in cells in the
peripheral blood compartment. There is mounting evidence that virus burden may
vary in the different lymphoid compartments.(29,30) Although there was no
measurable decrease in circulating CD4+ cell number, we cannot rule out that the
decrease in SIVmac provirus within the PBMC compartment following 5A8 treatment
was due to changes in recirculation of CD4 cells caused by coating with MAb.
However, for changes in cell trafficking alone to have this effect, the MAb-
induced change would have to selectively recruit uninfected CD4 cells into the
circulation.

   Humans infected with HIV might respond to treatment with anti-CD4 MAb in a
similar way. This antibody was shown to block IN VITRO replication of SIV and
HIV with equivalent efficiency.(20) However, the deleterious effect of
administering mouse Ig and the duration of treatment may be improved
substantially by using CDR-grafted, "humanized" MAb. In addition to treating
chronically HIV-infected individuals, this form of passive immunotherapy may
have usefulness in blocking primary infection with HIV in the setting of
needle-stick injuries or other occupational exposures(6,7). These results
suggest that CD4-directed treatments may exert a potent antiviral effect in
individuals infected with an AIDS virus.

                                ACKNOWLEDGMENTS

   We thank Alan Gill and Bernard J. Ransil for valuable discussions. Data
organization and analysis were performed on the PROPHET system, a national
computer resource sponsored by the National Center for Research Resources,
National Institutes of Health. This work was supported by National Institutes of
Health Grants RR-00168 and CA-50139. Special Emphasis Research Career Award
RR-00055 (K.A.R.), and by funds from Biogen, Inc.

                                   REFERENCES

1.  Dalgleish AG, Beverley PCL, Chapham PR, Crawford DH, Greaves MF, and Weiss
    RA: The CD4(T4) antigen is an essential component of the receptor for the
    AIDS retrovirus. Nature (London) 1984;312:763-767.

2.  Klatzman D, Champagne E, Chamaret S, Gruest J, Guetard D, Hercend T,
    Gluckman J-C, and Montagnier L: T-lymphocytes T4 molecule behaves as the
    receptor for human retrovirus LAV. Nature (London) 1984;312:767-768.

3.  McDougal JS, Kennedy MS, Sligh JM, Cort SP, Mawle A, and Nicholson JKA:
    Binding of HTLV-III/LAV to T4+ T cells by complex of the 110K viral protein
    and the T4 molecule. Science 1986;231:382-385.

4.  Sattentau QJ and Weiss RA: The CD4 antigen: Physiological ligand and HIV
    receptor. Cell 1988;52:631-633.

<PAGE>
5.  McDougal JS, Mawle A, Cort SP, Nicholson JKA, Cross GD, Scheppler-Campbell
    JA, Hicks D, and Sligh J: Cellular tropism of the human retrovirus
    HTLV-III/LAV. I. Role of T cell activation and expression of the T4 antigen.
    J Immunol 1985;135:3151-3162.

6.  Attanasio R, Allan JS, and Kennedy RC: Monoclonal anti-CD4 as
    immunoprophylactic agents for human immunodeficiency virus infection. J
    Infect Dis 1993;168:515-516.

7.  Rieber EP, Federle C, Reiter C, Krauss S, Gurtler L, Eberle I, Deinhardt F,
    and Riethmuller G: The monoclonal CD4 antibody M-T413 inhibits cellular
    infection with human immunodeficiency virus after viral attachment to the
    cell membrane: An approach to postexposure prophylaxis. Proc Natl Acad Sci
    USA 1992;89:10792-10796.

8.  Dhiver C, Olive D, Rousseau S, Tamalet C, Lopez M, Galindo J-R, Mourens M,
    M Hira M, Gastaut J-A, and Mawas C: Pilot phase I study using zidovudine in
    association with a 10-day course of anti-CD4 monoclonal antibody in seven
    AIDS patients. AIDS 1989;3:835-842.

9.  Reiber EP, Reiter C, Gurtler L, Deinhardt F, and Reithmuller G: Monoclonal
    CD4 antibodies after accidental HIV infection. Lancet 1990;336: 1007-1008.

10. Desrosiers RC, Daniel MD, Li Y: HIV-related lentiviruses of non-human
    primates. AIDS Res Hum Retroviruses 1989;5:465-473.

11. Letvin NL and King NW: Immunologic and pathologic manifestations of the
    infection of rhesus monkeys with simian immunodeficiency virus of macaques.
    J Acquir Immune Defic Syndr 1990;3:1023-1040.

12. Haynes BF, Dowell BL, Hensley LL, Gore I, and Metzgar RS: Human T cell
    antigen expression by primate T cells. Science 1982;215:298-300.

13. Letvin NL, King NW , Reinherz EL, Hunt RD, Lane H, and Schlossman SF: T
    lymphocyte surface antigens in primates. Eur J Immunol 1983;13:345-347 .

14. Wood R, Dong H, Katzenstein DA, and Merigan TC: Quantification and
    comparison of HIV-1 proviral load in peripheral blood mononuclear cells and
    isolated CD4+ T cells. J Acquir Immune Def Synd 1993;6:237-240.

15. Oka S, Urayama K, Hirabayashi Y, Otmishi K, Goto H, Mitamura K, Kimura S,
    and Shimada K: Quantitative extimation of human immunodeficiency virus
    type-1 provirus in CD4+ T lymphocytes using the polymerase chain reaction.
    Mol Cell Probes 1991;5:137-142.

16. Aoki S, Yarchoan R, Thomas RV, Pluda, JM, Marczyk K, Broder S, and Mitsuya
    H: Quantitative analysis of HIV-1 proviral DNA in peripheral blood
    mononuclear cells from patients with AIDS or ARC: Decrease of proviral DNA
    content following treatment with 2_.3__ dideoxyinosine (ddI). AIDS Res Hum
    Retroviruses 1990;6:1331-1339.

17. Clark AGB, Ho1odniy M, Schwartz DH, Katzenstein DA, and Merigan TC: Decrease
    in HIV provirus in peripheral blood mononuclear cells during zidovudine and
    human rIL-2 administration. J Acquir Immune Defic Syndr 1992;5:52-59.

18. Dickover RE, Donovan RM, Goldstein E, Cohen SH, Bolton V, Huth RG, Liu GZ,
    and Carlson JR: Decreases in unintegrated HIV DNA are associated with
    antiretroviral therapy in AIDS patients. J Acquir Immune Defic Syndr
    1992;5:31-36.

19. Bush CE, Donovan RM, Smereck SM, Strang D, Markowitz N, and Saravolatz LD:
    Quantitation of unintegrated HIV-1 DNA in asymptomatic patients in the
    presence or absence of antiretroviral therapy. AIDS Res Hum Retroviruses
    1993;9:183-187.

20. Reimann KA, Burk1y LC, Burros B, Waite BCD, Lord CI, and Letvin NL: In vivo
    administration to rhesus monkeys of a CD4-specific monoclonal antibody
    capable of blocking AIDS virus replication. AIDS Res Hum Retroviruses
    1993;9:199-207.

<PAGE>
21. Burkly LC, Olson D, Shapiro R, Winkler G, Rosa JJ, Thomas DW, Williams C,
    and Chisholm P: Inhibition of HIV infection by a novel CD4 domain 2-specific
    monoclonal antibody. J Immunol 1992;149:1779-l787.

22. Moore JP , Sattentau QJ, Klasse PJ, and Burkly LC: A monoclonal antibody to
    CD4 domain 2 blocks soluble CD4-induced conformational changes in the
    envelope glycoproteins of human immunodeficiency virus type I (HIV-1) and
    HIV-1 infection of CD4+ cells. J Virol 1992;66:4784-4793.

23. Relmann KA, WaIte BCD, Lee-Parrtz DE, Lin W, Unchanska-Ziegler B, O Connell
    MJ, and Letvin NL: Use of human leukocyte-specific monoclonal antibodies for
    clinically imrnunophenotyping lymphocytes of rhesus monkeys. Cytometry
    1994;17:102-108.

24. Cate RL, Chick W, and Gilbert W: Comparison of the methylation patterns of
    the two rat insulin genes. J Biol Chem 1983;258:6645-6652.

25. Devlin PE, Ramachandran KL, and Cate RL: Southern analysis of genomic DNA
    with unique and degenerate oligonucleotide probes: A method for reducing
    probe degeneracy. DNA 1988;7:499-507.

26. Church GM and Gilbert W: Genomic sequencing. Proc Natl Acad Sci USA
    1984;81:1991-1995.

27. Trapp RG: BASIC AND CLINICAL BIOSTATISTICS. Appleton and Lange, Norwalk, CT
    1990.

28. Gowda SD, Stein BS, Mohagheghpour N, Benike CJ, and Engleman EG: Evidence
    that T cell activation is required for HIV-1 entry into CD4+ lymphocytes. J
    Immunol 1989;142:773-780.

29. Pantaleo G, Graziosi C, Demarest JF, Butini L, Montroni M, Fox CH, Orenstein
    JM, Kotler DP, and Fauci AS: HIV infection is active and progressive in
    lymphoid tissue during clinically latent stage of disease. Nature (London)
    1993;362:355-358.

30. Embertson J, Zupancic M, Ribas JL, Burke A, Racz P, Tenner-Racz K, and Haase
    AT: Massive covert infection of helper T lymphocytes and macrophages by HIV
    during the incubation period of AIDS. Nature (London) 1993;362:359-362.

                                                    Address reprint requests to:
                                                                KEITH A. REIMANN
                                                          HARVARD MEDICAL SCHOOL
                                                  DIVISION OF VIRAL PATHOGENESIS
                                                          DEPARTMENT OF MEDICINE
                                                     BETH ISRAEL HOSPITAL RE-113
                                                            330 BROOKLINE AVENUE
                                                                BOSTON, MA 02215

(1) Harvard Medical School, Beth Israel Hospital, Boston, Massachusetts 02215.
(2) Biogen, Inc., Cambridge, Massachusetts 02146.


FIG. 1. Magnitude of the antimouse Ig antibody responses correlated with CD4
cell count. The antimouse Ig antibody response in the plasma of SIVmac-infected
monkeys was quantitated using an ELISA technique. Data are expressed as
reciprocal endpoint dilutions. Samples were analyzed over a course of treatment
with either the anti-CD4 MAb 5A8 (_) or a control antibody (O). (A) Monkeys with
pretreatment CD4 counts of >800/microliters. (B) monkeys with pretreatment CD4
counts of <800/microliters.

<PAGE>
FIG. 2. CD4 cells were not cleared from circulation during the course of
treatment with anti-CD4 MAb. CD4+ lymphocytes were enumerated flow
cytometrica1ly in the peripheral blood of SIVmac-infected monkeys that received
repeated injections of anti-CD4 MAb. (A) Values from monkeys that had
pretreatment CD4 counts >800/microliters and were treated for 9 days. (B) Values
from monkeys that had pretreatment CD4 count of <800 and were treated for either
12 or 22 days. Shaded area represents period of MAb treatment

FIG. 3. Relative amount of SIVmac provirus is reproducibly determined using a
quantitative PCR technique. DNA from SIVmac-infected H9 cells was diluted into
rhesus monkey genomic DNA at the indicated ratios. This dilution also reflects
the SIVmac provirus/CD4 gene ratio since infected H9 cells contain, on average
2 SIVmac provirus copies per cell as determined by Southern blot analysis (data
not shown). These DNA were amplified by PCR, transferred to nylon membranes, and
hybridized with radiolabeled oligomers as described in Materials and Methods.
(A) Autoradiographs from 4 replicate assays. (B) The dilution of SIVmac
provirus in input DNA is plotted against the ratio of SIV/CD4 PCR products (mean
+/- SD).

FIG. 4. SIVmac PCR products and reference gene (CD4) products were determined
before and after anti-CD4 MAb treatment. SIVmac and CD4 PCR products from the
provirus assay described above are visualized after hybridization with a
radiolabeled probe. DNA was extracted from PBMC at various time points over the
treatment course with a control MAb (MOPC) or an anti-CD4 MAb (5A8).

FIG. 5. SIVmac provirus levels were unchanged or increased when control MAb was
administered but decreased when the anti-CD4 MAb 5A8 was given. SIVmac provirus
in PBMC of infected monkeys was quantified as described in Materials and Methods
over the course of treatment with either a control MAb or the anti-CD4 MAb 5A8
(mean +/- SD). Shaded area represents the time during which MAb was
administered for each individual monkey. (A) Changes in provirus level in 4
monkeys that received control MAb. (B) Change in provirus level in 3 monkeys
with CD4 count >800 CD4 cell/ microliters treated with anti-CD4 MAb. These
monkeys rapidly developed antimouse Ig responses and were treated for only 9
days. (C) Change in provirus level in 3 monkeys with <800 CD4 cells/microliters
treated with anti-CD4 MAb. These monkeys had a diminished humoral response to
mouse Ig and were treated for 12-22 days.

FIG. 6. Mean SIVmac provirus level decreased in monkeys that received the
anti-CD4 MAb 5A8. Mean SIVmac provirus levels (+/- SD) in infected monkeys
treated with the anti-CD4 MAb 548 (n = 6) or a control MAb (n = 4) where
posttreatment mean values are compared with pretreatment mean. The asterisk (*)
signifies significant decrease (Newman-Keuls multiple range test, p < 0.05).

TABLE 1. CHANGES IN CD4 LYMPHOCYTE AND MONOCYTE COUNT DURING MONOCLONAL ANTIBODY
TREATMENT


<PAGE>
<TABLE>
<CAPTION>
                             TREATMENT(B)       BEFORE TREATMENT       DURING TREATMENT
              WEEKS
MONKEY NO.  INFECTED(C)  ANTIBODY  DURATION   CD4CELLS(C)  MONOCYTES(D)   CD4 CELLS

<S>            <C>          <C>       <C>         <C>          <C>        <C>   <C>
  163          108          5A8       12d         402          108        860+/-143
  395           37          5A8        9d         831          104       2387+/-562
  133           37          5A8        9d        1067          270       1898+/-535
  152          148          5A8       22d       81+/-38     232+/-118      83+/-47
   81           56          5A8       22d      103+/-48     282+/-247      47+/-16
  284           56          5A8        9d     1458+/-107    348+/-60     1858+/-1149
  107           37         MOPC        9d         148          448        200+/-19
  410           37         MOPC        9d        1109          287       1361+/-165
  177          148         MOPC       22d      322+/-35     123+/-124     252+/-58
  239           56         MOPC        9d     1944+/-537    298+/-265    2195+/-214
</TABLE>

<PAGE>
(a) Monkeys were infected with SIVmac the indicated number of weeks prior to
    treatment.
(b) Monkeys received intravenous injection of either a CD4-specific monoclonal
    antibody (5A8) or a control antibody (MOPC) at 3 mg/kg every 3 days for the
    indicated duration.
(c) CD4+ lymphocytes were enumerated by immunophenotyping and are expressed as
    mean cells/microliter +/- SD.
(d) Monocytes were enumerated by CBC and manual differential count and are
    expressed as mean cells/microliter +/- SD.


                                                                   EXHIBIT 10.14

CERTAIN INFORMATION IN THIS EXHIBIT IS SUBJECT TO A REQUEST FOR CONFIDENTIAL
TREATMENT. IN ACCORDANCE WITH RULE 406 UNDER THE SECURITIES ACT OF 1933, AS
AMENDED, SUCH INFORMATION HAS BEEN OMITTED AND FILED SEPARATELY WITH THE
SECURITIES AND EXCHANGE COMMISSION. THE LOCATION OF SUCH OMITTED INFORMATION HAS
BEEN INDICATED WITH AN ASTERISK(*).

                                                                    CONFIDENTIAL
                                                          TANOX BIOSYSTEMS, INC.

               OUTLINE OF TERMS FOR SETTLEMENT OF THE LITIGATIONS

             AMONG GENENTECH INC., GENENTECH INTERNATIONAL LIMITED

                             TANOX BIOSYSTEMS, INC.

                             AND CIBA-GEIGY LIMITED

             RELATING TO ANTI-IgE INHIBITING MONOCLONAL ANTIBODIES

     In 1993 Tanox sued Genentech for fraud and misappropriation of know-how in
     the context of anti-IgE-antibody projects to which both companies are
     committed. Genentech then sued Tanox and, later on Ciba for infringement of
     Genentech's US "Cabilly" patent by their anti-IgE and anti-HIV monoclonal
     antibody projects. Ciba and Tanox filed a counterclaim for invalidation of
     said patent. Tanox has further filed certain patent applications on which
     some patent rights have already been granted which may extend to
     Genentech's anti-IgE substance, although Genentech does not agree that they
     do. Now the parties are willing to settle a11 their pending litigations
     including potential future disputes regarding anti-IgE antibodies on the
     basis of the following principles:

1.   MERGER OF ANTI-IgE PROJECTS

     The anti-IgE-antibody projects of Genentech on the one side and Ciba/Tanox
     on the other side shall be merged, but Genentech and Ciba/Tanox will
     continue to take their respective anti-IgE antibodies through Phase II
     clinical trials currently in progress or planned to be performed during
     1996. Based upon the results of these trials and other relevant
     considerations Genentech, Tanox and Ciba shall jointly discuss and decide
     by June 1, 1997 at the latest which of the anti-IgE antibodies shall be
     taken up in Phase III trials, be developed for additional indications (if
     any), be submitted for marketing authorization and be commercialized as a
     pharmaceutical product ("anti-IgE Product"). The final Agreement(s) as
     referred to in Section 8.2 shall provide for procedures in case of a
     disagreement between the parties. All development activities shall be
     supervised by a Steering Committee on which each party is represented. The
     merging of each party's anti-IgE-antibody projects and the development and
     commercialization thereof according to this Outline of Terms shall extend
     to all IgE inhibiting antibodies (including fractions or derivatives
     thereof) which have been identified and synthesized by either party hereto
     *.
<PAGE>
                                      -2 -

2.   SHARING OF DEVELOPMENT COST

     All development activities for the anti-IgE Project/Product including such
     things as the manufacture of the clinical material, the conduct of clinical
     trials, the development of the process to make anti-IgE antibodies and
     required supporting activities/services and fees which are necessary for
     obtaining the NDA in the USA and the marketing authorization(s) in Europe
     shall be pooled between Genentech and Ciba. This cost pooling shall
     commence as of the date on which the selection of the anti-IgE Product for
     further development has been made (the "Selection Date").

     These pooled costs shall be allocated to the US development cost account on
     the one side and the Europe development cost account on the other side on a
     pro rata basis to be agreed upon according to the prospective sales
     potential for the anti-IgE Product in each of the two territories.

     The development cost allocated to the US shall be shared between Ciba and
     Genentech in the ratio of *, whereas the development cost for Europe
     -- subject to Section 11 hereafter shall be borne as to * by Ciba and as
     to * by Genentech.

     Any additional development cost required for the commercialization of the
     anti-IgE Product in territories outside the US and Europe shall be borne
     exclusively by Ciba/Tanox according to the Development and Licensing
     Agreement between Tanox and Ciba dated May 11, 1990, and the amendment
     thereto relating to the territories of Taiwan, Korea, Singapore, China and
     Hong Kong (the "D&L Agreement"), subject to additional cost obligations for
     Japan which may arise according to Section 11 hereafter.

3.   COMMERCIALIZATION

3.1  The anti-IgE Product shall be commercialized in the US under one brand
     under a co-promotion scheme by Ciba and Genentech to be further elaborated
     and agreed upon. In lieu of Tanox's right under the D&L Agreement to
     participate in such co-promotion in the US, Tanox will be entitled to the
     payments set forth in Section 5.1 hereafter.

     All the cost for the manufacturing/purchase of anti-IgE Product and all the
     cost for its marketing and sale in the US including all supporting and
     auxiliary activities and royalties to third parties (if any) shall be
     shared between Ciba and Genentech on a * basis.
<PAGE>
                                      -3-

     All the net profIts from the commercialization of the anti-IgE Product in
     the US shall be shared between Ciba and Genentech on a * basis.

3.2  The anti-IgE Product shall be commercialized in Europe exclusively by Ciba,
     subject to Section 11 hereafter.

     All the cost for the manufacturing/purchase of the anti-IgE Product and
     all the cost for its marketing and sale including all supporting activities
     and royalties to Tanox on the one hand and third parties (if any) and all
     the net profits from the commercialization of the anti-IgE Product in
     Europe shall be shared between Ciba and Genentech on the basis of *
     (Ciba): * (Genentech).

3.3  In all countries in the world other than US and Europe, Ciba shall have
     exclusive rights for the commercialization of the anti-IgE Product, subject
     to certain rights which Tanox has in Taiwan, Korea, Singapore, China and
     Hong Kong according to a separate agreement and the rights for Japan as set
     out in Section 11 hereafter. No specific compensation shall be due to
     Genentech by Ciba for these rights.

4.   MANUFACTURE

     Ciba and Genentech together with Tanox (to the extent they are exercising
     their rights of co-manufacturing) shall share in the responsibility for
     assuring adequate product supply necessary for commercialization of the
     anti-IgE Product. Genentech shall, on request of Ciba, manufacture the
     jointly selected anti-IgE Product up to a quantity of * of the anti-IgE
     antibody per year and shall sell the anti-IgE Product to the appropriate
     selling organizations in the US, Europe and the rest of the world at a
     price equal to the full manufacturing cost as defined in the Appendix
     hereto, plus an uplift of *. The parties also shall consider and, as
     appropriate, reach agreement on plans to assure adequate product supply in
     the event such * quantity is insufficient to meet projections for product
     requirements reasonably established by mutual agreement of the parties. The
     parties acknowledge that such manufacturing by Genentech and any
     manufacturing by Ciba shall be subject to Tanox's co-manufacturing rights
     under the D&L Agreement and the terms of a manufacturing and supply
     agreement to be negotiated between Tanox and the purchasing party in the
     manner contemplated by the D&L Agreement. Tanox agrees to waive its rights
     to compensation for relinquishing its rights under the D&L Agreement to
     manufacture * of such * which may be manufactured by Genentech, but Tanox
     does not waive its right prospectively to exercise its co-manufacturing
     rights. If Genentech terminates its cooperation hereunder, it shall
     continue to be bound by the above supply obligation for a reasonable period
     of time to establish an alternative
<PAGE>
                                      -4-

     supply source for the anti-IgE Product, such period to be mutually agreed
     upon in the Definitive Agreement.

     The manufacturing price paid to Genentech shall constitute a cost element
     in the calculation of the cost/net profit to be shared according to Sec.
     3.1 paragraphs 2 and 3 and Sec. 3.2 paragraph 2.

     In the event that there should not be enough anti-IgE Products available
     to meet the requirements of the different markets the available quantities
     shall be allocated pro rata to the respective potential in these markets.

5.   ROYALTIES AND MILESTONE PAYMENTS TO TANOX

5.1  Tanox is entitled to a royalty on the net sales of the anti-IgE product in
     the USA, as set out in the D&L Agreement, which amounts to * of such US
     net sales (or * if there is no valid Tanox patent), plus (i) * on *
     of such US net sales, payable by Genentech, and (ii) * of Ciba's net
     profits from the commercialization of the anti-IgE Product in the US,
     payable by Ciba.

5.2  For the sales of the anti-IgE Product in Europe and the rest of the world,
     Tanox shall be paid the royalties specified in the D&L Agreement.

5.3  The milestone payments payable to Tanox specified in the D&L Agreement
     shall become due regardless of whether the anti-IgE Product selected
     originates from Tanox or Genentech and, except for payments due for NDA/PLA
     submission and approval in Japan, shall be included in the cost to be
     shared according to Section 2 above.

5.4  Payments made to Tanox in connection with development activities undertaken
     by Tanox for the anti-IgE Project/Product after the Selection Date shall be
     included in the cost to be shared according to Section 2 above. The parties
     acknowledge and agree that for 1996 the already approved Tanox budget will
     continue. For 1997 the Tanox budget will be similar to that of 1996, unless
     Genentech, Tanox and Ciba conclude that activities at Tanox for 1997 would
     result in a significant reduction of Tanox's 1997 budget. In such event
     Ciba, Genentech and Tanox will negotiate in good faith an appropriate
     payment in addition to such reduced budget covering Tanox's reasonable cost
     for phase-out of its activities. Such payment, however, shall not exceed
     * of the budget calculated for the last full 12 months prior to the
     Selection Date. For subsequent years thereafter, development activities
     which should be undertaken by Tanox so as to maintain its active
     involvement will be agreed by Ciba, Genentech and Tanox and a Tanox budget
     will be submitted for approval in accordance with current procedures.
<PAGE>
                                      -5-

6.   LICENSES

     Each party hereto shall grant to the other party any and all licenses
     and/or sublicenses (to the extent possible and subject to payment of the
     appropriate royalty or other payment amount due to third parties, such
     payment to be borne or shared by the parties as otherwise provided herein,
     or if not provided herein, then only if the party sublicensed pays such
     royalty or amount) under their respective present and future patent rights,
     other intellectual property rights, licenses, know-how, technology, cell
     lines, materials, etc. they own and/or control to the extent they are
     required for or are to be used by the parties as jointly agreed for the
     development, manufacture, use and sale of the anti-IgE Product. No other
     compensations for these licenses shall be due than those set out in this
     outline.

     Each party hereto represents that it does not have knowledge of any such
     rights that it currently owns and to which it currently has a license which
     cannot be made accessible to the other parties hereto.

     To the extent any such rights of a party are not licensable or
     sublicensable such party shall take reasonable actions to permit the
     commercialization of the anti-IgE Product on a reasonable basis in the
     light of the restrictions to which it is subject.

7.   SETTLEMENT

7.1  The parties hereto shall dismiss all claims filed in the lawsuits against
     each Genentech and F. Hoffmann-La Roche Ltd. and its three affiliates
     concerned on the one side and Ciba and Tanox on the other side pending and
     consolidated with the US District Court for the Southern District of Texas,
     Houston Division (the "Litigation").

7.2  Except as may be otherwise agreed between some of the parties hereto, each
     party shall bear all cost and expenditure incurred by it under or in
     connection with the above lawsuits.

8.   CONDITIONS PRECEDENT

8.1  The parties are aware that the envisaged terms of settlement set out herein
     might need clearance by the relevant authorities and agree to cooperate via
     their internal and external experts in this respect.
<PAGE>
                                       -6-

8.2  The parties shall negotiate in good faith and enter into (a) detailed
     agreement(s) (the "Detailed Agreement") implementing and completing the
     terms outlined herein within 6 months from the execution of this Outline.

9.   PUBLICATIONS

     Unless otherwise agreed in advance in writing among all parties hereto,
     none of the parties hereto shall directly or indirectly make any public
     statement, press release or give any information to the public about this
     Outline of Terms and the Detailed Agreement to be entered into pursuant
     hereto. However, this restriction shall not apply to disclosure of
     information which the parties acknowledge will be set forth in press
     release with agreed upon text and release date and time, to be prepared
     following execution of the Outline of Terms, and to statements,
     information, or announcements required by law, regulation or administrative
     action to be disclosed including disclosure to (prospective) investors in
     the securities of a party. In such event, the parties shall promptly
     coordinate to the extent possible, the wording of any such disclosures.
     This restriction on publication shall not be applicable to disclosures made
     to third parties who are subject to non-disclosure or confidentiality
     obligations.

10.  CONFIDENTIALITY

10.1 Any information and data disclosed by a party to another party hereto (the
     "Receiving Party" in the context of the selection, development and
     commercialization of the anti-IgE Product shall be kept strictly
     confidential by the Receiving Party, shall not be disclosed to any third
     party by the Receiving Party and shall not be used by the Receiving Party
     for any purpose other than those contemplated under this Outline of Terms,
     the D&L Agreement and the Detailed Agreement.

10.2 The obligations set out in Section 10.1 above shall not apply to
     information and data of which the receiving party can show that it:

     (i) is or has become generally available to the public otherwise than
         through violation of the obligation set out in Section 10.1 above;

     (ii) has been received from a third party who did not acquire it directly
          or indirectly from the disclosing party.

     Notwithstanding the above, the parties may disclose such information (a) to
     the extent as required to be disclosed to comply with applicable laws, to
     defend or
<PAGE>
                                      -7-

     prosecute litigation or to comply with governmental regulations including
     disclosure to {prospective) investors in the securities of a party,
     provided that the receiving party provides prior written notice of such
     disclosure to the disclosing party and takes reasonable and lawful actions
     to avoid and/or minimize the degree of such disclosure, and (b) to their
     legal representatives, to affiliates and their legal representatives, and
     to consultants to the extent such disclosure is intended to further the
     purposes contemplated under this Outline of Terms, the D&L Agreement, and
     the Detailed Agreement, provided such legal representatives, affiliates and
     consultants are covered by obligations of confidentiality with respect to
     such information no less stringent than those set forth herein, and to
     further (c) in connection with publications, lectures, seminars or other
     presentations with respect to which all parties hereto have agreed in
     advance in writing.

11.  RIGHTS RESERVED TO ROCHE

11.1 The parties acknowledge that Genentech is a party to certain agreements
     with F. Hoffman-La Roche Ltd. and certain of its affiliates (collectively,
     "Roche") under which Roche has certain rights to products being developed
     by Genentech ("G/R Agreements"). In the event Roche exercises its rights
     under the G/R Agreements, Genentech and Roche have requested that certain
     rights to participate in the commercialization of the anti-IgE Product be
     reserved to Roche. Subject to receipt by Ciba and Tanox of a joint
     notification by Roche and Genentech of Roche's exercise of rights under the
     G/R Agreements and to its joinder in this Outiine of Terms and the Detailed
     Agreement implementing and completing the terms outlined herein, the
     parties agree to reserve for Roche's benefit certain rights to participate
     in commercialization of the anti-IgE Product in Europe and Japan as set
     forth in this Section 11.

11.2 For Europe and Japan, Roche shall have an option to participate in the
     commercialization of the anti-IgE Product according to the following terms:

     Roche's option, which shall be established and may be exercised on a
     country-by-country basis, will be subject to the anti-IgE Product having a
     significant "general practitioner potential" ("GP potential") in each
     country. The GP potential of the anti-IgE Product is characterized in
     particular by the following (cumulative) criteria: (i) clinical activity in
     patients with mild to moderate allergic asthma and/or allergic rhinitis is
     demonstrated; (ii) a patient friendly formulation (e.g. inhalation device
     or pen for autoinjection); {iii) safety profile of the Product and its
     application is adequate for self-administration; (iv) dose level and cost
     for the galenical formulation and/or a device, such as to permit pricing
     accepted for reimbursement by social security schemes in the respective
     country with a sufficient gross margin to support the business case for
     co-promotion.
<PAGE>
                                      -8-

     The envisaged commercialization scheme in Europe would be a co-promotion by
     Roche of the anti-IgE Product sold by Ciba wherever legally possible and,
     in those countries in Europe where no co-promotion is possible, each of
     Ciba and Roche may market and sell the anti-IgE Product under different
     trademarks on its own. The commercial terms and conditions e.g. modus of
     exercising of the option (until submission of marketing authorization to
     the competent authorities at the latest), time and manner in which
     reimbursement/sharing of development costs will occur, and manner in which
     co-promotion sales will be attributed to each party, etc., will be part of
     the detailed agreement(s) referenced in Section 8.2. It is understood,
     however, that each Ciba and Roche should be able to make bookings of sales
     in the same order of magnitude.

11.3 For each country in Europe in which Roche exercises its option, Ciba agrees
     to share profits on a * basis under a co-promotion scheme, subject also
     to a * sharing of all development and commercialization costs as
     provided in Sections 2 and 3 above, in lieu of the * cost and profit
     sharing for Europe otherwise provided in such Sections 2 and 3. For any
     country in Europe in which Roche chooses not to exercise its option, the
     cost and profit sharing ratios will continue to be * between Ciba and
     Genentech, as set out in Section 3.2 paragraph 2 above. In case of a
     co-marketing in a country Ciba and Roche shall negotiate in good faith the
     terms and conditions of such co-marketing in that country on the basis of a
     * sharing of the pertaining development cost, but, with respect to that
     country no sharing of marketing cost nor profit sharing neither between the
     co-marketing parties nor according to sections 2 and 3 above shall apply.
     If Roche exercises its option hereunder only for a limited number but not
     for all countries in Europe, then the costs to be shared in each country in
     which Roche exercises its option(s) will be based on a allocation of all
     development and commercialization costs attributable to Europe on a pro
     rata basis to each such country in a manner to be agreed upon according to
     the prospective sales potential for the anti-IgE Product in each of the
     countries in Europe. Profits for each such country will be based on total
     sales revenues for the anti-IgE Product in each such country.

11.4 At the time Roche exercises its option for any country in Europe, Roche and
     Genentech shall notify Ciba of their agreement regarding which of them will
     be responsible for the costs to be shared or whether each will share a
     portion thereof and regarding the manner in which they will participate in
     the profits to be shared. Such notice will be accompanied by payment of an
     amount sufficient to reduce Ciba's share in those costs already shared on a
     * basis to *.

11.5 In Japan, subject to Roche's participation in co-development of the
     anti-IgE Product for Japan, Roche shall have an option to market and sell
     the approved anti-IgE Product on its own under a different trademark. To
     maintain its rights for Japan hereunder, Roche shall have twelve (12)
     months from the date of execution of this Outline of Terms in which to
     notify Ciba and Tanox of its
<PAGE>
                                      -9-

     election to participate in the development of the anti-IgE Product for
     Japan. At such time as Roche notifies Ciba of such election, Roche shall be
     obligated to reimburse Ciba for * of all development costs incurred by
     Ciba for development in Japan since the Selection Date and Roche shall be
     entitled immediately to participate with Ciba/Tanox in the development
     activities in Japan on the basis of a * sharing of development cost
     including the milestone payments to Tanox due on filing and grant of
     NDA/PLA in Japan, as specified in the D&L Agreement. In the event that it
     should become evident that "the anti-IgE Product has no GP Potential in
     Japan, contrary to prior expectations, Ciba and/or Roche may chose to
     terminated the joint development in Japan, and Ciba shall retain all
     further rights to development and commercialization of the anti-IgE Product
     in Japan against reimbursement of Roche's development cost including
     milestone payment, if any incurred.

11.6 The parties acknowledge that the detailed agreement(s) contemplated under
     Section 8.2 will contain provisions which complete and implement the terms
     outlined in this Section 11. The parties agree that Roche may participate
     in negotiations relating to such provisions whether or not Roche has
     exercised its rights under the G/R Agreements so that Roche will have the
     opportunity to participate in establishing the detailed terms governing the
     rights reserved to Roche hereunder.

12.  EARLY TERMINATION

     Genentech may terminate the cooperation hereunder at any time during the
     development of the Anti-IgE Product by giving 120 days prior notice to Ciba
     and Tanox and paying all amounts due hereunder up to such termination date.
     If Genentech terminates its cooperation hereunder, Roche shall have the
     option exercisable for a period of 30 days after Genentech's termination,
     to assume all of Genentech's rights and obligations hereunder. If Roche
     does not exercise such option, all of Genentech's rights under this
     cooperation, except for rights with respect to which Roche has exercised
     its options under Section 11, shall revert to Ciba, which shall be entitled
     to continue the development and to commercialize the Anti-IgE Product on
     its own or with Roche, as the case may be, without further compensation to
     Genentech, and which shall assume Genentech's obligations hereunder.

     Ciba may terminate the cooperation hereunder at any time during the
     development of the Anti-IgE Product by giving 120 days prior notice to
     Genentech and Tanox and paying all amounts due hereunder up to such
     termination date. Such notice also shall act as notice to Tanox of Ciba's
     termination of the D&L Agreement In such event, subject to the rights of
     the parties hereunder, the termination
<PAGE>
                                      -10-

     provisions of the D&L Agreement shall govern such termination. Genentech
     and, as applicable, Roche shall be entitled to continue development in the
     U.S., Europe and Japan, as the case may be, in Ciba's stead, subject to
     assuming Ciba's obligations hereunder, and to reimbursing Tanox for any
     compensation which may be payable by Tanox to Ciba as a result of such
     termination. Tanox shall have and retain exclusive rights for the
     commercialization of the Anti-IgE Product in all other countries in the
     world.

13.  BINDING NATURE

     The contents of this Outline of Terms represent the bona fide intent of the
     parties. The parties hereto shall use all reasonable effort to complete the
     final agreement(s) as referred to in Section 8.2 above as soon as
     reasonably practicable. It is understood, however, that unless and until
     the said formal agreement(s) is/are completed and entered into the parties
     (including their legal successors) shall be legally bound by and shall
     operate under the terms reflected in the present Outline of Terms, which
     shall be governed by the laws of the State of New York without regard to
     conflict of law principles.


TANOX BIOSYSTEMS INC.:                                        Date: July 8, 1996


By: /s/ David Anderson
David Anderson
Executive Vice President


GENENTECH INC.:                                               Date: July 8, 1996
/s/ ILLEGIBLE

GENENTECH INTERNATIONAL LIMITED:                              Date: July 8, 1996
/s/ ILLEGIBLE

CIBA-GEIGY LIMITED:                                           Date: July 6, 1996

Dr. Herbert Gut                                               Dr. H. F. Mohr
Senior Division Counsel                                       Head of
                                                              Pharma Licensing
<PAGE>
                                                    APPENDIX TO OUTLINE OF TERMS

DEFINITION OF FULLY BURDENED MANUFACTURING COST

Genentech's Fully Burdened Manufacturing Cost shall mean:

(a)  the actual direct cost associated with the manufacture of the Anti-IgE
     Product. i.e. direct material cost, direct labor cost, direct equipment
     cost, direct facility expense, direct quality control expense, direct
     energy cost, direct environmental expense, provided, however, that such
     actual direct cost shall not include cost associated with idle plant
     capacity, plus

(b)  an allocation of Genentech's overhead cost associated with such
     manufacture, up to a maximum of fifty percent of the actual price cost,
     which allocation for manufacturing overhead shall be made in accordance
     with U.S. Generally accepted cost accounting principles consistently
     applied by Genentech across all similar pharmaceutical manufacture
     operations, plus

(c)  Genentech's allocable intellectual property acquisition, licensing and
     royalty cost paid to third parties (except Tanox) upon the sale of Anti-IgE
     Products to third parties, plus

(d)  any other costs borne by Genentech for transport, customs clearance and
     storage of Anti-IgE Product, to the extent necessary (i.e. freight, duty,
     insurance and warehousing).

                                                                   EXHIBIT 10.15

CERTAIN INFORMATION IN THIS EXHIBIT IS SUBJECT TO A REQUEST FOR CONFIDENTIAL
TREATMENT. IN ACCORDANCE WITH RULE 406 UNDER THE SECURITIES ACT OF 1933, AS
AMENDED, SUCH INFORMATION HAS BEEN OMITTED AND FILED SEPARATELY WITH THE
SECURITIES AND EXCHANGE COMMISSION. THE LOCATION OF SUCH OMITTED INFORMATION HAS
BEEN INDICATED WITH AN ASTERISK(*).

                                                              CONFIDENTIAL
                                                          TANOX BIOSYSTEMS, INC.

                             SUPPLEMENTAL AGREEMENT

Tanox and Ciba currently are engaged in settling certain litigation with
Genentech and Roche. In connection with the settlement of such litigation,
Tanox, Ciba and Genentech (and possibly certain Roche entities) have entered
Into an agreement (the "Multiparty Transaction" under which Genentech merges its
anti-IgE antibody project with the anti-IgE antibody project of Tanox/Ciba which
is being pursued under a Development and License Agreement between Tanox and
Ciba dated May 11, 1990 (the "D&L Agreement").

Tanox and Ciba also are party to a Loan Agreement dated effective December 13,
1994, pursuant to which Ciba has agreed to loan up to $10 million for the
construction, validation, and start-up of a mammalian cell culture pilot
manufacturing facility located in Houston, Texas (the "Pilot Plant").

To further facilitate the cooperation between them in connection with the
Multiparty Transaction and the development of the respective anti-IgE antibody
product ("Anti-IgE Product") project, Tanox and Ciba intend to enter into an
agreement which modifies and amends their agreements to the extent of the
provisions set forth below.

1.0  DEVELOPMENT IN CERTAIN FAR EAST COUNTRIES

     1.1 MERGER OF RIGHTS IN EA COUNTRIES. Pursuant to the D & L Agreement,
     Tanox has retained certain commercialization rights for the Anti-IgE
     Product in the territories of Taiwan, Hong Kong, Singapore, China and Korea
     (the "EA Countries"). Ciba also has certain commercialization rights for
     Anti-IgE Product in such EA Countries. As part of this Addendum to the D &
     L Agreement, Tanox and Ciba agree to merge their rights in the EA Countries
     into a combined development and commercialization program for the Anti-IgE
     Product, in which each shall share all development and commercialization
     costs as set out in Section 1.4 below and net profits before taxes from
     commercialization of the Anti-IgE Product on a 50:50 basis.

     1.2 TANOX DEVELOPMENT COMPANY. The parties acknowledge that all or a
     portion of Tanox's rights and responsibilities for development and
     commercialization of the Anti-IgE Product in the EA Countries may be
     undertaken by (a) company(ies) formed by Tanox for such purpose ("EA
     Company"), which may be financed in part by third parties as shareholders
     and in which Tanox shall have the control, i.a. by having a majority of the
     voting rights as shareholder.

     1.3 DEVELOPMENT AND COMMERCIALIZATION ACTIVITIES. The parties shall
     cooperate fully in connection with the development and commercialization of
     the Anti-IgE Product. Tanox shall assume primary responsibility in
     coordination with the Steering Committee (as defined in the D & L
     Agreement) for pursuing any additional
<PAGE>
Supplemental Agreement
June 10, 1996
Page 2

     development activities in the EA Countries which may be necessary or
     beneficial in connection with obtaining product registration and marketing
     approval in such countries. Ciba shall have the right to market and sell
     the Anti-IgE Product following marketing approval. Tanox shall have the
     right to supply product to the EA Countries at cost from its pilot facility
     in Houston, Texas, and/or from a facility owned and operated by the EA
     Company. To the extent Tanox is unable to supply all the product which may
     be required for the EA Countries, such product also may be purchased from
     Genentech or supplied by Ciba, as applicable.

     1.4 COST AND PROFIT SHARING. All costs associated with development
     activities undertaken for commercialization of the Anti-IgE Product in the
     EA Countries, which may include production of clinical materials, clinical
     trials and other activities for obtaining marketing authorization, and
     supporting activities/services and fees, shall be shared between Ciba and
     Tanox or the EA Company on a 50:50 basis. All costs for the
     manufacturing/purchase of the Anti-IgE Product and the costs for marketing
     and sales in the EA Countries, including all supporting and auxillary
     activities and royalties to third parties (if any) also shall be shared
     between Ciba and Tanox or the EA Company on a 50:50 basis. All net profits
     before taxes from commercialization of the Anti-IgE Product in the EA
     Countries shall be shared between Ciba and Tanox or the EA Company on a
     50:50 basis.

2.0  REIMBURSEMENT OF CIBA'S PATENT LITIGATION COSTS

     2.1 REIMBURSABLE COSTS. Tanox agrees that it will reimburse Ciba in the
     manner agreed below for * of its ex-pocket expenditures for
     attorneys' fees and expenses, document discovery, and compensation for
     expert's opinions which are directly related to Ciba's defense of
     Genentech's patent claims against it for infringement of the U.S. "Cabilly"
     patent and/or Ciba's counterclaims against Genentech for invalidation of
     such patent. Ciba agrees that reimbursable ex-pocket expenditures shall not
     include any expenditures which have been incurred by Ciba following
     February 15, 1996, and shall not include any expenditures relating to
     representation of Ciba's interests outside the scope of the patent claims
     and counterclaims as defined above, including, without limitation, any
     attorneys' fees incurred in connection with representation of Ciba in the
     multiparty settlement discussions or bilateral discussions between Tanox
     and Ciba.

     2.2 DOCUMENTATION. Promptly following execution of the agreement
     contemplated hereby, Ciba agrees to submit copies to Tanox of appropriate
     invoices or other documentation for such ex-pocket expenditures to be
     claimed for reimbursement hereunder so that Tanox can confirm that all such
     charges are
<PAGE>
Supplemental Agreement
June 10, 1996
Page 3

     properly within the scope of the ex-pocket expenditures agreed to be
     reimbursable hereunder.

     2.3 REIMBURSEMENT BY OFFSET. All amounts due Ciba hereunder shall be paid
     solely by Ciba's offset of such amounts against royalties payable to Tanox
     by Ciba under the D & L Agreement or which are attributable to Ciba based
     on its profit sharing ratios under the Multiparty Transaction.

3.0  LOAN REPAYMENT OBLIGATION

     3.1 EFFECTIVENESS OF PROVISIONS. If the Multiparty Transaction is
     concluded, then as of such date, repayment of that certain $10 million loan
     ("Loan") from Ciba to Tanox for construction, validation and start-up of
     the Pilot Plant shall be governed by the provisions of this Paragraph 3.

     3.2 UTILIZATION OF FACILITY. The parties agree that (i) if Genentech's
     anti-IgE antibody is selected for development as of the Selection Date, as
     defined in the Outline of Terms entered into in connection with the
     Multiparty Transaction or (ii) if the parties to the Outline of Terms
     otherwise determine that activities currently contemplated for the Pilot
     Plant should be shifted to Genentech in whole or in part in connection with
     its agreement, on Ciba's request, to undertake commercial production of up
     to * of Anti-IgE Product, then Tanox shall have 120 days from receipt of
     written notice of the occurrence of either such event to notify Ciba of its
     intent to pursue one of the following alternatives:

     (a)  Tanox may notify Ciba that it has decided to shut down the Pilot Plant
          and terminate production activities effective as of a date mutually
          agreeable to the parties ("Shut-down Date"), subject to reactivation,
          as Tanox may wish, within five (5) years from the Shut-down Date
          (however, Tanox can continue to perform routine maintenance activities
          at its cost beneficial to reactivation of the facility); or

     (b)  Tanox may notify Ciba that it has decided to continue operation of the
          Pilot Plant at its own commercial and technical responsibility, in
          which case such decision shall become effective immediately on Ciba's
          receipt of such notice ("Continuation Date")

     3.3  SHUT-DOWN ALTERNATIVE. If Tanox has notified Ciba that it has decided
          to shut down the Pilot Plant, subject to reactivation as provided
          hereinafter, then at the expiration five (5) years from the Shut-down
          Date or on satisfaction of Tanox's obligations to Ciba following the
          Disposal Date, as hereinafter defined, whichever is the first to
          occur, Ciba shall forgive, without further
<PAGE>
Supplemental Agreement
June 10, 1996
Page 4

          action on its part, the principal balance and accrued interest
          remaining outstanding on the Loan at such time. Thereafter, Tanox
          shall have no further obligations under the Loan. During such
          five-year period, if Tanox should sell or otherwise dispose of the
          Pilot Plant (the "Disposal Date", then Tanox shall be obligated to pay
          to Ciba, in reduction of the outstanding principal and any unforgiven
          interest, the proceeds from such disposal net of all reasonable costs
          accrued during such period in connection with the maintenance of the
          shut-down Pilot Plant. Tanox shall pay such net proceeds to Ciba
          within 90 days following the Disposal Date. During such five-year
          period, if Tanox should decide to reactivate the Pilot Plant for
          production activities, then the provisions of Paragraph 3.4 below
          shall immediately become effective.

     3.4  CONTINUATION ALTERNATIVE. If Tanox has notified Ciba that it has
          decided to continue operation of (or reactivate, as the case may be)
          the Pilot Plant, then Tanox will be obligated at the end of each
          calendar year, beginning as of the first year end following the
          Continuation Date (or date of reactivation), to account for the
          operations of the Pilot Plant and determine Net Cash Flow available
          from operations as defined in Paragraph 3.5 below. On or before March
          31 of the succeeding year, Tanox will be obligated to apply 75% of Net
          Cash Flow first to payment of accrued interest for such year and then
          to reduction of the outstanding principal balance on the Loan. Tanox
          will be entitled to retain the remaining 25% of Net Cash Flow. If the
          75% Net Cash Flow payments due as set out above should not equal the
          Loan amount including accrued interest, at the end of 10 years from
          the Continuation Date (or date of reactivation), and following payment
          by Tanox of the amount to be applied against the Loan and accrued
          interest through such date based on an interim accounting for such
          final period, Ciba shall forgive, without further action on its part,
          the principal balance and all accrued interest for such period that
          remains outstanding on the Loan and Tanox shall have no further
          obligations under the Loan.


     3.5  ACCOUNTING FOR THE PILOT PLANT. At the end of each calendar year
          during which Pilot Plant operations are continued or reactivated, the
          Pilot Plant's Net Cash Flow will be computed and any payments required
          under Paragraph 3.4 above will be made on or before March 31 of the
          succeeding year. Net Cash Flow for purposes of this agreement will be
          the Pilot Plant's "net cash provided from operating activities" (as
          illustrated in SFAS No.95), *
<PAGE>
Supplemental Agreement
June 10, 1996
Page 5

          *. Allocable costs to the Pilot Plant shall be apportioned in a manner
          consistent with GAAP and Tanox's normal practices, which have been
          reviewed in connection with the preparation of Tanox's annual audited
          financial statements.

     3.6  INTEREST EXPENSE. As set out in the Loan Agreement, interest shall
          begin as of the Commencement Date (as defined in the Loan Agreement)
          for the Pilot Plant. If the Pilot Plant is shut down, then at the end
          of each calendar year in which the Pilot Plant remains shut down
          (provided no disposal has occurred), Ciba agrees to forgive all the
          interest accrued on the Loan for such year. If Tanox disposes of the
          Pilot Plant, the net proceeds of such disposal, as provided in
          Paragraph 3.3 above, shall first be applied to payment of accrued
          interest on the Loan for the year in which disposal occurs and then to
          reduction of the outstanding principal balance.

The contents of this supplemental agreement represent the bona fide intent of
the parties who shall negotiate and enter into a more detailed agreement in
line with the provisions set forth above.

Ciba-Geigy Limited                               Tanox Biosystems, Inc.
By: H. F. MOHR                                   By: DAVID ANDERSON
Name: Dr. H. F. Mohr                             Name: David Anderson
Title: Head Pharma Licensing                     Title: Executive Vice President
Date:                                            Date: July 8, 1996

By: HERBERT GUT
Name: Dr. Herbert Gut
TItle: Senior Division Counsel
Date: July 6, 1996

                                                                   EXHIBIT 10.16


                    SETTLEMENT AND CROSS-LICENSING AGREEMENT

   This Settlement and Cross-Licensing Agreement ("Agreement") is entered into
effective as of July 8, 1996 ("Effective Date") between Tanox Biosystems, Inc.,
a Texas corporation, with its principal offices at 10301 Stella Link, Houston,
Texas 77025 ("Tanox") and Genentech, Inc., a Delaware corporation, with its
principal offices at 460 Point San Bruno Boulevard, South San Francisco,
California 94080-4990 and Genentech International Limited, a Bermuda
corporation, with its principal offices at Reid House, 31 Church Street,
Hamilton HM 12 Bermuda (the term "Genentech" as used herein shall mean
Genentech, Inc., and/or Genentech International Limited, as appropriate).

   Tanox and Genentech, Inc. are parties to a lawsuit, Civil Action No.
H-94-0189, in the United States District Court for the Southern District of
Texas, Houston Division, styled TANOX BIOSYSTEMS, INC. V. GENENTECH, INC. ET AL.
resulting from the consolidation of Civil Action No. H-94-0239, styled TANOX
BIOSYSTEMS, INC. V. GENENTECH, INC., ET AL. with Civil Action No. H-94-0189,
styled GENENTECH, INC. V. TANOX BIOSYSTEMS, INC. (the "Lawsuit"), which they
desire to settle.

   Tanox and Genentech, together with Ciba-Geigy, Ltd. ("Ciba"), have also
reached an agreement in principle under which Genentech and Tanox and Ciba would
merge their respective anti-IgE antibody projects and such agreement has been
memorialized in an Outline of Terms (a copy of which is attached hereto as
Exhibit 1), which Tanox, Genentech and Ciba are executing to be effective
simultaneously with this Agreement and which provides for the development and
commercialization of one or more anti-IgE products (the "Multiparty
Transaction").

   In addition to their execution of the Outline of Terms, Tanox and Genentech
wish to enter into this agreement to: (i) release and indemnify each other from
and settle all claims which each may have against the other in connection with
the Lawsuit; (ii) license certain patent rights which each of the Parties has
and desires to obtain from the other; and (iii) reflect all other agreements
between the Parties relating to the settlement of the Lawsuit, the Multiparty
Transaction, and the licensing of such patents by each Party to the other.


                                       1
<PAGE>
   Therefore, Tanox and Genentech agree as follows:

   1.0 DEFINITIONS. In addition to the words otherwise used as defined terms
throughout this Agreement, the words set forth below will have the meanings
indicated when used in this Agreement.

       1.1"AFFILIATE" shall mean (i) an organization fifty (50%) percent or more
of the voting stock of which is owned and/or controlled directly or indirectly
by a Party; (ii) an organization which directly or indirectly owns and/or
controls fifty percent (50%) or more of the voting stock of a Party; (iii) an
organization which is directly or indirectly under common control of a Party
through common share holdings; or (iv) an organization as to which a Party can
demonstrate that the operation and management of such organization is under the
control, directly or indirectly, of the Party.

       1.2"AGGREGATE ANNUAL NET SALES" shall mean the aggregate of Net Sales
each calendar year for all Genentech Licensed Products.

       1.3"ALL CLAIMS" shall mean all existing and future claims, demands, and
causes of action, known or unknown, pending or threatened, for all existing and
future damages and remedies (i) that arise out of or are in any way related to
the Incident and (ii) that were brought, could have been brought, or were sought
to be brought in the Lawsuit. Under this definition, "All Claims" includes but
is not limited to all claims, demands, lawsuits, debts, accounts, covenants,
liens, encumbrances, agreements, actions, counterclaims, cross-actions,
liabilities, obligations, losses, attorney's fees, costs, expenses, remedies,
and causes of action of any nature, whether in contract or in tort, or based
upon fraud or misrepresentation, breach of duty or common law, or arising under


                                       2
<PAGE>
or by virtue of any judicial decision, federal, state or foreign statute or
regulation, for past, present, and future damages, property or economic damage,
and for all other losses and damages of any kind, including BUT NOT LIMITED TO
the following: all actual damages; all exemplary and punitive damages; all
penalties of any kind, including WITHOUT LIMITATION any tax liabilities or
penalties; lost profits or goodwill; consequential damages; damages ensuing from
loss of credit; damages ensuing from breach of the covenant or duty of good
faith and fair dealing; damages ensuing from breach of any federal, state, or
foreign antitrust law; damages ensuing from breaches of confidential and
fiduciary duties; damages ensuing from breach of contract; damages ensuing from
actual or constructive fraud; and prejudgment and postjudgment interest, costs,
and attorney's fees.


       1.4"ANTI-IQE ANTIBODY(IES)" shall mean an antibody directed against the
immunoglobulin IgE as an antigen, fragments or conjugates of such antibodies,
and other constructs comprising antibodies which are derived from or contain any
of the above-specified components.

       1.5"COMBINATION PRODUCT" shall mean any pharmaceutical formulation or
method or system for use in humans which contains (i) an Anti-IgE Antibody and
(ii) at least one other ingredient or substance which is also Therapeutically
Active or a device that enhances application and use of an Anti-IgE Antibody and
is sold as part of a product or system that contains an Anti-IgE Antibody.
"THERAPEUTICALLY ACTIVE" shall mean biologically active but shall not include
diluent, vehicles or specific adjuvants or any other ingredient or substance
which does not have any, or has only incidental, therapeutic properties when
present alone and is included to aid or enhance the activity of an Anti-IgE
Antibody.

       1.6"CONSIDERATION" shall mean the value or benefit to each of the
Parties, respectively, of the licenses, royalties, payments and agreements
contained herein and in the Outline of Terms and all other mutual promises,
covenants, agreements, releases, and representations set forth in this
Agreement.


                                       3
<PAGE>
       1.7"CROSS-LICENSE PROVISIONS" shall mean those provisions of this
Agreement set forth in Sections 4.0, 5.0, 6.0 and 7.0.

       1.8"FIRST COMMERCIAL SALE" shall mean the date of the first commercial
sale to an independent third party by a Party or its sublicensee of a Licensed
Product in a country following appropriate regulatory approval to sell such
Licensed Product in such country.

       1.9"GENENTECH LICENSED PRODUCT" shall mean any pharmaceutical formulation
or product or method or system which contains an Anti-IgE Antibody (excluding
any Anti-IgE Antibody identified and synthesized by Tanox and/or Ciba) and which
is made, used or sold by Genentech or a sublicensee of Genentech hereunder and
which is not a product made, used or sold by Genentech or a sublicensee of
Genentech under the Outline of Terms or Definitive Agreement.

       1.10 "GENENTECH NET SALES" shall mean the gross invoiced sales price
charged by Genentech or its sublicensees hereunder for Genentech Licensed
Products in arm's length sales to third parties (excluding sales for clinical
trial purposes), after deduction of the following items, to the extent that such
items were incurred during such calendar quarter with respect to sales of
Genentech Licensed Products hereunder regardless of the calendar quarter in
which such sales were made, are included in the price charged, and do not exceed
reasonable and customary amounts in the market in which such sale occurred:

   (i)   trade and quantity discounts or rebates;

   (ii)  credits or allowances given or made for rejection or return of and for
         uncollectible amounts on previously sold Genentech Licensed Products or
         for retroactive price reductions to distributors holding existing
         product inventories to conform to reductions in the price charged for
         new purchases of product;


                                       4
<PAGE>
   (iii) any tax or government charge (other than an income tax) levied on the
         sale, transportation or delivery of a Genentech Licensed Product and
         borne by the seller thereof; and

   (iv)  any charges for freight or insurance in a CIF (cost, insurance,
         freight) sale.

       1.11 "GENENTECH PATENTS" shall mean those patents owned in whole or in
part now or in the future by Genentech and those patents to which Genentech has
a license as of the Effective Date or in the future acquires a license and under
which Genentech is free to grant a sublicense to Tanox for a Tanox Licensed
Product, and which contain a Valid Claim covering the manufacture, use or sale
of an Anti-IgE Antibody or a Tanox Licensed Product; provided, however, with
respect to patents to which Genentech is a licensee, Tanox provides notice to
Genentech that it wishes to receive a sublicense and agrees to pay Genentech
such royalties, fees or similar payments that Genentech is obligated to make to
its licensor for the grant of the license or for the manufacture, use or sale of
a Tanox Licensed Product by Tanox or its sublicensee, adjusted as appropriate
for the scope of the sublicense granted.

       1.12 "GENENTECH TERRITORY" shall mean every country in the world and the
territories and possessions of each such country, other than South Korea, North
Korea, People's Republic of China, Taiwan, Singapore and Hong Kong.

       1.13 "INCIDENT" shall mean the negotiations, beginning in 1989 and ending
in December 1993, between Tanox and Genentech with regard to a potential
collaboration in the identification and development of anti-immunoglobulin E
("anti-IgE") monoclonal antibodies and anti-IgE therapy; the agreements entered
into pursuant to those negotiations, as well as any supplements or amendments to
those agreements ("the


                                       5
<PAGE>
Collaboration Agreements"), including but not limited to a Confidentiality
Agreement dated (by Tanox) March 29, 1989 and a Biological Material Transfer and
Confidentiality Agreement dated (by Tanox) July 27, 1989; negotiations
concerning the construction and meaning of the Collaboration Agreements; the
performance of the Collaboration Agreements; any interference in the performance
of the Collaboration Agreements; any statements regarding the performance of the
Collaboration Agreements; any acts or events prior to or subsequent to the
negotiation or execution of the Collaboration Agreements that form the basis of
any cause of action alleged in or that could have been alleged in the Lawsuit;
any other matters arising out of the Collaboration Agreements; the use
heretofore by Genentech of information provided by Tanox to Genentech or to any
of Genentech's employees or agents pursuant to the Collaboration Agreements (or
otherwise during the time period of such negotiations 1989 to December 1993);
the solicitation and obtaining of licensing rights heretofore from third parties
in the area of monoclonal antibody research and technology; the research,
development and commercialization of anti-IgE monoclonal antibodies and/or
anti-IgE therapy heretofore; any infringement heretofore of patents rights held
at any time by the Parties to this Agreement regarding recombinant
immunoglobulin preparations and monoclonal antibody identification and
development; and any statements or representations heretofore made by either
Party regarding research, development, and commercialization of anti-IgE
monoclonal antibodies and/or anti-IgE therapy.

       1.14 "LICENSED PRODUCT" shall mean either a Genentech Licensed Product or
Tanox Licensed Product, as appropriate.

       1.15 "NET SALES" shall mean either Tanox Net Sales or Genentech Net
Sales, as appropriate.

       1.16 "OUTLINE OF TERMS" shall mean the agreement between Tanox, Genentech
and Ciba attached hereto as Exhibit 1 which sets forth the basic terms agreed by
such parties with respect to the joint development and commercialization of
Anti-IgE Antibodies and which is intended to be superseded by a definitive
agreement(s) as contemplated by Section 8.2 of the Outline of Terms, which
agreement(s) is referred to as the ("Definitive Agreement").


                                       6
<PAGE>
       1.17 "PARTY" shall mean, when used in the singular, either Tanox or
Genentech, as appropriate, and "PARTIES" shall mean Tanox and Genentech.

       1.18 "PERSON" OR "PERSONS" shall include any natural person, as well as
any entity such as a corporation, partnership, proprietorship, or business
association.

       1.19 "PIVOTAL CLINICAL TRIAL" shall mean a controlled study in humans of
the efficacy and safety of a Genentech Licensed Product which is prospectively
designed to demonstrate statistically whether that Genentech Licensed Product is
effective for use in a particular indication and is intended to be sufficient,
if successful, (together with other necessary clinical trials) to obtain
approval from the U.S. Food and Drug Administration to sell that Genentech
Licensed Product in the United States. A Pivotal Clinical Trial could include a
Phase II clinical trial appropriately designed to be within this definition
(sometimes referred to as a Phase II/III trial) and would include a Phase III
clinical trial (as such terms are used generally in connection with
identification of clinical trial protocols).

       1.20 "PRODUCT LICENSE APPLICATION" shall mean an application, filed with
the U.S. Food and Drug Administration and accepted by that agency for filing,
for the purpose of seeking approval to sell a Genentech Licensed Product in the
United States.

       1.21 "TANOX LICENSED PRODUCT" shall mean any pharmaceutical formulation
or product or method or system (i) which contains an Anti-IgE Antibody
identified and synthesized by Tanox and/or Ciba, or (ii) other IgE inhibiting
antibodies within Tanox's MIGIS(R) program, and which, but for the licenses
granted hereunder, would infringe a Valid Claim of a Genentech Patent in the
country in which such formulation, product, method or system is made, used or
sold by Tanox or a sublicensee of Tanox.



                                       7
<PAGE>
       1.22 "TANOX NET SALES" shall mean the gross invoiced sales price charged
by Tanox or its sublicensees hereunder for Tanox Licensed Products in arm's
length sales to third parties (excluding sales for clinical trial purposes),
after deduction of the following items, to the extent that such items were
incurred during such calendar quarter with respect to sales of Tanox Licensed
Products hereunder regardless of the calendar quarter in which such sales were
made, are included in the price charged, and do not exceed reasonable and
customary amounts in the market in which such sale occurred:

   (i)   trade and quantity discounts or rebates;

   (ii)  credits or allowances given or made for rejection or return of and for
         uncollectible amounts on previously sold Tanox Licensed Products or for
         retroactive price reductions to distributors holding existing product
         inventories to conform to reductions in the price charged for new
         purchases of product;

   (iii) any tax or government charge (other than an income tax) levied on the
         sale, transportation or delivery of a Tanox Licensed Product and borne
         by the seller thereof; and

   (iv)  any charges for freight or insurance in a CIF (cost, insurance,
         freight) sale.

       1.23 "TANOX PATENTS" shall mean those patents owned in whole or in part
now or in the future by Tanox and those patents to which Tanox has a license as
of the Effective Date or in the future acquires a license and under which Tanox
is free to grant a sublicense to Genentech for a Genentech Licensed Product, and
which contain a Valid Claim covering the manufacture, use or sale of an Anti-IgE
Antibody or a Genentech Licensed Product; provided, however, with respect to
patents to which Tanox is a licensee, Genentech provides notice to Tanox that it
wishes to receive a sublicense and agrees to pay Tanox such royalties, fees or
similar payments that Tanox is obligated to make to its licensor for the grant
of the license or for the manufacture, use or sale of a Genentech Licensed
Product by Genentech or its sublicensee, adjusted as appropriate for the scope
of the sublicense granted.


                                       8
<PAGE>
       1.24 "VALID CLAIM" shall mean a subsisting claim of an issued and
unexpired patent that has not been held invalid, unpatentable or unenforceable
by a decision of a governmental body or count of competent jurisdiction, that is
unappealable or unappealed within the time allowed for appeal, and that has not
been rendered unenforceable through disclaimer.

       2.0 MUTUAL RELEASE, INDEMNIFICATION AND SETTLEMENT AGREEMENT

           2.1  DISMISSAL OF LAWSUIT. Tanox and Genentech agree as follows:

               (i)  Tanox and Genentech will each file motions to dismiss their
                    respective claims in the Lawsuit against each other, with
                    prejudice; and

               (ii) each of the Parties shall bear its own costs of court
                    incurred.

           2.2 RELEASE OF GENENTECH. For the Consideration, including the
agreements set forth in this Section 2, Tanox hereby RELEASES, ACQUITS, and
FOREVER DISCHARGES Genentech and (i) all of its present or former agents,
employees, officers, directors, shareholders, partners, joint venturers, and
attorneys; (ii) all companies, partnerships, joint ventures, or firms affiliated
with or subsidiary to, Genentech; (iii) its predecessors, successors, and
assigns; (iv) all other persons, partners, joint venturers, firms, partnerships,
joint ventures, and corporations for whose conduct Genentech may be liable; and
(v) all of its insurers from All Claims that have accrued or that may ever
accrue to Tanox or any person or persons now or hereafter claiming by, through,
or under Tanox.


                                       9
<PAGE>
           2.3 RELEASE OF TANOX. For the Consideration, including the agreements
set forth in this Section 2, Genentech RELEASES, ACQUITS, and FOREVER DISCHARGES
Tanox and (i) all of its present or former agents, employees, officers,
directors, shareholders, partners, joint venturers, and attorneys; (ii) all
companies, partnerships, joint ventures, or firms affiliated with or subsidiary
to Tanox; (iii) its predecessors, successors, and assigns; (iv) all other
persons, partners, joint venturers, firms, partnerships, joint ventures, and
corporations for whose conduct Tanox may be liable; and (v) all of its insurers
from All Claims that have accrued or that may ever accrue to Genentech or any
person or persons now or hereafter claiming by, through, or under Genentech.

           2.4 NO ADMISSION OF LIABILITY. The payment of any of the
Consideration is not an admission of liability and may not be so construed.
Genentech vigorously denies the position taken by Tanox in the Lawsuit and Tanox
acknowledges the highly disputed nature of its claims in the Lawsuit. Tanox
vigorously denies the position taken by Genentech in the Lawsuit, and Genentech
acknowledges the highly disputed nature of its claims in the Lawsuit. Each Party
acknowledges that this agreement is made as a compromise to avoid further
expense and to terminate for all time the controversies which were asserted,
could have been asserted, or were sought to be asserted in the Lawsuit.

           2.5 INDEMNIFICATION BY TANOX. Tanox agrees to INDEMNIFY and to DEFEND
and to HOLD HARMLESS Genentech and (i) all of its present or former agents,
employees, officers, directors, shareholders, partners, joint venturers, and
attorneys; (ii) all companies, partnerships, joint ventures, or firms affiliated
with or subsidiary to, Genentech; (iii) its predecessors, successors, and
assigns; (iv) all other persons, partners, joint venturers, firms, partnerships,
joint ventures, and corporations for whose conduct Genentech may be liable; and
(v) all of its insurers from All Claims, together with all costs, expenses, and
legal fees, that may be asserted against Genentech by any person, entity, firm,
or corporation claiming by, through, or under Tanox, that arise out of the
incident and/or the Lawsuit.


                                       10
<PAGE>
           2.6 INDEMNIFICATION BY GENENTECH. Genentech agrees to INDEMNIFY and
to DEFEND and to HOLD HARMLESS Tanox and (i) all of its present or former
agents, employee, officers, directors, shareholders, partners, joint venturers,
and attorneys; (ii) all companies, partnerships, joint ventures, or firms
affiliated with or subsidiary to Tanox; (iii) its predecessors, successors, and
assigns; (iv) all other persons, partners, joint venturers, firms, partnerships
joint ventures, and corporations for whose conduct Tanox may be liable; and (v)
all of its insurers from All Claims, together with all costs, expenses, and
legal fees, that may be asserted against Tanox by any person, entity, firm, or
corporation claiming by, through, or under Genentech, that arise out of the
Incident and/or the Lawsuit.

           2.7 WITHDRAWAL OF OPPOSITION. Genentech agrees that, simultaneously
with the filing of motions of dismissal under Section 2.1 above, it will file
all documents necessary to withdraw its pending opposition in the European
Patent Office to Tanox's patent No. EP-B-407392 relating to Anti-IgE Antibodies.

           2.8 EXEMPTION FROM PROTECTIVE ORDER. Notwithstanding the terms of the
protective order agreed in connection with the Lawsuit, the Parties agree that,
except for any persons reasonably excluded by notice from a Party to the other
prior to the execution of this Agreement, the employees, experts and consultants
of a Party having access to information during the course of the Lawsuit will
not be prohibited from participating in ongoing development and
commercialization activities associated with the Anti-IgE Antibody projects of
such Party and/or development and commercialization activities of the Parties
pursuant to the Outline of Terms or Definitive Agreement.

           2.9 REPRESENTATIONS OF TANOX. Tanox makes the representations and
warranties to Genentech set forth in Exhibit 2.

           2.10 REPRESENTATIONS OF GENENTECH. Genentech makes the
representations and warranties to Tanox set forth in Exhibit 3.


                                       11
<PAGE>
           3.0 EFFECTIVENESS OF CROSS-LICENSE PROVISIONS.

               3.1 OUTLINE OF TERMS. Simultaneously with the execution of this
Agreement, the Parties are executing the Outline of Terms. The Outline of Terms
and Definitive Agreement, together with that certain Development and Licensing
agreement dated May 11, 1990, between Tanox and Ciba (the "D & L Agreement"),
shall among them govern the development and commercialization of one or more
Anti-IgE Antibodies which have been identified and synthesized by Tanox, Ciba,
or Genentech before July 1, 1996. The Parties also acknowledge that, contingent
on the occurrence of certain events as set forth in Paragraphs 3.2 through 3.5
below, the Cross-License Provisions shall become effective in lieu of or in
addition to the Outline of Terms and Definitive Agreement. Notwithstanding any
representations and warranties in this Agreement to the contrary, the Parties
acknowledge that in the event of a conflict between this Agreement and the
Outline of Terms and Definitive Agreement, the Outline of Terms and Definitive
Agreement shall prevail and that the Parties are aware of Ciba's position (and
expressly disagree with and have advised Ciba of such disagreement) that it is
the exclusive licensee of Tanox Patents for Anti-IgE Antibodies. Each Party
agrees that it shall be solely responsible for any claims, damages (including
costs, expenses, and legal fees), or other liabilities of any nature asserted
against it by Ciba or any third party arising out of or in any way resulting
from the grant by Tanox to Genentech of rights hereunder to the Tanox Patents.
Further, Genentech acknowledges that the Outline of Terms does not limit or
prohibit in any way the exercise by Tanox of its rights under the D & L
Agreement with respect to Tanox Licensed Products, except as expressly stated in
the Outline of Terms or Definitive Agreement. Tanox acknowledges that the
Outline of Terms will not extend its independent rights of parallel product
development under the D & L Agreement to Anti-IgE Antibodies identified and
synthesized by Genentech.

               3.2 THIRD PARTY ACTIONS. If the Multiparty Transaction requires
approval from any regulatory or governmental authority or agency in the United
States, the European Union or its member countries, any other country in Europe,
or in Japan, or if


                                       12
<PAGE>
any governmental authority brings any action, formal or informal, against one or
more of the Parties to the Outline of Terms or Definitive Agreement in an effort
to enjoin, preclude, or prevent the Multiparty Transaction in whole or in part
("Government Action"), then the Parties shall meet and consider, in good faith,
how they should lawfully proceed in response to such event. If the Parties have
been unsuccessful either (i) after exhausting all reasonable possibilities which
do not jeopardize the timely commercialization of a Licensed Product or (ii) by
August 1, 1997, whichever is the last to occur, in obtaining any such approval
in any country where such approval is required, or in resolving the Government
Action, as the case may be, then upon notice by one Party to the other, the
Cross-License Provisions shall immediately become effective within any country
or countries in which any such approval has not been or cannot be obtained or
where any Government Action is being pursued.

               3.3 TERMINATION OF MULTIPARTY TRANSACTION. If the Outline of
Terms (or the Definitive Agreement if in effect), is terminated at any time,
then upon notice by either Party to the other the Cross-License Provisions shall
immediately become effective.

               3.4 ADDITIONAL PRODUCTS. If either Party should at any time
require a license of the type provided by the other Party under the
Cross-License Provisions for a Licensed Product that such Party may lawfully
develop notwithstanding the Multiparty Transaction, then such Party requiring
the license shall provide notice to the other of such requirement and,
immediately upon such notice, the Cross-License Provisions shall become
effective with respect to such Licensed Product.

               3.5 MUTUAL AGREEMENT. At any time after the execution of this
Agreement, if the Parties jointly agree in writing that the Cross-License
Provisions should be implemented, then the Cross-License Provisions shall become
effective as provided in such agreement.


                                       13
<PAGE>
               3.6 CROSS-LICENSE DATE. The Cross-License Provisions shall become
effective immediately upon the date the notice required under Sections 3.2, 3.3,
and 3.4, respectively is given in accordance with Section 13.4 ("Cross-License
Date") and shall be effective for the purpose or purposes specified in any such
notice and to the extent set forth in this Agreement.

    4.0 LICENSES TO GENENTECH UNDER TANOX PATENTS.

               4.1 GRANT OF LICENSE. Effective commencing upon the Cross-License
Date, Tanox grants to Genentech under all Tanox Patents, on a country-by-country
basis in the Genentech Territory, an exclusive, sublicenseable license to the
extent necessary to make, have made, use, sell, have sold and import Genentech
Licensed Products for the treatment, prophylaxis or diagnosis of any disease or
condition in humans; provided, however, that with respect to Genentech Licensed
Products containing an Anti-IgE Antibody identified and synthesized before June
1, 1997, and/or Tanox Patents issued before June 1, 1999, the foregoing
limitation "to the extent necessary" shall not be applicable.

               4.2 ROYALTIES. For the Consideration, including the licenses
granted herein, Genentech shall pay Tanox, on a country-by-country basis, the
following royalties on Net Sales of Genentech Licensed Products by Genentech and
its sublicensees:

   (a)   for sales in the United States:

         (i)    a royalty of * of Net Sales of Genentech Licensed Products
                covered in the United States by a Valid Claim of a Tanox Patent;
                or

         (ii)   a royalty of * of Net Sales of Genentech Licensed Products
                not covered in the United States by a Valid Claim of a Tanox
                Patent; and

                                       14
<PAGE>
   (b)   for sales in each country in the Genentech Territory by Genentech and
         its sublicensees, other than the United States, in which a Genentech
         Licensed Product is covered in that country by a Valid Claim of a Tanox
         Patent:

         (i)    a royalty of * of Net Sales of all such Genentech Licensed
                Products if the Aggregate Annual Net Sales for all such
                countries are * or less; and

         (ii)   a royalty of * of Net Sales of all such Genentech Licensed
                Products if the Aggregate Annual Net Sales for all such
                countries are between * and *; and

         (iii)  a royalty of * of Net Sales of all such Genentech Licensed
                Products if the Aggregate Annual Net Sales for all such
                countries are greater than *; and

   (c)   in each country in the Genentech Territory, other than the United
         States, where there is no Valid Claim of a Tanox Patent covering a
         Genentech Licensed Product, a royalty of * of Net Sales of all such
         Genentech Licensed Products.

      The foregoing royalties shall be payable in each country until the latter
of (i) a period of ten (10) years from First Commercial Sale of a Genentech
Licensed Product in such country or (ii) the expiration of all Valid Claims of
Tanox Patent(s) in such country which a Genentech Licensed Product sold in such
country would infringe but for the licenses granted herein. At such time as
royalties are no longer payable hereunder in a country, the license granted to
Genentech with respect to such country in Section 4.1 shall thereafter be fully
paid up and royalty-free in perpetuity.

      Genentech shall be entitled to deduct from the royalties payable with
respect to any country hereunder, * of the aggregate royalties required to be
paid to a third party(s)


                                       15
<PAGE>
under license(s) entered into after the Effective Date where such royalties are
paid for the manufacture, use or sale of an Anti-IgE Antibody as part of a
Genentech Licensed Product in such country to avoid infringing a Valid Claim of
such third party's patents; provided, that such deduction in any calendar year
shall in no event exceed * of the royalties otherwise payable to
Tanox in such country for that calendar year, except the United States, and, in
the United States, such deduction shall in no event exceed * of
Genentech's Net Sales in a calendar year if a Valid Claim of a Tanox Patent
covers the Genentech Licensed Products in the United States or *
of Genentech's Net Sales in a calendar year if no Valid Claim of a Tanox Patent
covers the Genentech Licensed Products in the United States. For purposes of
computing the deduction permitted hereunder, the percentage royalty payable to
any such third party with respect to which such deduction is permitted shall not
exceed the usual percentage royalty charged by such third party to others or the
royalty charged to Ciba, whichever may be less.

         4.3 TANOX EXCLUSIVE TERRITORIES. Genentech agrees that it will not
manufacture or sell a Genentech Licensed Product or provide a Genentech Licensed
Product for sale or knowingly contribute to or assist in the manufacture or sale
of a Genentech Licensed Product in any country outside the Genentech Territory.

    5.0 LICENSES TO TANOX.

         5.1 GRANT OF LICENSE. As additional consideration for the granting of
the licenses under Section 4.0 by Tanox, effective commencing upon the
Cross-License Date, Genentech grants to Tanox under all Genentech Patents a
nonexclusive, worldwide, sublicensable license to the extent necessary to make,
have made, use, sell, have sold and import Tanox Licensed Products for the
treatment, prophylaxis or diagnosis of any disease or condition in humans and
animals; provided, however, that with respect to Tanox Licensed Products
containing an Anti-IgE Antibody identified and synthesized before *,
and/or Genentech Patents issued before *, the foregoing limitation
"to the extent necessary" shall not be applicable.


                                       16
<PAGE>
         5.2 ROYALTIES. Tanox will pay Genentech such royalties or other
license-related payments as Genentech is obligated to pay to any third party by
virtue of the manufacture, use or sale hereunder of any Tanox Licensed Product
by Tanox or any sublicensee of Tanox in any country pursuant to Section 5.1
above (excluding any royalties due from Ciba to Genentech or any such third
parties under the Outline of Terms or Definitive Agreement); provided, however,
that such royalties or other license-related payments shall be the only payments
required and shall be comprised of, to the extent applicable, (i) * of Net Sales
for Tanox Licensed Products manufactured by or for Tanox and sold or otherwise
transferred by Tanox under a sublicense pursuant to the * Agreement effective as
of * and Genentech, Inc. (for the purposes of this Agreement, Tanox and
Genentech agree that the royalties that Tanox would otherwise pay to Genentech
for a sublicense under * Agreement, but for the provisions of this Section 5.2,
is *; (ii) * of Net Sales under * Patents as those terms are used in the
agreement effective as of * between Genentech, Inc. and *; and (iii) * of Net
Sales under * Patents as those terms are used in the Agreement effective as of *
between Genentech, Inc. and *. To the best of Genentech's knowledge, there are
no other royalty obligations under licenses granted to Genentech existing as the
Effective Date hereof with respect to chimeric or humanized monoclonal Anti-IgE
Antibodies produced in mammalian cell systems which Tanox would be obligated to
pay pursuant to this Section 5.2. and Genentech warrants that it has not
assigned any patent applications it may have pending relating to Anti-IgE
Antibodies to any third party.

   6.0   ACCESS TO LICENSES.

         6.1 MUTUAL REPRESENTATIONS. Tanox represents to Genentech that it does
not have knowledge of any restrictions existing as of the Effective Date which
would prevent it from granting licenses to the Tanox Patents as provided under
this agreement. Genentech represents to Tanox that it does not have knowledge of
any restrictions existing


                                       17
<PAGE>
as of the Effective Date which would prevent it from granting licenses to the
Genentech Patents as provided under this agreement. If any Patents of a Party
which would otherwise be included within the licenses granted herein now or in
the future are not licensable or sublicensable under the respective
Cross-License Provisions of this Agreement because of contractual restrictions
to which such Patents are subject, then such Party shall take reasonable actions
in an effort to permit the other Party to secure the benefits of such rights for
the purposes intended herein in light of the restrictions to which it is
subject, including, without limitation, the agreement of each Party not to sue
the other Party for infringement of any such Patents.

         6.2 THIRD PARTY LICENSES. If either Party obtains exclusive access for
the allergy field to a patent owned and/or controlled by a third party which is
necessary to make have made, use or sell a Licensed Product, then such Party
will either (i) permit the other Party to obtain co-exclusive rights to such
patent for such field, if possible, or (ii) acquire a license to such patent for
such field free of any restrictions which would limit such Party's right to
sublicense to the other Party as required under this Agreement, including
preservation of such other Party's sublicense rights hereunder.

   7.0 ROYALTY PAYMENTS.

         7.1 PAYMENT DATES. Royalties payable hereunder shall be paid within 100
days of the end of each calendar quarter for Net Sales for that calendar quarter
(with respect to all uses of "calendar quarter" in this Agreement, the first
calendar quarter in each year ends on March 31, with succeeding calendar
quarters ending each 3 months thereafter). Such payment shall be accompanied by
a statement showing the amount of each Licensed Product sold in each country,
the Net Sales of each Licensed Product in that country's currency in each
country in which Net Sales occurred, the royalties payable in local currency,
the applicable exchange rate as set forth in Section 7.3 below for that
currency, and the royalties payable in U.S. Dollars.


                                       18
<PAGE>
         7.2 RECORDS AND ACCOUNTING. A Party shall keep and require its
sublicensees to keep complete and accurate records of the latest three (3)
calendar years of Net Sales with respect to which a royalty is payable under
this Agreement. The Party receiving royalties shall have the right at its own
expense to have an independent, certified or chartered public accountant,
reasonably acceptable to the Party paying royalties, review the paying Party's
records upon reasonable notice and during reasonable business hours for the
purpose of verifying the payments provided for in this Agreement. This right may
not be exercised more than once for any calendar year with respect to the
records of the paying Party and each of its sublicensees. Should such review
lead to the discovery of an under reporting of royalties due hereunder of
greater than two percent (2%), the Party under reporting such royalties, in
addition to promptly paying the unpaid royalties, shall pay the full cost and
expense of such review, plus interest on such unpaid royalties at the rate of
10% per annum from the date any such under reporting occurred to the day paid.

         7.3 CURRENCY OF PAYMENTS. All payments under this Agreement shall be
made in United States Dollars by wire transfer (or such other reasonable means
as the receiving Party may direct) to such bank account as the receiving Party
may designate from time to time. If a wire transfer is to be made, the remitting
Party shall provide notice at least five (5) days prior to the date of transfer
of the amount of payment and the date it is to be received. Such notice should
be given to the Treasurer of the receiving Party at the address set forth at the
beginning of this Agreement or such other address as the receiving Party may
subsequently direct. Any payments due hereunder on sales outside of the United
States shall first be calculated in the currency in which sales took place and
then converted to United States Dollars at the average of the average spot rate
published in the Wall Street Journal for the last business day of each of the
three (3) months of the calendar quarter for which royalties are payable.

    If by law, regulation or fiscal policy of a particular country, remittance
of royalties in United States Dollars is restricted or forbidden, notice thereof
will be promptly given to the receiving Party, and payment of the royalty shall
be made by the deposit thereof in local


                                       19
<PAGE>
currency to the credit of the receiving Party in a recognized banking
institution designated by the receiving Party. When in any country the law or
regulations prohibit both the transmittal and deposit of royalties on sales in
such a country, royalty payments shall be suspended for as long as such a
prohibition is in effect and as soon as such prohibition ceases to be in effect,
all royalties which the paying Party would have been under obligation to
transmit or deposit but for the prohibition, shall forthwith be deposited or
transmitted promptly to the extent allowable. If a Party is required to pay or
withhold any income tax or other tax with respect to royalty payments, such
Party shall first (i) furnish the receiving Party, in writing, with the
satisfactory evidence that such payment or withholding is required, (ii) provide
reasonable assistance in claiming any exemption from any such deduction which
may be available, and (iii) provide satisfactory documentation to confirm the
payment of the tax.

         7.4 COMBINATION PRODUCT NET SALES. In determining the Net Sales of
Combination Products, Net Sales shall first be calculated in accordance with the
definition of Net Sales and then multiplied by the percentage value of the
Licensed Product contained in the Combination Product, such percentage value
being the quotient obtained by dividing the current market price of the Licensed
Product by the sum of the separate current market prices of the Licensed Product
and the other ingredients which are Therapeutically Active or the device
contained in the Combination Product. The current market price of each
Therapeutically Active ingredient or the device and of the Licensed Product
shall be for a quantity comparable to that contained in the Combination Product
and of the same class, purity and potency. When no current market price is
available for a Therapeutically Active ingredient or device or a Licensed
Product in a Combination Product, the Party with the Combination Product shall
calculate a commercially reasonable hypothetical market price for such
ingredient or device or Licensed Product, allocating the same proportions of
costs, overhead and profit as are then allocated to all similar substances then
being made and marketed by that Party marketing the Combination Product and
having an ascertainable market price. The current market price shall be
determined with respect to the Licensed Product and other Therapeutically Active


                                       20
<PAGE>
ingredients or devices in the country in which such sales of Combination
Products occur to the extent practicable. In the event of any dispute regarding
determination of Net Sales for a Combination Product, the Party with such
Combination Product shall pay royalties in accordance with the definition of Net
Sales notwithstanding this Section 7.4 or on such other agreed basis until such
dispute is resolved. Upon resolution of any such dispute, any excess royalties
which may have been paid shall be promptly reimbursed, plus interest on any such
excess royalties at the rate of * per annum from the date any such excess
royalties were paid to the date of reimbursement.

         8.0 PAYMENTS TO TANOX. For the Consideration, including settlement of
the Lawsuit, execution of the Outline of Terms, and grant of the licenses by
Tanox herein, Genentech shall pay Tanox the * payment due on execution
of this Agreement and dismissal of the Lawsuit within five (5) days of the
occurrence of such event and the remaining sums set forth on Exhibit 4 hereto
within thirty (30) days of the date upon which each remaining event described on
Exhibit 4 occurs with respect to any Genentech Licensed Product that has been
covered by the claims of a Tanox Patent and/or any anti-IgE Product (as that
term is used in the Outline of Terms) that is subject to the Outline of Terms of
Definitive Agreement. The obligations hereunder are acknowledged to be in
addition to any other obligations of Genentech to Tanox under the Outline of
Terms or Definitive Agreement. With respect to the amounts payable hereunder,
Genentech shall receive a credit of * which shall be applied against
royalties due Tanox hereunder or under the Outline of Terms and Definitive
Agreement at such time as the total annual net sales of Genentech Licensed
Products that have been covered by the claims of a Tanox Patent and anti-IgE
Products sold under the Outline of Terms and Definitive Agreement exceed
*.

         9.0 ADDITIONAL LICENSES. In addition to and without limitation of the
license granted to Tanox under Section 5.0, Genentech agrees to grant certain
additional licenses to Tanox as provided herein. Subject to all of Genentech's
existing licenses and existing agreements that restrict Genentech's ability to
grant licenses and subject to the additional


                                       21
<PAGE>
restrictions set forth below, Genentech agrees to grant to Tanox, upon written
request from Tanox, a worldwide, nonexclusive, nonsublicenseable (except to
Affiliates, but only in conjunction with the license of a specific product)
license under patents owned by Genentech and set forth on Exhibit 5 hereto, to
make, have made, use, sell, have sold and import products for *, except that
such products shall not include those (i) that are the subject of a prior
exclusive license by Genentech to a third party; (ii) that are the subject of an
active research or development program of Genentech or its Affiliates; or (iii)
that compete with, or will compete with, a then current product of Genentech or
its Affiliates or a product in an active research and/or development program of
Genentech or its Affiliates; provided however, that if any such patents desired
by Tanox shall be subject to exclusive rights to a third party which would
prevent the license desired by Tanox, Genentech agrees that Tanox shall have the
right to obtain a sublicense, if possible, from any such third party on terms
agreed between Tanox and such third party. Tanox agrees that to the extent
Genentech would deprive itself of its right to practice the patents thereby,
Genentech shall not be required pursuant hereto to grant sublicense rights to
Tanox under those patents known as the "Boss" and "Cabily" patents for any
antibodies set forth on Exhibit 6 which are the subject of co-exclusive rights
between Genentech and * with respect to such patents. Except for those patents
and patent applications listed on Exhibit 7, Genentech represents and warrants
that it has no existing patents or patent applications and, except for licenses
from The City of Hope and Celltech Limited, is not a licensee of any patents
with claims which cover the composition of the molecules set forth on Exhibit 6
and agrees that Tanox may rely on this representation and warranty in pursuing
the development and commercialization of such molecules. Notwithstanding the
foregoing restrictions, but expressly subject to certain agreements between
Genentech and F. Hoffmann-La Roche Ltd. and Roche Holdings, Inc. ("Roche")
covering rights to Genentech's patents, Genentech also represents and warrants
that it will grant a worldwide, nonexclusive, nonsublicenseable (except to
Affiliates, but only in conjunction with the license of a specific product)
license to Tanox under all future patents owned by it in whole or in part with
claims which are necessary to make, use, or sell the Tanox molecules set forth
on Exhibit

                                       22
<PAGE>
6 so long as Genentech does not currently have an active clinical development
program involving any such Tanox molecule for the indication being pursued by
Tanox. To the extent that Genentech is a licensee of patents which are necessary
to make, use or sell any Tanox molecule on Exhibit 6 or which is also covered by
the patents set forth on Exhibit 5, until Genentech has offered a sublicense to
Tanox and Tanox has refused such a sublicense, Genentech agrees that it will not
sue, or provide affirmative assistance in any suit against, Tanox for
infringement of any such patents. Any license granted to Tanox pursuant hereto
for the patents set forth on Exhibit 5 shall be at a royalty rate and on other
terms to be mutually agreed upon but which shall be no less favorable to Tanox
than that granted to any other licensee of the patents set forth on Exhibit 5
where the license is for the patents listed and where there is no other
substantial consideration for the license granted other than the usual
consideration sought by Genentech for such licenses. If any patents subject to
license or sublicense hereunder have no comparable royalty rates or terms, the
Parties agree to negotiate in good faith the royalty rate and terms on which any
such license or sublicense will be granted. Subject to the limitations set forth
above, Tanox may exercise its right to such a license or sublicense, without
threat of suit or penalty from Genentech, with respect to a product subject to
this Section 9.0 at any time prior to the First Commecial Sale of such product
in the first country in which such event occurs and the Parties shall then
negotiate and execute a license agreement for that product and the patents
subject to this Section 9.0. If Tanox should ever have under development a
product which could be subject to the restrictions on receiving a license set
forth herein, then Genentech or Tanox should notify the other of such
possibility prior to taking any other actions. If the Parties are unable to
resolve the issues prior to the time Tanox files for approval to market such
product in any country, which resolution could include a collaboration or
cross-licensing opportunity or Tanox's express agreement not to manufacture or
market for commercial sale (as such term is used in connection with the
definition of ("First Commercial Sale") in a country in which a Valid Claim of
any Genentech patent covering such product may exist, then Genentech shall be
entitled to pursue such legal or other actions as Genentech may determine, in
its sole discretion, to be appropriate under the circumstances.


                                       23
<PAGE>
         10.0 TANOX MANUFACTURING FACILITY. With respect to Tanox's pilot
manufacturing facility in Houston, Texas, if subsequent to the Selection Date,
as defined in the Outline of Terms, such facility is not utilized by Tanox or
Ciba for the manufacture of Anti-IgE Antibodies, Genentech agrees to discuss, in
good faith, a potential arrangement with Tanox for the manufacture of clinical
research material for Genentech in the circumstance where Genentech does not
have sufficient capacity at that time to manufacture its own clinical research
material needs.

         11.0 CONFIDENTIALITY. In connection with preparation and during the
term of this Agreement, one Party may disclose to the other or receive from the
other written information relating to the subject matter of this Agreement which
information, if so identified in writing either pursuant to this Section 11.0 or
otherwise upon disclosure, shall be considered to be the disclosing Party's
Confidential Information. Each Party agrees that it will take the same steps to
protect the confidentiality of the other Party's Confidential Information as it
takes to protect its own proprietary and confidential information. Each Party
shall protect and keep confidential and shall not use, publish or otherwise
disclose to any third party, except as permitted by this Agreement (or the
Outline of Terms or Definitive Agreement) or with the other Party's written
consent, the other Party's Confidential Information for a period of five (5)
years from the date of termination of the Cross-Licensing Provisions or for 10
years, whichever is longer. For the purposes of this Agreement, Confidential
Information shall not include such information that (i) was lawfully known to
the receiving Party at the time of disclosure; (ii) was generally available to
the public or was otherwise part of the public domain at the time of disclosure
or became generally available to the public or otherwise part of the public
domain after disclosure other than through any act or omission of the receiving
Party in breach of this Agreement; (iii) became known to the receiving Party
after disclosure from a source that had a lawful right to disclose such
information to others; or (iv) is required to be disclosed by the receiving
Party to comply with applicable laws, to defend or prosecute litigation or to
comply with governmental regulations, provided that the receiving Party provides
prior written notice of such disclosure to the other Party and takes reasonable
and lawful actions to avoid and/or minimize the degree of such disclosure.


                                       24
<PAGE>
      Notwithstanding the above, the Parties may disclose Confidential
Information to their legal representatives, to Affiliates and their legal
representatives, and to consultants (to the extent such disclosure is intended
to further the purposes contemplated under this Agreement) and provided such
legal representatives, Affiliates and consultants have agreed in writing to be
bound to protect the confidentiality of such information in a manner at least as
restrictive as that generally set forth herein.

         12.0 TERM: DEFAULT; SURVIVAL.

                12.1 TERM. Except as otherwise set forth herein, the
Cross-Licensing Provisions and Sections 9.0 and 10.0 of this Agreement shall
terminate at such time following the First Commercial Sale as royalties are no
longer owed by either Party hereunder in any country in the world.

                12.2 TERMINATION. (a) Subject to the simultaneous or prior
termination of its participation in the Outline of Terms and Definitive
Agreement, and all other development and commercialization activities relating
to Anti-IgE Antibodies and Genentech Licensed Products which are subject to this
Agreement and have been covered at any time by a claim of a Tanox Patent,
Genentech may terminate the provisions of Section 4.0, Section 8.0 and Section
9.0 of this Agreement upon thirty days prior written notice to Tanox (but for
Section 9.0, such termination shall be effective only with respect to products
which are not already under development at the time of such termination). Upon
such termination, Roche shall have the option, exercisable for a period of 90
days after Genentech's termination, to assume all of Genentech's rights and
obligations with respect to Anti-IgE Antibodies and Genentech Licensed Products
hereunder. If Roche does not exercise this option by the end of the 90 day
option period, any licenses granted to Genentech by Tanox under Section 4.0 will
immediately terminate, and Genentech shall


                                       25
<PAGE>
grant Tanox a royalty-free, non-exclusive license under Genentech's Patents,
know how and other technology to make, have made, use, sell, have sold or import
Anti-IgE Antibodies and Genentech Licensed Products existing as of the date of
such termination and which have been covered at any time by a claim of a Tanox
Patent.

         In addition, if Genentech terminates this Agreement pursuant to the
foregoing paragraph and Roche does not exercise its option to assume Genentech's
rights and obligations hereunder, Tanox shall have the option for a period of
120 days following the date of termination to acquire from Genentech on mutually
agreeable and commercial reasonably terms Genentech's. Anti-IgE Antibodies and
Genentech Licensed Products existing as of the date of such termination and
which have been covered at any time by a claim of a Tanox Patent, as well as
cell lines producing such materials or substances used in the development and
commercialization of such Antibodies or Products, including data and development
information relating thereto. If Tanox fails to exercise its option and
Genentech thereafter desires to license or sell such Antibodies or Products to a
third party, Genentech shall not license or sell such Antibodies or Products on
terms that are in the aggregate more favorable to such third party than those
terms that Genentech offered to Tanox unless Genentech first offers such
Antibodies or Products to Tanox on such more favorable terms.

         Genentech represents and warrants that it does not presently intend to
terminate this Agreement pursuant to this Section 12.2(a) and is not presently
aware of any existing development activities within Genentech or elsewhere which
would give rise to an Anti-IgE Antibody or Genentech Licensed Product which
Genentech would consider developing following a termination pursuant to this
Section 12.2 (a).

                (b) Tanox may terminate the provisions of Section 5.0 of this
Agreement upon thirty days prior written notice to Genentech. Upon any such
termination, any licenses granted to Tanox by Genentech thereunder will
immediately terminate.

         12.3 DEFAULT. Failure by either Party (the "defaulting Party") to
comply with any of the material obligations contained in this Agreement shall
entitle the other Party (the nondefaulting Party") to give the defaulting Party
notice specifying the nature of the default and requiring it to cure such
default. If such default is not cured within the sixty (60) day period after the
receipt of such notice, the nondefaulting Party shall be entitled, except as
otherwise specifically provided in this Agreement (including, without
limitation, Tanox's right to receive payments under Section 8.0 so long as the
Outline of Terms or Definitive Agreement continue in effect) and subject to any
arbitration award under Section 13.12 (b), to terminate all or any part of this
Agreement or the licenses granted herein and without prejudice to any other
rights conferred on it by this Agreement.

         12.4 SURVIVAL OF PROVISIONS. Except to the extent termination is
expressly permitted herein, the agreements and obligations of the Parties shall
survive to the extent and/or for the purposes provided herein.

    13.0  GENERAL PROVISIONS.

         13.1 ADEQUACY OF CONSIDERATION. By signing this Agreement, each Party
to this Agreement acknowledges the receipt by such Party and the sufficiency to
such Party of the Consideration.

     13.2 Disputes with Ciba. In connection with the Multiparty Transaction,
Genentech agrees that without Tanox's express consent, to the extent consistent
with any obligations Genentech may have as a result of any process to which it
is subject, such as subpoena, deposition or the like during the course of such
dispute, it will not voluntarily or at the request of Ciba interfere with,
participate in, or actively attempt to influence the outcome of any dispute
which may arise between Tanox and Ciba in connection with or relating to the D &
L Agreement, unless such dispute is substantially likely to have a material
effect on Genentech.

                                       27
<PAGE>
         13.3 GUARANTY. Genentech, Inc. absolutely and unconditionally
guarantees the prompt and punctual payment and performance when due of the
obligations of Genentech International Limited to Tanox under this Agreement.
This is a continuing guaranty applicable to and guaranteeing any and all
obligations and liabilities of every kind and character of Genentech
International Limited to Tanox and Genentech, Inc. waives any right to require
that any action be brought against Genentech International Limited or any other
person or entity. Genentech, Inc. also expressly waives all rights to which it
may be entitled by virtue of Chapter 34 of the Texas Business and Commerce Code.

         13.4 NOTICES. All notices which may be required pursuant to this
Agreement (i) shall be in writing, (ii) shall be addressed, in the case of
Genentech (except as otherwise specified herein), to the Corporate Secretary at
the address set forth at the beginning of this Agreement, and in the case of
Tanox to the President at the address set forth at the beginning of this
Agreement, (or to such other person or address as either Party may so designate
from time to time), (iii) shall be mailed, postage-prepaid, by registered mail
or certified mail, return receipt requested, or transmitted by courier for hand
delivery or sent by express courier service, and (iv) shall be deemed to have
been given on the date of receipt if sent by mail or on the date of delivery if
transmitted by courier or express courier service.

         13.5 ENTIRE AGREEMENT. This Agreement, the Outline of Terms, and the
Definitive Agreement to be concluded hereafter are the entire agreements between
the Parties regarding the subject matter hereof, and there are no prior written
or oral promises or representations not incorporated herein or therein. No
amendment or modification of the terms of this Agreement shall be binding on
either Party unless reduced to writing and signed by an authorized officer of
the Party to be bound.

         13.6 BINDING EFFECT. This Agreement shall be binding upon and inure to
the benefit of the Parties hereto and their respective successors and permitted
assigns. This Agreement shall not be assignable by either Party without the
other's prior written consent, except that this Agreement (with the exception of
Section 9.0 which shall not be assignable without Genentech's prior written
consent, which will not be unreasonably withheld) may be assigned in whole or in
part to an Affiliate or a successor to all or substantially all of a Party's
business by merger, sale of assets, sale of stock or otherwise.


                                       28
<PAGE>
         13.7 WAIVER. The waiver by a Party hereto of any breach of or default
under any of the provisions of this Agreement or the failure of a Party to
enforce any of the provisions of this Agreement or to exercise any right
thereunder shall not be construed as a waiver of any other breach or default or
as a waiver of any such rights or provisions hereunder.

         13.8 SEVERABILITY. If any part of this Agreement shall be invalid or
unenforceable under applicable law, such part shall be ineffective only to the
extent of such invalidity or unenforceability, without in any way affecting the
remaining parts of this Agreement. In addition, the part that is ineffective
shall be reformed in such a manner as to as nearly approximate the intent of the
Parties as possible.

         13.9 PUBLICITY. The Parties acknowledge that certain information
contained in this Agreement will be set forth in a press release with agreed
upon text and release date and time following the execution of this Agreement.
Except for the information in that disclosure, neither Genentech nor Tanox shall
issue any public statement concerning this Agreement or the transactions
contemplated by this Agreement without the other Party's reasonable prior
written consent; provided, however, that either Party may disclose the
transaction or the terms hereof or thereof from time to time without the other
Party's consent (i) if such consent has been requested and not received and such
information is set forth in disclosures to investors and prospective investors
in the securities of a Party in compliance with laws, rules and regulations
covering any such transactions or such Party has a written opinion from outside
counsel that it is otherwise required by law to disclose the transaction or the
terms thereof, or (ii) to the extent that similar disclosure has been previously
approved by the Parties pursuant to this Section 13.9. The foregoing
notwithstanding, Tanox may disclose the terms of this Agreement to its existing
shareholders, investment bankers and other financial consultants, and
prospective investors in Tanox, provided that any such recipient of such
information must agree in writing prior to disclosure to be bound to protect the
confidentiality of that information for a period of at least three (3) years and
in a manner at least as restrictive as that generally set forth in Section 11.0
above.

                                       29
<PAGE>
         13.10 NO PARTNERSHIP. Nothing in this Agreement is intended or shall be
deemed to constitute a partnership, agency, employer-employee or joint venture
relationship between the Parties. No Party shall incur any debts or make any
commitments for the other.

         13.11 SURVIVAL OF REPRESENTATIONS. All agreements and representations
made by the parties in this Agreement shall survive the execution and delivery
of this Agreement, the payment and receipt of Consideration, and the execution
and delivery of any other instrument, or the taking of any other actions
required or provided for in this Agreement.

         13.12 DISPUTE RESOLUTION. Any dispute, controversy or claim arising out
of or relating to the validity, enforceability or performance of this Agreement,
including disputes relating to alleged breach or termination of this Agreement
but excluding any determination as to the validity of the Parties' patents
(hereinafter, the "Dispute"), shall be settled in accordance with the provisions
of this Section 13.12, and no Party can initiate any litigation in connection
with a Dispute except to enforce an arbitration award under Section 13.12 (b).
If a Party intends to begin mediation or arbitration to resolve a Dispute, such
Party shall provide written notice to the other Party informing such other Party
of such intention and the issues to be resolved. From the date of such request
and until such time as any matter has been finally settled by mediation or
arbitration, the running of the time periods contained in Section 12.3 in which
a Party must cure a breach of this Agreement shall be suspended as to the
subject matter of the Dispute.


                                       30
<PAGE>
         (a) MEDIATION. The Parties have entered into the Agreement in good
faith and in the belief that it is mutually advantageous to them. It is with
that same spirit of cooperation that they pledge to attempt to resolve any
dispute amicably and without the necessity of litigation. Accordingly, they
agree that if any Dispute should arise, prior to the commencement of any legal
action, they will first seek to mediate their Dispute by mediation, with a
mediator mutually agreeable between the Parties. If the Parties are unable to
agree upon a mediator within ten (10) days of the date a Party has requested
mediation, either one of them may thereafter request JAMS/ENDISPUTE to designate
a mediator to preside over the mediation proceeding. The Parties agree to sign a
document agreeing that the mediation and mediator will be governed by the
provisions of Chapter 154 of the Texas Civil Practice and Remedies Code and such
other rules as the mediator prescribes. The Parties commit to participate in the
proceedings in good faith with the intention of resolving the Dispute, if at all
possible. The fees and expenses of the mediator will be shared equally by the
Parties. The mediator is disqualified as a witness, consultant, expert or
counsel for any Party with respect to the Dispute and any related matters.

         (b) BINDING ARBITRATION. If the Dispute has not been resolved by
mediation within sixty days after the request for mediation is made, then upon
the request of either party, the Dispute will be settled by binding arbitration
as provided in this Section 13.12 (b).

            (1) The arbitration shall be administered by the American
Arbitration Association ("AAA"), pursuant to its then current Commercial
Arbitration Rules, except as otherwise provided in this Section 13.12 (b). The
arbitration shall be conducted by a panel of three arbitrators ("the Panel").
The Panel shall be selected from a pool of arbitrators to be presented to the
Parties by AAA.

            (2) If a Party can demonstrate to the Panel that the complexity of
the issues or other reasons warrant the extension of one or more of the time
tables in the AAA rules, the Panel may extend such time tables, but in no event
shall the time tables be extended so that the proceeding extends more than 1
year from its beginning to the award.

                                       31
<PAGE>
            (3) The Parties (i) acknowledge that the issues that may arise in a
Dispute may involve a number of complex matters and (ii) confirm their intention
that each Party will have the opportunity to conduct complete discovery with
respect to all material issues involved in the Dispute in accordance with the
rules of the Federal Rules of Civil Procedure.

            (4) The Panel shall, in rendering its decision, apply the
substantive law of the state in which the proceeding takes place, without regard
to its conflict of laws provisions, except that the interpretation of and
enforcement of this Section 13.12 (b) shall be governed by the Federal
Arbitration Act. The Panel shall apply the Federal Rules of Evidence to the
hearing. The proceeding shall take place in San Francisco, California if
arbitration is initiated by Tanox and in Houston, Texas if arbitration is
initiated by Genentech. The fees of the Panel and AAA shall be paid in the
manner designated by the Panel under Section 13.12 (b) (6) below.

            (5) The Panel is empowered to award any remedy allowed by law,
including money damages, prejudgment interest and attorney's fees, and to grant
final, complete, interim, or interiocutory relief, including injunctive relief,
but excluding punitive damages and multiple damages. The Parties shall be deemed
to have waived any right to such punitive damages or multiple damages.

            (6) Unless the Panel directs otherwise pursuant to Section 13.12 (b)
(5) above, each Party shall bear its own legal fees. The Panel shall assess
costs, fees and expenses of the AAA and the Panel to the Parties in the manner
the Panel deems appropriate under the circumstances.

            (7) The arbitration proceeding shall be confidential and the Panel
shall issue appropriate protective orders to safeguard each Party's Confidential
Information. Except as required by law, no Party shall make (or instruct the
Panel to make) any public announcement with respect to the proceedings or
decision of the Panel without prior written consent of each other Party. The
existence of any Dispute submitted to arbitration, and the award, shall be kept
in confidence by the Parties and the Panel, except as required in connection
with the enforcement of such award or as otherwise required by applicable law.

                                       32
<PAGE>
         (c) ENFORCEMENT. For purposes of this Section 13.12, the Parties agree
to accept the jurisdiction of the federal counts located in the Southern
District of Texas with respect to arbitration proceedings initiated by Genentech
and with the Northern District of California with respect to arbitration
proceedings initiated by Tanox for the purposes of enforcing awards entered
pursuant to Section 13.12 (b) and for enforcing the agreements reflected in this
Section 13.12.

         13.13 AGREEMENT TO PERFORM NECESSARY ACTS. Each Party agrees to perform
any further acts and execute and deliver any and all further documents,
agreements, and/or instruments which may be reasonably necessary or desirable to
carry out or effect the provisions of this Agreement.

         13.14 COUNTERPARTS. This Agreement may be executed in counterparts, and
each such counterpart shall be deemed an original for all purposes.


GENENTECH, INC.                                 TANOX BIOSYSTEMS, INC.
By:                                             By: David Anderson
Title: CEO & President                          Title: Executive Vice President

GENENTECH INTERNATIONAL LIMITED
By: PETER MARTIN
Title: Director

                                       33
<PAGE>
                                                                       EXHIBIT 1


               OUTLINE OF TERMS FOR SETTLEMENT OF THE LITIGATIONS
             AMONG GENENTECH INC., GENENTECH INTERNATIONAL LIMITED,
                             TANOX BIOSYSTEMS, INC.
                             AND CIBA-GEIGY LIMITED
                              RELATING TO ANTI-IGE

                        INHIBITING MONOCLONAL ANTIBODIES

In 1993 Tanox sued Genentech for fraud and misappropriation of know-how in the
context of anti-IgE-antibody projects to which both companies are committed.
Genentech then sued Tanox and, later on Ciba for infringement of Genentech's US
"Cabilly" patent by their anti-IgE and anti-HIV monoclonal antibody projects.
Ciba and Tanox filed a counterclaim for invalidation of said patent. Tanox has
further filed certain patent applications on which some patent rights have
already been granted which may extend to Genentech's anti-IgE substance,
although Genentech does not agree that they do. Now the parties are willing to
settle all their pending litigations including potential future disputes
regarding anti-IgE antibodies on the basis of the following principles:

1. MERGER OF ANTI-IGE PROJECTS

   The anti-IgE-antibody projects of Genentech on the one side and Ciba/Tanox on
the other side shall be merged, but Genentech and Ciba/Tanox will continue to
take their respective anti-IgE antibodies through Phase II clinical trials
currently in progress or planned to be performed during 1996. Based upon the
results of these trials and other relevant considerations Genentech, Tanox and
Ciba shall jointly discuss and decide by June 1, 1997 at the latest which of the
anti-IgE antibodies shall be taken up in Phase III trials, be developed for
additional indications (if any), be submitted for marketing authorization and be
commercialized as a pharmaceutical product ("anti-IgE Product"). The final
Agreement(s) as referred to in Section 8.2 shall provide for procedures in case
of a disagreement between the parties. All development activities shall be
supervised by a Steering Committee on which each party is represented. The
merging of each party's anti-IgE-antibody projects and the development and
commercialization thereof according to this Outline of Terms shall extend to all
IgE inhibiting antibodies (including fractions or derivatives thereof) which
have been identified and synthesized by either party hereto *

<PAGE>
2. SHARING OF DEVELOPMENT COST

   All development activities for the anti-IgE Project/Product including such
things as the manufacture of the clinical material, the conduct of clinical
trials, the development of the process to make anti-IgE antibodies and required
supporting activities/services and fees which are necessary for obtaining the
NDA in the USA and the marketing authorization(s) in Europe shall be pooled
between Genentech and Ciba. This cost pooling shall commence as of the date on
which the selection of the anti-IgE Product for further development has been
made (the "Selection Date").

   These pooled costs shall be allocated to the US development cost account on
the one side and the Europe development cost account on the other side on a pro
rata basis to be agreed upon according to the prospective sales potential for
the anti-IgE Product in each of the two territories.

   The development cost allocated to the US shall be shared between Ciba and
Genentech in the ratio of *, whereas the development cost for Europe -subject to
Section 11 hereafter- shall be borne as to * by Ciba and as to * by Genentech.

   Any additional development cost required for the commercialization of the
anti-IgE Product in territories outside the US and Europe shall be borne
exclusively by Ciba/Tanox according to the Development and Licensing Agreement
between Tanox and Ciba dated May 11, 1990, and the amendment thereto relating to
the territories of Taiwan, Korea, Singapore, China and Hong Kong (the "D&L
Agreement"), subject to additional cost obligations for Japan which may arise
according to Section 11 hereafter.

3. COMMERCIALIZATION

   3.1 The anti-IgE Product shall be commercialized in the US under one brand
under a co-promotion scheme by Ciba and Genentech to be further elaborated and
agreed upon. In lieu of Tanox's right under the D&L Agreement to participate in
such co-promotion in the US, Tanox will be entitled to the payments set forth in
Section 5.1 hereafter.

   All the cost for the manufacturing/purchase of anti-IgE Product and all the
cost for its marketing and sale in the US including all supporting and auxiliary
activities and royalties to third parties (if any) shall be shared between Ciba
and Genentech on a * basis.

<PAGE>
   All the net profits from the commercialization of the anti-IgE Product in the
US shall be shared between Ciba and Genentech on a * basis.

   3.2 The anti-IgE Product shall be commercialized in Europe exclusively by
Ciba, subject to Section 11 hereafter. All the cost for the
manufacturing/purchase of the anti-IgE Product and all the cost for its
marketing and sale including all supporting activities and royalties to Tanox on
the one hand and third parties (if any) and all the net profits from the
commercialization of the anti-IgE Product in Europe shall be shared between Ciba
and Genentech on the basis of * (Ciba): * (Genentech).

   3.3 In all countries in the world other than US and Europe, Ciba shall have
exclusive rights for the commercialization of the anti-IgE Product, subject to
certain rights which Tanox has in Taiwan, Korea, Singapore, China and Hong Kong
according to a separate agreement and the rights for Japan as set out in Section
11 hereafter. No specific compensation shall be due to Genentech by Ciba for
these rights.

4. MANUFACTURE

   Ciba and Genentech together with Tanox (to the extent they are exercising
their rights of co-manufacturing) shall share in the responsibility for assuring
adequate product supply necessary for commercialization of the anti-IgE Product.
Genentech shall, on request of Ciba, manufacture the jointly selected anti-IgE
Product up to a quantity of * of the anti-IgE antibody per year and shall sell
the anti-IgE Product to the appropriate selling organizations in the US, Europe
and the rest of the world at a price equal to the full manufacturing cost as
defined in the Appendix hereto, plus an uplift of *. The parties also shall
consider and, as appropriate, reach agreement on plans to assure adequate
product supply in the event such * quantity is insufficient to meet projections
for product requirements reasonably established by mutual agreement of the
parties. The parties acknowledge that such manufacturing by Genentech and any
manufacturing by Ciba shall be subject to Tanox's co-manufacturing rights under
the D&L Agreement and the terms of a manufacturing and supply agreement to be
negotiated between Tanox and the purchasing party in the manner contemplated by
the D&L Agreement. Tanox agrees to waive its rights to compensation for
relinquishing its rights under the D&L Agreement to manufacture * of such *
which may be manufactured by Genentech, but Tanox does not waive its right
prospectively to exercise its co-manufacturing rights. If Genentech terminates
its cooperation hereunder, it shall continue to be bound by the above supply
obligation for a reasonable period of time to establish an alternative supply
source for the anti-IgE Product, such period to be mutually agreed upon in the
Definitive Agreement.

<PAGE>
   The manufacturing price paid to Genentech shall constitute a cost element in
the calculation of the cost/net profit to be shared according to Sec. 3.1
paragraphs 2 and 3 and Sec. 3.2 paragraph 2.

   In the event that there should not be enough anti-IgE Products available to
meet the requirements of the different markets the available quantities shall be
allocated pro rata to the respective potential in these markets.

5. ROYALTIES AND MILESTONE PAYMENTS TO TANOX

   5.1 Tanox is entitled to a royalty on the net sales of the anti-IgE Product
in the USA, as set out in the D&L Agreement, which amounts to * of such US net
sales (or * if there is no valid Tanox patent), plus (i) * on * of such US net
sales, payable by Genentech, and (ii) * of Ciba's net profits from the
commercialization of the anti-IgE Product in the US, payable by Ciba.

   5.2 For the sales of the anti-IgE Product in Europe and the rest of the
world, Tanox shall be paid the royalties specified in the D&L Agreement.

   5.3 The milestone payments payable to Tanox specified in the D&L Agreement
shall become due regardless of whether the anti-IgE Product selected originates
from Tanox or Genentech and, except for payments due for NDA/PLA submission and
approval in Japan, shall be included in the cost to be shared according to
Section 2 above.

   5.4 Payments made to Tanox in connection with development activities
undertaken by Tanox for the anti-IgE Project/Product after the Selection Date
shall be included in the cost to be shared according to Section 2 above. The
parties acknowledge and agree that for 1996 the already approved Tanox budget
will continue. For 1997 the Tanox budget will be similar to that of 1996, unless
Genentech, Tanox and Ciba conclude that activities at Tanox for 1997 would
result in a significant reduction of Tanox's 1997 budget. In such event Ciba,
Genentech and Tanox will negotiate in good faith an appropriate payment in
addition to such reduced budget covering Tanox's reasonable cost for phaseout of
its activities. Such payment, however, shall not exceed * of the budget
calculated for the last full 12 months prior to the Selection Date. For
subsequent years thereafter, development activities which should be undertaken
by Tanox so as to maintain its active involvement will be agreed by Ciba,
Genentech and Tanox and a Tanox budget will be submitted for approval in
accordance with current procedures.

<PAGE>
6. LICENSES

   Each party hereto shall grant to the other party any and all licenses and/or
sublicenses (to the extent possible and subject to payment of the appropriate
royalty or other payment amount due to third parties, such payment to be borne
or shared by the parties as otherwise provided herein, or if not provided
herein, then only if the party sublicensed pays such royalty or amount) under
their respective present and future patent rights, other intellectual property
rights, licenses, know-how, technology, cell lines, materials, etc. they own
and/or control to the extent they are required for or are to be used by the
parties as jointly agreed for the development, manufacture, use and sale of the
anti-IgE Product. No other compensations for these licenses shall be due than
those set out in this outline.

   Each party hereto represents that it does not have knowledge of any such
rights that it currently owns and to which it currently has a license which
cannot be made accessible to the other parties hereto.

   To the extent any such rights of a party are not licensable or sublicensable
such party shall take reasonable actions to permit the commercialization of the
anti-IgE Product on a reasonable basis in the light of the restrictions to which
it is subject.

7. SETTLEMENT

   7.1 The parties hereto shall dismiss all claims filed in the lawsuits against
each Genentech and F. Hoffmann-La Roche Ltd. and its three affiliates concerned
on the one side and Ciba and Tanox on the other side pending and consolidated
with the US District Court for the Southern District of Texas, Houston Division
(the "Litigation").

   7.2 Except as may be otherwise agreed between some of the parties hereto,
each party shall bear all cost and expenditure incurred by it under or in
connection with the above lawsuits.

8. CONDITIONS PRECEDENT

   8.1 The parties are aware that the envisaged terms of settlement set out
herein might need clearance by the relevant authorities and agree to cooperate
via their internal and external experts in this respect.

<PAGE>
   8.2 The parties shall negotiate in good faith and enter into (a) detailed
agreement(s) (the "Detailed Agreement") implementing and completing the terms
outlined herein within 6 months from the execution of this Outline.

9. PUBLICATIONS

   Unless otherwise agreed in advance in writing among all parties hereto, none
of the parties hereto shall directly or indirectly make any public statement,
press release or give any information to the public about this Outline of Terms
and the Detailed Agreement to be entered into pursuant hereto. However, this
restriction shall not apply to disclosure of information which the parties
acknowledge will be set forth in press release with agreed upon text and release
date and time, to be prepared following execution of the Outline of Terms, and
to statements, information, or announcements required by law, regulation or
administrative action to be disclosed including disclosure to (prospective)
investors in the securities of a party. In such event, the parties shall
promptly coordinate to the extent possible, the wording of any such disclosures.
This restriction on publication shall not be applicable to disclosures made to
third parties who are subject to non-disclosure or confidentiality obligations.

10.   CONFIDENTIALITY

   10.1 Any information and data disclosed by a party to another party hereto
(the "Receiving Party") in the context of the selection, development and
commercialization of the anti-IgE Product shall be kept strictly confidential by
the Receiving Party, shall not be disclosed to any third party by the Receiving
Party and shall not be used by the Receiving Party for any purpose other than
those contemplated under this Outline of Terms, the D&L Agreement and the
Detailed Agreement.

   10.2 The obligations set out in Section 10.1 above shall not apply to
information and data of which the receiving party can show that it:

        (i)  is or has become generally available to the public otherwise than
             through violation of the obligation set out in Section 10.1 above;

        (ii) has been received from a third party who did not acquire it
             directly or indirectly from the disclosing party.

   Notwithstanding the above, the parties may disclose such information (a) to
the extent as required to be disclosed to comply with applicable laws, to defend


<PAGE>
or prosecute litigation or to comply with governmental regulations including
disclosure to (prospective) investors in the securities of a party, provided
that the receiving party provides prior written notice of such disclosure to the
disclosing party and takes reasonable and lawful actions to avoid and/or
minimize the degree of such disclosure, and (b) to their legal representatives,
to affiliates and their legal representatives, and to consultants to the extent
such disclosure is intended to further the purposes contemplated under this
Outline of Terms, the D&L Agreement, and the Detailed Agreement, provided such
legal representatives, affiliates and consultants are covered by obligations of
confidentiality with respect to such information no less stringent than those
set forth herein, and further (c) in connection with publications, lectures,
seminars or other presentations with respect to which all parties hereto have
agreed in advance in writing.

11.   RIGHTS RESERVED TO ROCHE

   11.1 The parties acknowledge that Genentech is a party to certain agreements
with F. Hoffman-La Roche Ltd. and certain of its affiliates (collectively,
"Roche") under which Roche has certain rights to products being developed by
Genentech (the "G/R Agreements"). In the event Roche exercises its rights under
the G/R Agreements, Genentech and Roche have requested that certain rights to
participate in the commercialization of the anti-IgE Product be reserved to
Roche. Subject to receipt by Ciba and Tanox of a joint notification by Roche and
Genentech of Roche's exercise of rights under the G/R Agreements and to its
joinder in this Outline of Terms and the Detailed Agreement implementing and
completing the terms outlined herein, the parties agree to reserve for Roche's
benefit certain rights to participate in commercialization of the anti-IgE
Product in Europe and Japan as set forth in this Section 11.

   11.2 For Europe and Japan, Roche shall have an option to participate in the
commercialization of the anti-IgE Product according to the following terms:

   Roche's option, which shall be established and may be exercised on a
country-by-country basis, will be subject to the anti-IgE Product having a
significant "general practitioner potential" ("GP potential") in each country.
The GP potential of the anti-IgE Product is characterized in particular by the
following (cumulative) criteria: (i) clinical activity in patients with mild to
moderate allergic asthma and/or allergic rhinitis is demonstrated; (ii) a
patient friendly formulation (e.g. inhalation device or pen for autoinjection);
(iii) safety profile of the Product and its application is adequate for
self-administration; (iv) dose level and cost for the galenical formulation
and/or a device, such as to permit pricing accepted for reimbursement by social
security schemes in the respective country with a sufficient gross margin to
support the business case for co-promotion.

<PAGE>
   The envisaged commercialization scheme in Europe would be a co-promotion by
Roche of the anti-IgE Product sold by Ciba wherever legally possible and, in
those countries in Europe where no co-promotion is possible, each of Ciba and
Roche may market and sell the anti-IgE Product under different trademarks on its
own. The commercial terms and conditions e.g. modus of exercising of the option
(until submission of marketing authorization to the competent authorities at the
latest), time and manner in which reimbursement/sharing of development costs
will occur, and manner in which co-promotion sales will be attributed to each
party, etc., will be part of the detailed agreement(s) referenced in Section
8.2. It is understood, however, that each Ciba and Roche should be able to make
bookings of sales in the same order of magnitude.

   11.3 For each country in Europe in which Roche exercises its option, Ciba
agrees to share profits on a * basis under a co-promotion scheme, subject also
to a * sharing of all development and commercialization costs as provided in
Sections 2 and 3 above, in lieu of the * cost and profit sharing for Europe
otherwise provided in such Sections 2 and 3. For any country in Europe in which
Roche chooses not to exercise its option, the cost and profit sharing ratios
will continue to be * between Ciba and Genentech, as set out in Section 3.2
paragraph 2 above. In case of a co-marketing in a country Ciba and Roche shall
negotiate in good faith the terms and conditions of such co-marketing in that
country on the basis of a * sharing of the pertaining development cost, but,
with respect to that country no sharing of marketing cost nor profit sharing
neither between the co-marketing parties nor according to sections 2 and 3 above
shall apply. If Roche exercises its option hereunder only for a limited number
but not for all countries in Europe, then the costs to be shared in each country
in which Roche exercises its option(s) will be based on a allocation of all
development and commercialization costs attributable to Europe on a pro rata
basis to each such country in a manner to be agreed upon according to the
prospective sales potential for the anti-IgE Product in each of the countries in
Europe. Profits for each such country will be based on total sales revenues for
the anti-IgE Product in each such country.

   11.4 At the time Roche exercises its option for any country in Europe, Roche
and Genentech shall notify Ciba of their agreement regarding which of them will
be responsible for the costs to be shared or whether each will share a portion
thereof and regarding the manner in which they will participate in the profits
to be shared. Such notice will be accompanied by payment of an amount sufficient
to reduce Ciba's share in those costs already shared on a * basis to *.

   11.5 In Japan, subject to Roche's participation in co-development of the
anti-IgE Product for Japan, Roche shall have an option to market and sell the
approved anti-IgE Product on its own under a different trademark. To maintain
its rights for Japan hereunder, Roche shall have twelve (12) months from the
date of execution of this Outline of Terms in which to notify Ciba and Tanox of
its
<PAGE>
     election to participate in the development of the anti-IgE Product for
Japan. At such time as Roche notifies Ciba of such election, Roche shall be
obligated to reimburse Ciba for * of all development costs incurred by Ciba for
development in Japan since the Selection Date and Roche shall be entitled
immediately to participate with Ciba/Tanox in the development activities in
Japan on the basis of a * sharing of development cost including the milestone
payments to Tanox due on filing and grant of NDA/PLA in Japan, as specified in
the D&L Agreement. In the event that it should become evident that the anti-IgE
Product has no GP Potential in Japan, contrary to prior expectations, Ciba
and/or Roche may chose to terminate the joint development in Japan, and Ciba
shall retain all further rights to development and commercialization of the
anti-IgE Product in Japan against reimbursement of Roche's development cost
including mile-stone payment, if any incurred.

     11.6 The parties acknowledge that the detailed agreement(s) contemplated
under Section 8.2 will contain provisions which complete and implement the terms
outlined in this Section 11. The parties agree that Roche may participate in
negotiations relating to such provisions whether or not Roche has exercised its
rights under the G/R Agreements so that Roche will have the opportunity to
participate in establishing the detailed terms governing the rights reserved to
Roche hereunder.

12. EARLY TERMINATION

     Genentech may terminate the cooperation hereunder at any time during the
     development of the Anti-IgE Product by giving 120 days prior notice to Ciba
     and Tanox and paying all amounts due hereunder up to such termination date.
     If Genentech terminated its cooperation hereunder, Roche shall have the
     option exerciseable for a period of 30 days after Genentech's termination,
     to assume all of Genentech's rights and obligations hereunder. If Roche
     does not exercise such option, all of Genentech's rights under this
     cooperation, except for rights with respect to which Roche has exercised
     its options under Section 11, shall revert to Ciba, which shall be entitled
     to continue the development and to commercialize the Anti-IgE Product on
     its own or with Roche, as the case may be, without further compensation to
     Genentech, an which shall assume Genentech's obligations hereunder.

     Ciba may terminate the cooperation hereunder at any time during the
     development of the Anti-IgE Product by giving 120 days prior notice to
     Genentech and Tanox and paying all amounts due hereunder up to such
     termination date. Such notice also shall act as notice to Tanox of Ciba's
     termination of the D&L Agreement. In such even, subject to the right of the
     parties hereunder, the termination
<PAGE>
     provisions of the D&L Agreement shall govern such termination. Genentech
     and, as applicable, Roche shall be entitled to continue development in the
     U.S., Europe, and Japan, as the case may be, in Ciba's stead, subject to
     assuming Ciba's obligations hereunder, and to reimbursing Tanox for any
     compensation which may be payable by Tanox to Ciba as a result of such
     termination. Tanox shall have and retain exclusive rights for the
     commercialization of the Anti-IgE Product in all other countries in the
     world.

13. BINDING NATURE

     The contents of this Ouline of Terms represent the bona fide intent of the
     parties. The parties hereto shall use all reasonable effort to complete the
     final agreement(s) as referred to in Section 8.2 above as soon as
     reasonably practicable. It is understood, however, that unless and until
     the said formal agreement(s) is/are completed and entered into the parties
     (including their legal successors) shall be legally bound by and shall
     operate under the terms reflected in the present Outline of Terms, which
     shall be governed by the laws of the State of New York without regard to
     conflict of law principles.

Tanox Biosystems Inc.:                                  Date____________________



Genentech Inc.:                                         Date____________________



Genentech International Limited:                        Date____________________



Ciba-Geigy Limited:                                     Date____________________
<PAGE
                                                  > APPENDIX TO OUTLINE OF TERMS


DEFINITION OF FULLY BURDENED MANUFACTURING COST

Genentech's Fully Burdened Manufacturing Cost shall mean:

(a)  the actual direct cost associated with the manufacture of the Anti-IgE
     Product, i.e. direct material cost, direct labor cost, direct equipment
     cost, direct facility expense, direct quality control expense, direct
     energy cost, direct environmental expense, provided, however, that such
     actual direct cost shall not include cost associated with idle plant
     capacity, plus

(b)  an allocation of Genentech's overhead cost associated with such
     manufacture, up to a maximum of fifty percent of the actual price cost,
     which allocation for manufacturing overhead shall be made in accordance
     with U.S. Generally accepted cost accounting principles consistently
     applied by Genentech across all similar pharmaceutical manufacture
     operations, plus

(c)  Genentech's allocable intellectual property acquisition, licensing and
     royalty cost paid to third parties (except Tanox) upon the sale of Anti-IgE
     Products to third parties, plus

(d)  any other costs borne by Genentech for transport, customs clearance and
     storage of Anti-IgE Product, to the extent necessary (i.e. freight, duty,
     insurance and warehousing).

<PAGE>
                                   EXHIBIT 2
                    REPRESENTATIONS AND WARRANTIES BY TANOX


(a)  Before executing this Agreement, Tanox became fully informed of the terms,
     contents, conditions, and effect of this Agreement.

(b)  Tanox is a corporation duly organized, existing, and in good standing under
     the laws of the State of Texas.

(c)  Tanox possesses all requisite power and authority to enter into and perform
     this Agreement and to carry out the transactions contemplated herein.

(d)  Tanox has taken all necessary corporate and legal action to authorize the
     execution, delivery, and performance of this Agreement.

(e)  No consent or authorization of, filing with or any other act by or in
     respect of any other person (including any shareholder or creditor) or
     court is required in connection with the settlement of All Claims as set
     forth in this Agreement or with the execution, delivery, or performance by
     Tanox or the validity or enforceability as to Tanox of this Agreement.

(f)  This Agreement has been duly executed and delivered by Tanox and
     constitutes a legal, valid and binding obligation of Tanox enforceable
     against Tanox in accordance with its terms.

(g)  No promise or representation of any kind has been made to Tanox or by
     anyone acting for Tanox, except as is expressly stated in this Agreement.

(h)  Except for certain claims or portions thereof which may have been assigned
     to its attorneys, Tanox is the lawful owner of All Claims asserted by Tanox
     in the Lawsuit and has not assigned, pledged, or in any other manner sold
     or transferred any right, title, interest, or claim that arises out of or
     is the subject of the Incident and/or the Lawsuit.

(i)  In entering this Agreement, Tanox has had the benefit of the advice of
     lawyers of its own choosing; and Tanox enters this Agreement freely, by
     Tanox's own choice, and judgment, and without duress or other influence.

(j)  Tanox understands that this Agreement is a full, final, and complete
     release of the other Party to this Agreement and that the Consideration
     includes the ONLY benefits Tanox shall ever receive from such Party as a
     result of the Incident and the Lawsuit.

(k)  Tanox recognizes that the recitations contained in this Agreement are
     contractual and not a mere recital.

<PAGE>
                                    EXHIBIT 3
                  REPRESENTATIONS AND WARRANTIES BY GENENTECH


(a)  Before executing this Agreement, Genentech became fully informed of the
     terms, contents, conditions, and effect of this Agreement.

(b)  Each of Genentech, Inc. and Genentech International Limited is a
     corporation duly organized, existing, and in good standing under the laws
     of the respective state, country, or jurisdiction under which they each
     have been organized.

(c)  Genentech possesses all requisite power and authority to enter into and
     perform this Agreement and to carry out the transactions contemplated
     herein.

(d)  Genentech has taken all necessary corporate and legal action to authorize
     the execution, delivery, and performance of this Agreement.

(e)  No consent or authorization of, filing with or any other act by or in
     respect of any other person (including any shareholder or creditor) or
     court is required in connection with the settlement of All Claims as set
     forth in this Agreement or with the execution, delivery, or performance by
     Genentech or the validity or enforceability as to Genentech of this
     Agreement.

(f)  This Agreement has been duly executed and delivered by Genentech and
     constitutes a legal, valid and binding obligation of Genentech enforceable
     against Genentech in accordance with its terms; provided, that this
     representation is not intended to apply to Section 2.7 of the Agreement.

(g)  No promise or representation of any kind has been made to Genentech or by
     anyone acting for Genentech, except as is expressly stated in this
     Agreement.

(h)  Genentech is the lawful owner of All Claims asserted by Genentech in the
     Lawsuit and has not assigned, pledged, or in any other manner sold or
     transferred any right, title, interest, or claim that arises out of or is
     the subject of the incident and/or the Lawsuit.

(i)  In entering this Agreement, Genentech has had the benefit of the advice of
     lawyers of its own choosing; and Genentech enters this Agreement freely, by
     Genentech's own choice, and judgment, and without duress or other
     influence.

(j)  Genentech understands that this Agreement is a full, final, and complete
     release of the other Party to this Agreement and that the Consideration
     includes the ONLY benefits Genentech shall ever receive from such Party as
     a result of the incident and the Lawsuit.

(k)  Genentech recognizes that the recitations contained in this Agreement are
     contractual and not a mere recital.

<PAGE>
                                    EXHIBIT 4
                                 PAYMENT AMOUNTS


                        EVENT                                    PAYMENT AMOUNT
                    -------------                               ----------------

(a) Execution of this Agreement and dismissal of all claims in          *
    the Lawsuit as described in Paragraph 2.1 of this Agreement.

(b) Initiation of the first Pivotal Clinical Trial                      *

(c) Filing of the first Product License Application (or                 *
    equivalent in the U.S.)

(d) First approval by the Food and Drug Administration of a             *
    Product License Application (or equivalent in the U.S.)

(e) At such time as total annual net sales of all Genentech             *
    Licensed Products and Anti-IgE Antibody products sold
    under the Outline of Terms and Definitive Agreement
    first exceed *

If the total payment set forth above has been made by Genentech under this
Agreement for an event described above, no additional payment shall be due under
this Agreement for any subsequent occurrence that is covered by the language
describing that event.

<PAGE>
                                    EXHIBIT 5
                               SECTION 9.0 PATENTS


U. S. Patent Nos.    4,356,270
                     4,366,246
                     4,425,437
                     4,431,739
                     4,571,421
                     4,704,362
                     5,221,619
                     5,420,020

   and any and all patents maturing from applications that are divisionals,
continuations or continuations-in-part of the parent applications of any of the
foregoing; foreign counterparts, if any, of the foregoing; and any and all
reissues or extensions of any of the foregoing.

   U. S. Patent No. 4,816,567 and the claims relating to chimeric antibodies
found in patents or patent applications arising from divisionals, continuations
or continuations-in-part of any application from which U.S. Patent No. 4,816,567
claims priority (excluding U.S.S.N. 07/205,419 and foreign counterparts thereof)
as well as the foreign counterparts of the foregoing and any and all reissues,
reexaminations or extensions of the foregoing; and

   any patent issuing based on U.S.S.N. 07/205,419 (a continuation of the
application maturing into U. S. Patent No. 4,816,567) relating to the
coexpression of immunoglobulin chains in recombinant host cells, as well as the
divisionals, continuations or continuations-in-part of such application as well
as foreign counterparts, if any, of the foregoing; and any and all reissues,
reexaminations or extensions of the foregoing.


<PAGE>
                                    EXHIBIT 6
                           TANOX PRODUCT OPPORTUNITIES

   o   Allergen-specific human IgA antibodies for mucosal administration.

   o   Anti-HIV-1 neutralizing antibodies.

   o   MIGIS-mIgA antibodies (against a portion of membrane IgA).

   o   MIGIS-mIgG antibodies (against a portion of membrane IgG). o MIGIS-mIgM
       antibodies (against a portion of membrane IgM).

   o   Anti-Rh antibodies.

   o   Antibodies against adipocytes.

   o   Anti-tissue factor antibodies.

   o   Anti-complement pathway antibodies.

   o   Anti-Epstein Barr virus antibodies.

   o   Anti-mb-1 antibodies.

   o   Anti-drug resistant bacteria MAbs

   o   Therapeutic immunogen for treating human IgE-mediated diseases. o Novel
       anti-HIV binding protein and related products. o PLATAR (Polyvalent
       ligand against T-cell antigen receptors): Polyvalent binding
       fragments of T-cell receptors, including anti-CD3).

<PAGE>
                                    EXHIBIT 7

Foreign patents and applications based on U.S. Serial No. 07/110,255 entitled
METHOD AND THERAPEUTIC COMPOSITIONS FOR THE TREATMENT OF BLEEDING DISORDERS
filed October 20, 1987, which is a continuation-in-part of U.S. Serial No.
06/926,977

and

U.S. and foreign patents and applications based on U.S. Serial No. 07/237,585
entitled METHOD AND THERAPEUTIC COMPOSITIONS FOR THE TREATMENT OF MYOCARDIAL
INFARCTION filed August 25, 1988, which is a continuation-in-part of U.S. Serial
No. 07/209,665 filed June 21, 1988, which is a continuation-in-part of U.S.
Serial No. 110,2565 filed October 20, 1987, which is a continuation-in-part of
U.S. Serial No. 06/926,977 filed Nov. 4, 1986.

                                                                   EXHIBIT 10.17

CERTAIN INFORMATION IN THIS EXHIBIT IS SUBJECT TO A REQUEST FOR CONFIDENTIAL
TREATMENT. IN ACCORDANCE WITH RULE 406 UNDER THE SECURITIES ACT OF 1933, AS
AMENDED, SUCH INFORMATION HAS BEEN OMITTED AND FILED SEPARATELY WITH THE
SECURITIES AND EXCHANGE COMMISSION. THE LOCATION OF SUCH OMITTED INFORMATION HAS
BEEN INDICATED WITH AN ASTERISK(*).

                                  CONFIDENTIAL
                              TANOX BIOSYSTEMS INC.

                     Settlement and Participation Agreement

     This Settlement and Participation Agreement ("Agreement") is entered into
effective as of July 8, 1996 ("Effective Date") between Tanox Biosystems, Inc.,
a Texas corporation, with its principal offices at 10301 Stella Link, Houston,
Texas 77025 ("Tanox") and F. Hoffmann-La Roche Ltd. with its principal offices
at CH-4070, Basal, Switzerland ("Roche"), Hoffmann-La Roche, Inc., Roche Holding
Ltd. and Roche Holdings, Inc., (collectively with Roche, the "Roche Entities").

     Tanox and the Roche Entities are parties to a lawsuit, Civil Action No.
H-94-0189, in the United States District Court for the Southern District of
Texas, Houston Division, styled TANOX BIOSYSTEMS. INC. V. GENENTECH. INC. ET
AL., resulting from the consolidation of Civil Action No. H-94-0239, styled
TANOX BIOSYSTEMS. INC. V. GENENTECH. INC., ET. AL. with Civil Action No.
H-94-0189, styled GENENTECH., INC. V. TANOX BIOSYSTEMS. INC. (the "Lawsuit"),
which they desire to settle.

     Tanox, Genentech, Inc. ("Genentech") and Ciba-Geigy Ltd. ("Ciba"), together
with the participation of Roche, also have reached an agreement in principle
under which Genentech and Tanox and Ciba would merge their respective anti-IgE
antibody projects. Such agreement has been memorialized in an Outline of Terms
which Tanox, Genentech, and Ciba are executing on the Effective Date and which
provides for the development and commercialization of one or more anti-IgE
products with the participation of Roche, should it exercise certain options
provided therein {the "Multiparty Transaction").

     Discussions relating to the Multiparty Transaction and settlement of the
Lawsuit also have culminated in an agreement between Tanox and Genentech
entitled Settlement and Cross-Licensing Agreement which has been executed prior
to or simultaneously with the Effective Date {the "Genentech Agreement") and in
certain additional agreements between Tanox and Roche relating to such
collaboration and to certain licensing relationships based on the Parties desire
to avoid the possibility of future disputes.

                                       1
<PAGE>
     Therefore, Tanox and Roche agree as follows:

     1.0 DEFINITIONS. In addition 10 the words otherwise used as defined 1em1s
throughout this Agreement, the words set forth below will have the meanings
indicated when used in this Agreement.

     1.1 "AFFILIATE" shall mean (i) an organization fifty (50%) percent or more
of the voting stock of which is owned and/or controlled directly or indirectly
by either Party; (ii) an organization which directly or indirectly owns and/or
controls fifty percent (50%) or more of the Voting stock of either Party; (iii)
an organization which is directly or indirectly under common control of either
Party through common share holdings; or (iv) an organization as to which either
Party can demonstrate that the operation and management of such organization is
under the control, directly or indirectly, of the Party.

     1.2 "ALL CLAIMS" shall mean all existing and future claims, demands, and
causes of action, known or unknown pending or threatened, for all existing and
future damages and remedies (i) that arise out of or are in any way related to
the Incident and (ii) that were brought, could have been brought, or were sought
to be brought in the Lawsuit. Under this definition, "All Claims" includes but
is not limited to all claims, demands, lawsuits, debts, accounts, covenants,
liens, encumbrances, agreements, actions, counterclaims, cross-actions,
liabilities, obligations, losses, attorney's fees, costs, expenses, remedies,
and causes of action of any nature, whether in contract or in tort, or based
upon fraud or misrepresentation, breach of duty or common law, or arising under
or by virtue of any judicial decision, or federal, state or foreign statute or
regulation, for past present and future damages, property or economic damage,
and for all other losses and damages of any kind, including BUT NOT LIMITED TO
the following: all actual damages; all exemplary and punitive damages; all
penalties of any kind, including WITHOUT LIMITATION any tax liabilities or
penalties; lost profits or goodwill; consequential damages; damages ensuing from
loss of credit; damages ensuing from breach of the covenant or

                                       2
<PAGE>
duty of good faith and fair dealing; damages ensuing from breach of any
federal, state or foreign antitrust law; damages ensuing from breaches of
confidential and fiduciary duties; damages ensuing from breach of contract;
damages ensuing from actual or constructive fraud; and prejudgment and post
judgment interest, costs and attorney's fees.

     1.3 "ANTI-IgE ANTIBODY(IES)" shall mean an antibody directed against the
immunoglobulin IgE as an antigen, fragments or conjugates of such antibodies,
and other constructs comprising antibodies which are derived from or contain any
of the above-specified components. ANTI-IgE ANTIBODY PRODUCT(S) means any
pharmaceutical formulation, product, method or system which contains an Anti-IgE
Antibody.

     1.4 "CONSIDERATION" shall mean the value or benefit to each of the Parties,
respectively, of-the licenses, royalties, payments and agreements contained
herein, in the Genentech Agreement and in the Outline of Terms and all other
mutual promises, covenants, agreements, releases, and representations set forth
in this Agreement.

     1.5 "INCIDENT" shall mean the negotiations, beginning in 1989 and ending in
December 1993, between Tanox and Genentech with regard to a potential
collaboration in the identification and development of anti-immunoglobulin E
("anti-IgE") monoclonal antibodies and anti-IgE therapy; the agreements entered
into pursuant to those negotiations, as well as any supplements or amendments to
those agreements ("the Collaboration Agreements"), including but not limited to
a Confidentiality Agreement dated (by Tanox) March 29, 1989 and a Biological
Material Transfer and Confidentiality Agreement dated (by Tanox) July 27, 1989;
negotiations concerning the construction and meaning of the Collaboration
Agreements; the performance of the Collaboration Agreements; any interference in
the performance of the Collaboration Agreements; any statements regarding the
performance of the Collaboration Agreements; any acts or events prior to or
subsequent to the negotiation or execution of the Collaboration Agreements that
form the basis of any cause of action alleged in or that could have been alleged
in the Lawsuit; any other matters arising out of the Collaboration Agreements;
the use by

                                       3
<PAGE>
Genentech of information provided by Tanox to Genentech pursuant to the
Collaboration Agreements or otherwise during such negotiations; the solicitation
and obtaining of licensing rights heretofore from third parties in the area of
monoclonal antibody research and technology; the research, development and
commercialization of anti-IgE monoclonal antibodies and/or anti-IgE therapy
heretofore; any infringement heretofore of patents rights held at any time by
the Parties to this Agreement regarding recombinant immunoglobulin preparations
and monoclonal antibody identification and development; and any statements or
representations heretofore made by either Party regarding research, development
and commercialization of anti-IgE monoclonal antibodies and/or anti-igE therapy.

     1.6 "OUTLINE OF TERMS" shall mean the agreement between Tanox, Genentech
and Ciba which sets forth the basic terms agreed by such parties with respect to
the joint development and commercialization of Anti-IgE Antibodies, with the
participation of Roche to the extent it exercises its options thereunder, and
which is intended to be followed and superseded by a definitive agreement(s) as
contemplated by Section 8.2 of the Outline of Terms [which agreement(s) is
referred to as the ("Definitive Agreement")].

     1.7 "PARTY" shall mean, when used in the singular, either Tanox or the
Roche Entities, as appropriate, and "Parties" shall mean Tanox and the Roche
Entities.

     1.8 "PERSON" OR "PERSONS" shall include any natural person, as well as any
entity such as a corporation, partnership, proprietorship, or business
association.

     1.9 "ROCHE ENTITIES" shall mean, jointly and severally, each and all of the
following companies and their Affiliates (excluding Genentech): F. Hoffmann-La
Roche Ltd. Hoffmann-LaRoche, Inc., Roche Holding Ltd., and Roche Holdings, Inc.

                                       4
<PAGE>
     2.0 MUTUAL RELEASE, INDEMNIFICATION AND SETTLEMENT AGREEMENT

     2.1 DISMISSAL OF LAWSUIT. Tanox and the Roche Entities agree as follows:

          (i)  Tanox will file a motion to dismiss its claims in the Lawsuit
               against the Roche Entities with prejudice; and

          (ii) each of the parties shall bear its own costs of court incurred.

     2.2 RELEASE OF ROCHE ENTITIES. For the Consideration, including the
agreements set forth in this Section 2, Tanox hereby RELEASES, ACQUITS, and
FOREVER DISCHARGES the Roche Entities and (I) all of their present or former
agents, employees, officers, directors, shareholders, partners, joint venturers,
and attorneys; (ii) all companies partnerships, joint ventures, or firms
affiliated with or subsidiary to, the Roche Entities; (iii) their predecessors,
successors, and assigns; (iv) all other persons, partners, joint venturers,
firms, partnerships, joint ventures, and corporations for whose conduct the
Roche Entities may be liable; and (v) all of their insurers from All Claims that
have accrued or that may ever accrue to Tanox or any person or persons now or
hereafter claiming by, through, or under Tanox.

     2.3 RELEASE OF TANOX. For the Consideration including the agreements set
forth in this Section 2, the Roche Entities RELEASE, ACQUIT, and FOREVER
DISCHARGE Tanox and (i) all of its present or former agents, employees,
officers, directors, shareholders, partners, joint venturers, and attorneys;
(ii) all companies, partnerships, joint ventures, or firms affiliated with or
subsidiary to Tanox; (iii) its predecessors, successors, and assigns; (iv) all
other persons, partners, joint venturers, firms, partnerships, joint ventures,
and corporations for whose conduct Tanox may be liable; and (v) all of its
insurers from All Claims that have accrued or that may ever accrue to the Roche
Entities or any person or persons now or hereafter claiming by, through, or
under the Roche Entities.

                                       5
<PAGE>
     2.4 NO ADMISSION OF LIABILITY. Agreement to the Consideration is not an
admission of liability and may not be so construed. The Roche Entities
vigorously deny the position taken by Tanox in the Lawsuit and Tanox
acknowledges the highly disputed nature of its claims in the Lawsuit. Tanox
vigorously denies the position taken by the Roche Entities in the Lawsuit, and
the Roche Entities acknowledges the highly disputed nature of their defenses in
the Lawsuit. Each party acknowledges that this Agreement is made as a
compromise to avoid further expense and to terminate for all time the
controversies which were asserted, could have been asserted, or were sought to
be asserted in the Lawsuit.

     2.5 INDEMNIFICATION BY TANOX. Tanox agrees to INDEMNIFY and to DEFEND and
to HOLD HARMLESS the Roche Entities and (i) all of their present or former
agents, employees, officers, directors, shareholders, partners, joint venturers,
and attorneys; (ii) all companies, partnerships, joint ventures, or firms
affiliated with or subsidiary to, the Roche Entities; (iii) their predecessors,
successors, and assigns; (iv) all other persons, partners, joint venturers,
firms, partnerships, joint ventures, and corporations for whose conduct the
Roche Entities may be liable; and (v) all of their insurers from All Claims,
together with all costs, expenses, and legal fees, that may be asserted against
the Roche Entities by any person, entity, firm, or corporation claiming by,
through, or under Tanox, that arise out of the Incident and/or the Lawsuit.

     2.6 INDEMNIFICATION BY THE ROCHE ENTITIES. The Roche Entities agree to
INDEMNIFY and to DEFEND and to HOLD HARMLESS Tanox and (i) all of its present or
former agents, employee, officers, directors, shareholders, partners, joint
venturers, and attorneys; (ii) all companies, partnerships, joint ventures, or
firms affiliated with or subsidiary to Tanox; (iii) its predecessors,
successors, and assigns; (iv) all other persons, partners, joint venturers,
firms, partnerships joint ventures, and corporations for whose conduct Tanox may
be liable; and (v) all of its insurers from All Claims, together with all costs,
expenses, and legal fees, that may be asserted against Tanox by any person,
entity,

                                       6
<PAGE>
firm, or corporation claiming by, through, or under the Roche Entities that
arise out of the Incident and/or the Lawsuit

     2.7 NO OPPOSITION. The Roche Entities represent and warrant that they have
not filed any opposition in the European Patent Office to Tanox's patent No.
EP-B-407392 relating to Anti-IgE Antibodies or taken any other actions to
re oppose, request the examination of, or otherwise challenge the validity or
enforceability, directly or indirectly, of any Tanox patents covering Anti-IgE
Antibodies.

     2.8 ANTI-IgE ANTIBODY PATENTS. The Roche Entities represent and warrant to
Tanox that they do not have knowledge of any patents owned in whole or in part
and/or controlled by them which would prevent Tanox from being able to make, use
and sell Anti-IgE Antibodies. If Roche has exercised its option set forth in the
Outline of Terms (or Definitive Agreement) in a particular country or has
received a sublicense or assumed Genentech's rights and obligations under the
Genentech Agreement, then to the extent the Roche Entities should ever own in
whole or in part and/or control any such patents the Roche Entities agree to
grant to Tanox under all such patents a royalty-free, non-exclusive,
sublicensable license to make, have made, use, sell, have sold and import
Anti-IgE Antibodies for the treatment, prophylaxis or diagnosis of any disease
or condition in humans and animals in the country or territory with respect to
which Roche has exercised its options under the Outline of Terms (or Definitive
Agreement) or has received a sublicense or assumed Genentech's rights and
obligations under the Genentech Agreement.

     2.9 EXEMPTION FROM PROTECTIVE ORDER. Notwithstanding the terms of the
protective order agreed in connection with the Lawsuit, the Parties agree that
the employees, experts and consultants of a Party having access to information
during the course of the Lawsuit will not be prohibited from participating in
on-going development and commercialization activities associated with the
Anti-IgE Antibody projects of such Party

                                       7
<PAGE>
and/or development and commercialization activities of the Parties pursuant to
the Outline of Terms or Definitive Agreement.

     2.10 REPRESENTATIONS OF TANOX. Tanox makes the representations and
warranties set forth in Exhibit 1 to the Roche Entities.

     2.11 REPRESENTATIONS OF ROCHE. The Roche Entities make the representations
and warranties set forth in Exhibit 2 to Tanox.

     3.0 BENEFICIARY OF AGREEMENTS. On the Effective Date, Tanox, Ciba and
Genentech have executed the Outline of Terms. The Outline of Terms and
Definitive Agreement, together with that certain Development and Licensing
Agreement dated May 11, 1990, between Tanox and Ciba (the "D & L Agreement"),
shall among them govern the development and commercialization of one or more
anti-IgE Products (as such term is used in the Outline of Terms) which have been
identified and synthesized by Tanox, Ciba, or Genentech before July 1, 1996.
Additionally, on the Effective Date, Tanox and Genentech have executed the
Genentech Agreement which, among other things, grants certain additional license
rights to such parties which may be effective in addition to or in lieu of
rights under the Outline of Terms and Definitive Agreement. The Parties
acknowledge that under such agreements, including the Genentech Agreement, and
subject to certain agreements between Roche and Genentech, Roche will have
certain rights to participate in the development and commercialization of
Anti-IgE Antibody products.

     4.0 LICENSES FOR ANTI-IgE ANTIBODY PATENTS. If (i) Roche has exercised its
options set forth in the Outline of Terms (or Definitive Agreement) in a country
or has received a sublicense or assumed Genentech's rights and obligations under
the Genentech Agreement in a particular country and (ii) the Roche Entities
should ever desire to obtain exclusive access to a patent owned and/or
controlled by a third party which covers Anti-IgE Antibodies in such country in
any manner, then the Roche Entities will acquire rights to

                                       8
<PAGE>
such patent in a manner which reserves for Tanox the opportunity to obtain
co-exclusive rights to such patent for Anti-IgE Antibodies in such country.

5.0 ADDITIONAL LICENSES. Subject to all of the existing licenses and existing
agreements that restrict the ability of 1he Roche Entities to grant licenses and
subject to the additional restrictions set forth below, "the Roche Entities
agree to grant to Tanox, a worldwide, nonexclusive, nonsublicenseable (except to
Affiliates, but only in conjunction with the license of a specific product)
license to make, have made, use, sell, have sold and import products for * under
patents owned by the Roche Entities now or in the future, and which the Roche
Entities have made or agree to make generally available on a non-exclusive
basis, except that such products shall not include those (i) that are the
subject of a prior exclusive license by the Roche Entities to a third party;
(ii) that are the subject of an active research or development program of the
Roche Entities; or (iii) that compete with, or will compete with, a then current
product of the Roche Entities or a product in an active research and/or
development program of the Roche Entities; provided, however, that if any such
patents desired by Tanox shall be subject to exclusive rights to a third party
which would prevent the license desired by Tanox , the Roche Entities agree that
Tanox shall have the right to negotiate a sublicense, if possible, from any such
third party on terms agreed between Tanox and such third party. The Roche
Entities also agree to negotiate in good faith with Tanox on the availability of
such a license for Tanox products under other patents owned by the Roche
Entities. The Parties agree to negotiate in good faith the royalty rate and
terms on which any license will be granted. Subject to the limitations set forth
above, Tanox may exercise its right to such a license, without threat of suit or
penalty from the Roche Entities, with respect to a product at any time prior to
the date of the first commercial sale of such product to an independent third
party following regulatory approval to sell such product. If Tanox should ever
have under development a product which could be subject to the restrictions on
receiving a license set forth herein, then the Roche Entities or Tanox should
notify the other of such possibility prior to taking any other actions. If the
Parties are unable to resolve the issues prior to the time the

                                       9
<PAGE>
activities of Tanox would constitute an infringement of a patent owned and/or
controlled by the Roche Entities pursuant to applicable laws, which resolution
could include a collaboration or cross-licensing opportunity or Tanox's express
agreement not to manufacture, develop or market in such country in which a valid
claim of any patent of the Roche Entities covering such product may exist, then
the Roche Entities shall be entitled to pursue such legal or other actions as
they may determine, in their sole discretion, to be appropriate under the
circumstances.

     6.0 CONFIDENTIALITY. In connection with preparation and during the term of
this Agreement, one Party may disclose to the other or receive written
information from the other relating to the subject matter of this Agreement
which information, if so identified in writing either pursuant to this Section
6.0 or otherwise upon disclosure, shall be considered to be the disclosing
Party's Confidential Information. Each Party agrees that it will take the same
steps to protect the confidentiality of the other Party's Confidential
Information as it takes to protect its own proprietary and Confidential
Information. Each Party shall protect and keep confidential and shall not use,
publish or otherwise disclose to any third party, except as permitted by this
Agreement or with the other Party's written consent, the other Party's
Confidential Information for a period of ten (10) years from the date of
disclosure, respectively, of any such Confidential Information. For the purposes
of this Agreement, Confidential Information shall not include such information
that (i) was lawfully known to the receiving Party at the time of disclosure;
(ii) was generally available to the public or was otherwise part of the public
domain at the time of disclosure or became generally available to the public or
otherwise part of the public domain after disclosure other than through any act
or omission of the receiving Party in breach of this Agreement; (iii) became
known to the receiving Party after disclosure from a source that had a lawful
right to disclose such information to others; or (iv) is required to be
disclosed by the receiving Party to comply with applicable laws, to defend or
prosecute litigation or to comply with governmental regulations, provided that
the receiving Party provides prior written notice of such disclosure to the
other Party and takes reasonable and lawful actions to avoid and/or minimize the
degree of such disclosure.

                                       10
<PAGE>
Notwithstanding the above, the Parties may disclose Confidential information to
their legal representatives, to Affiliates and their legal representatives, and
to consultants (to the extent such disclosure is intended to further the
purposes contemplated under this Agreement) and provided such legal
representatives, Affiliates and consultants have agreed in writing to be bound
to protect the confidentiality of such information in a manner at least as
restrictive as that generally set forth herein.

     7.0 TERM; DEFAULT; SURVIVAL.

     7.1 TERM. Except as otherwise set forth herein, this Agreement shall
terminate at such time following the first commercial sale of an Anti-IgE
Antibody product as royalties are no longer owed to Tanox by or as a result of
sales for the benefit of the Roche Entities or any Affiliate, excluding
Genentech or sales by or for the benefit of Genentech. Notwithstanding the
foregoing, this Agreement shall terminate upon the prior occurrence of the
expiration unexercised of any option rights which the Roche Entities may have
under the Outline of Terms or Definitive Agreement and the expiration
unexercised of any rights which the Roche Entities may have to receive a
sublicense or to assume Genentech's rights and obligations under the Genentech
Agreement.

     7.2 DEFAULT. Failure by either Party (the "defaulting Party") to comply
with any of the material obligations contained in this Agreement shall entitle
the other Party (the "nondefaulting Party") to give the defaulting Party notice
specifying the nature of the default and requiring it to cure such default. If
such default is not cured within the sixty (60) day period after the receipt of
such notice, the nondefaulting Party shall be entitled, except as otherwise
specifically provided in this Agreement and without prejudice to any of its
other rights conferred on it by this Agreement, to terminate all or part of this
Agreement.

     7.3 SURVIVAL OF PROVISIONS. The obligations of the Parties under Sections
2.0 and 6.0 shall survive any termination of this Agreement, except to the
extent limited therein.

                                       11
<PAGE>
     8.0 GENERAL PROVISIONS.

     8.1 ADEQUACY OF CONSIDERATION. By signing this Agreement, each Party to
this Agreement acknowledges the receipt by such Party and the sufficiency to
such party of the Consideration.

     8.2 NOTICES. All notices which may be required pursuant to this Agreement
(i) shal1 be in writing, (ii) shal1 be addressed, in the case of the Roche
Entities (except as otherwise specified herein), to Corporate Law, F.
Hoffmann-La Roche Ltd. at the address set forth at the beginning of this
Agreement and to Corporate Secretary, Hoffmann-La Roche, Inc., 340 Kingsland St,
Nutley, N.J. 07110, and in the case of Tanox to the President at the address set
forth at the beginning of this Agreement, (or to such other person or address as
either Party may so designate from time to time), (iii) shall be mailed,
postage-prepaid, by registered mail or certified mail, return receipt
requested, or transmitted by courier for hand delivery or sent by express
courier service, and (iv) shall be deemed to have been given on the date of
receipt if sent by mail or on the date of delivery if transmitted by courier or
express courier service.

     8.3 ENTIRE AGREEMENT. This Agreement is the entire agreement between the
Parties regarding the subject matter hereof, and there are no prior written or
oral promises or representations not incorporated herein. No amendment or
modification of the terms of this Agreement shall be binding on either Party
unless reduced to writing and signed by an authorized officer of the Party to be
bound.

     8.4 BINDING EFFECT. This Agreement shall be binding upon and inure to the
benefit of the Parties hereto, Affiliates, and their respective successors and
permitted assigns. This Agreement shall not be assignable by either Party
without the other's prior written consent, except that this Agreement may be
assigned in whole or in part to an Affiliate or a successor to all or
substantially all of a Party's business by merger, sale of assets, sale of stock
or otherwise.

                                       12
<PAGE>
     8.5 WAIVER. The waiver by a Party hereto of any breach of or default under
any of the provisions of this Agreement or the failure of a Party to enforce any
of the provisions of this Agreement or to exercise any right thereunder shall
not be construed as a waiver of any other breach or default or as a waiver of
any such rights or provisions hereunder.

     8.6 SEVERABILITY. If any part of this Agreement shall be invalid or
unenforceab1e under applicable law, such part shall be ineffective only to the
extent of such invalidity or unenforceability, without in any way affecting the
remaining parts of this Agreement. In addition, the part that is ineffective
shall be reformed in such a manner as to as nearly approximate the intent of
the Parties as possible.

     8.7 PUBLICITY. Except for disclosure that settlement of the Lawsuit has
occurred, neither the Roche Entities nor Tanox shall issue any public statement
concerning this Agreement without the other Party's reasonable prior written
consent; provided, however, that either Party may disclose the transaction or
the terms hereof or thereof from time to time without the other Party's consent
(i) if such consent has been requested and not received and such information is
set forth in disclosures to investors and prospective investors in the
securities of a Party pursuant to laws, rules and regulations covering any such
transactions or such Party has a written opinion from outside counsel that it is
otherwise required by law to disclose the transaction or the terms thereof, or
(ii) to the extent that similar disclosure has been previously approved by the
Parties pursuant to this Section 8.7. The foregoing notwithstanding, Tanox may
disclose the terms of this Agreement to its shareholders, investment bankers and
other financial consultants, and prospective investors in Tanox, provided that
the recipients of such information agree to be bound to protect the
confidentiality of that information for a period of at least three (3) years and
in a manner otherwise at least as restrictive as that generally set forth in
Section 6.0 above.

                                       13
<PAGE>
     8.8 NO PARTNERSHIP. Nothing in this Agreement is intended or shall be
deemed to constitute a partnership, agency, employer-employee or joint venture
relationship between the Parties. No party shall incur any debts or make any
commitments for the other.

     8.9 SURVIVAL OF REPRESENTATIONS. All agreements and representations made by
the parties in this Agreement shall survive the execution and delivery of this
Agreement, the receipt of the Consideration, and the execution and delivery of
any other instrument, or the taking of any other actions required or provided
for in this Agreement.

     8.10 DISPUTE RESOLUTION. The laws of the State of New York shall govern the
construction and interpretation of this Agreement, and any action to enforce
this agreement or resolve any disputes shall be by binding arbitration conducted
pursuant to the then current American Arbitration Association ("AAA") Commercial
Arbitration rules in New York City, New York, such arbitration to be conducted
by a panel of three arbitrators selected from a pool of arbitrators to be
presented to the Parties by AAA.

     8.11 AGREEMENT TO PERFORM NECESSARY ACTS. Each Party agrees to perform any
further acts and execute and deliver any and all further documents, agreements,
and/or instruments which may be reasonably necessary or desirable to carry out
or effect the provisions of this Agreement.

     8.12 COUNTERPARTS. This Agreement may be executed in counterparts, and each
such counterpart shall be deemed an original for all purposes.

                                       14
<PAGE>
F. Hoffman-La Roche Ltd                         Roche Holding Ltd
By:   ILLEGIBLE                                 By:   ILLEGIBLE
Title: Authorized Signatory                     Title: Director

By:   ILLEGIBLE                                 By:   ILLEGIBLE
Title: Director                                 Title: Director

Hoffman-La Roche Inc.                           Roche Holdings, Inc
By:   ILLEGIBLE                                 By:   ILLEGIBLE
Title: V.P.                                     Title: Secretary

Tanox Biosystems, Inc.
By: David Anderson
Title: Executive Vice President

                                       15
<PAGE>
                                   EXHIBIT 1
                    Representations and Warranties by Tanox

(a)  Before executing this Agreement, Tanox became fu11y informed of the terms
     contents, conditions, and effect of this Agreement.

(b)  Tanox is a corporation duly organized, existing, and in good standing under
     the laws of the State of Texas.

(c)  Tanox possesses all requisite power and authority to enter into and perform
     this Agreement and to carry out the transactions contemplated herein.

(d)  Tanox has taken a1l necessary corporate and legal addition to authorize the
     execution, delivery, and performance of this Agreement.

(e)  No consent or authorization of, filing with or any other act by or in
     respect of any other person (including any shareholder or creditor) or
     court is required in connection with the settlement of All Claims as set
     forth in this Agreement or with the execution, delivery, or performance by
     Tanox or the validity or enforceability as to Tanox of this Agreement.

(f)  This Agreement has been duly executed and delivered by Tanox and
     constitutes a legal, valid and binding obligation of Tanox enforceable
     against Tanox in accordance with its terms.

(g)  No promise or representation of any kind has been made to Tanox or by
     anyone acting for Tanox, except as is expressly stated in this Agreement.

(h)  Except for certain claims or portions thereof which may have been assigned
     to its attorneys, Tanox is the lawful owner of All Claims asserted by Tanox
     in the Lawsuit and has not assigned, pledged, or in any other manner sold
     or transferred any right, title, interest, or claim that arises out of or
     is the subject of the Incident and/or the Lawsuit.

(i)  In entering this Agreement, Tanox has had the benefit of the advice of
     lawyers of its own choosing; and Tanox enters this Agreement freely, by
     Tanox's own choice and judgment, and without duress or other influence.

(j)  Tanox understands that this Agreement is a full, final, and complete
     release of the other Party to this Agreement and that the Consideration
     includes the ONLY benefits Tanox shall ever receive from such Party as a
     result of the Incident and the Lawsuit.

(k)  Tanox recognizes that the recitations contained in this Agreement are
     contractual and not a mere recital.
<PAGE>
                                   EXHIBIT 2
              Representations and Warranties by The Roche Entities

(a)  Before executing this Agreement, the Roche Entities became fully informed
     of the terms, contents, conditions, and effect of this Agreement.

(b)  The Roche Entities are corporations duly organized, existing, and in good
     standing under the laws of the respective states, cantons, and countries
     under which they have been organized.

(c)  The Roche Entities possess all requisite power and authority to enter into
     and perform this Agreement and to carry out the transactions contemplated
     herein.

(d)  The Roche Entities have taken all necessary corporate and legal action to
     authorize the execution, delivery, and performance of this Agreement.

(e)  No consent or authorization of, filing with or any other act by or in
     respect of any other person (including any shareholder or creditor) or
     court is required in connection with the settlement of All Claims as set
     forth in this Agreement or with the execution, delivery, or performance by
     the Roche Entities or the validity or enforceability as to the Roche
     Entities of this Agreement.

(f)  This Agreement has been duly executed and delivered by the Roche Entities
     and constitutes a legal, valid and binding obligation of the Roche Entities
     enforceable against the Roche Entities in accordance with its terms.

(g)  No promise or representation of any kind has been made to the Roche
     Entities or by anyone acting for the Roche Entities, except as is expressly
     stated in this Agreement.

(h)  In entering this Agreement, the Roche Entities have had the benefit of the
     advice of lawyers of its own choosing; and the Roche Entities enter this
     Agreement freely, by their own choice and judgment, and without duress or
     other influence.

(i)  The Roche Entities understand that this Agreement is a full, final, and
     complete release of the other Party to this Agreement and that the
     Consideration includes the ONLY benefits the Roche Entities shall ever
     receive from such Party as a result of the Incident and the Lawsuit.

(j)  The Roche Entities recognize that the recitations contained in this
     Agreement are contractual and not a mere recital.

                                                                   EXHIBIT 10.22

                 G-CSF RECEPTOR NON-EXCLUSIVE LICENSE AGREEMENT

     THIS G-CSF RECEPTOR NON-EXCLUSIVE LICENSE AGREEMENT is entered into and
made effective this 11th day of January, 2000, by and between IMMUNEX
CORPORATION, a corporation of the state of Washington, having its principle
place of business as 51 University Street, Seattle, Washington 98101
(hereinafter referred to as "Immunex"), and TANOX, INC., a corporation of the
State of Texas, and having a place of business at 10301 Stella Link, Houston,
Texas 77025.

                                   BACKGROUND

          WHEREAS, Immunex is a biopharmaceutical company engaged in the
     research, development, marketing and sale of therapeutics for treating
     human disease. Immunex owns proprietary and confidential information and
     intellectual property relating to G-CSF Receptor ("G-CSF Receptor
     Technology"). Immunex is the sole owner of and has full right to the
     Licensed Patent Rights (as defined below):

          WHEREAS, Licensee (as defined herein) wishes to obtain *

          WHEREAS, the use of G-CSF Receptor Technology is valuable to Licensee
     in the discovery, research and development of Developed Products;
     therefore, Licensee is willing to compensate Immunex for such use by paying
     Immunex a royalty calculated as a percentage of Net Sales (as defined
     below) of Developed Products, in addition to license execution and
     maintenance fees and fees payable upon the achievement of certain
     milestones relating to Developed Products.

                                   AGREEMENT

     NOW THEREFORE, in consideration of the premises and mutual covenants and
agreements contained herein, and for good and other valuable consideration, the
receipt and sufficiency of which is hereby acknowledged, Immunex and Licensee,
intending to be legally bound hereby, do hereby agree as follows:
<PAGE>
1.  DEFINITIONS

     1.1  "AFFILIATE" shall mean any corporation, company, partnership, joint
venture, firm or other entity which directly or indirectly owns, is owned by or
is under common ownership with a Party (as defined below) where "owns" or
"ownership" means possession of at least fifty percent (50%) of the equity (or
such lesser percentage which is the maximum allowed to be owned by a foreign
corporation in a particular jurisdiction or such lesser percentage provided the
operational control is held by the Party) having the power to vote on or direct
the affairs of the entity and any person, firm, partnership, corporation or
other entity actually controlled by, controlling or under common control with a
Party.

     1.2  "CALENDAR QUARTER" shall mean each three (3) month period commencing
January 1, April 1, July 1 and October 1 of each year during the Term (as
defined in Section 5.1) of this Agreement.

     1.3  "DEVELOPED PRODUCT" *

     1.4  "EFFECTIVE DATE" shall mean the date this Agreement is effective,
which shall be the date first indicated above.

     1.5  "FIELD" *

     1.6  "FORCE MAJEURE" shall mean any act of God or the public enemy, any
accident, explosion, fire, storm, earthquake, flood, drought, peril of the sea,
riot, embargo, war or foreign, federal, state or municipal order issued by a
court or other authorized official, seizure, requisition or allocation, any
failure or delay of transportation, shortage of or inability to obtain supplies,
equipment, fuel or labor or any other circumstance or event beyond the
reasonable control and without the fault or negligence of the Party relying upon
such circumstance or event.

     1.7  "LICENSED PATENT RIGHTS" *

                                       2
<PAGE>
     1.8  "LICENSEE" shall mean Tanox, Inc. and/or its Affiliates, as
applicable.

     1.9  "NET SALES" *

     1.10  "PARTY" shall mean either Immunex or Licensee, as applicable. The
term "PARTIES" shall mean both Immunex and Licensee.

     1.11  "PHASE III" shall mean, with respect to a Developed Product, the
period of product development commencing with enrollment of the first patient in
a placebo-controlled or otherwise appropriately controlled clinical trial that
is intended to demonstrate efficacy for registration of such Developed Product
and ending upon filing of an NDA, BLA, or foreign equivalent seeking Regulatory
Approval, where the clinical trial is sponsored by a Party or its sublicensees.

     1.12  "REGULATORY AGENCY" shall mean the United States Food and Drug
Administration ("FDA") or any successor agency vested with administrative and
regulatory authority to approve testing and marketing of human pharmaceutical or
biological therapeutic products in the United States and/or any regulatory body
with similar regulatory authority in any other part of the world where any Party
to

                                       3
<PAGE>
this Agreement elects to file an NDA, BLA or foreign equivalent seeking
Regulatory Approval.

     1.13  "REGULATORY APPROVAL" shall mean the receipt by a Party of the
authorization by an appropriate Regulatory Agency to market and sell Developed
Product in a country, including to the extent required, any governmental pricing
approval for such Developed Product in such country.

     1.14  "THIRD PARTY" shall mean any individual, partnership, corporation,
firm, association, unincorporated organization, joint venture, trust or other
entity that is neither a Party nor an Affiliate.

     1.15 *

2.  LICENSE GRANT

     2.1 Immunex hereby grants a non-exclusive worldwide license under the
Licensed Patent Rights, for manufacture and use of G-CSF Receptor in the Field
by Licensee. This license includes the limited right to sublicense the Licensed
Patent Rights to a Third Party to manufacture Developed Products on behalf of
Licensee. The license grant herein does not include the right to sublicense the
Licensed Patent Rights to sell or offer for sale G-CSF Receptor. In any event,
such license grant shall permit the manufacture, use, sale, offer for sale and
importation of Developed Products by Licensee throughout the world. Nothing
contained in this Agreement shall restrict or prohibit Licensee's right to grant
to a Third Party such right to sell or offer for sale a Developed Product.

3.  PAYMENTS AND REPORTS

     3.1  LICENSE EXECUTION FEE.  * after the Effective Date, Licensee shall pay
to Immunex *

     3.2  LICENSE MAINTENANCE FEE.  In consideration of maintaining the license
granted to it pursuant to this Agreement. Licensee shall pay to Immunex *


                                       4
<PAGE>
     3.3  MILESTONE FEES.  For each Developed Product, Licensee, or its
Affiliate, shall pay Immunex the following fees upon occurrence of the following
milestone events:

                                       *

     3.4 ROYALTIES. Licensee shall pay Immunex a royalty of * in respect of the
annual Net Sales of all Developed Products * following the last day of each
Calendar Quarter following * Such royalties shall not be returnable in any
event. *

     3.5  ROYALTY REPORTS AND TERM. *

                                       5
<PAGE>
     3.6  CURRENCY CONVERSION.  Royalty and milestone payments by Licensee shall
be made to Immunex in U.S. Dollars. For converting any royalty payments on Net
Sales made in a currency other than U.S. Dollars, Net Sales shall first be
determined in the currency of the country in which they are earned and shall be
converted each Calendar Quarter into an account in U.S. Dollars at the average
of the bid and ask prices reported in the WALL STREET JOURNAL as of the close of
the last business day of such Calendar Quarter in which such royalty is due. If
the last day of such Calendar Quarter is not a business day, then the closest
preceding business day shall be used for such calculation. All such converted
Net Sales shall be consolidated with U.S. Net Sales for each Calendar Quarter
and the applicable royalty payable determined therefrom. If by law, regulation
or fiscal policy of a particular country, remittance of royalties in U.S.
Dollars is restricted or forbidden, notice thereof will be promptly given to
Immunex, and payment of the royalty shall be made by the deposit thereof in
local currency to the credit of Immunex in a recognized banking institution
designated by Licensee. When in any country a law or regulation prohibits both
the transmittal and deposit of royalties on sales in such a country, royalty
payments shall be suspended for as long as such prohibition is in effect and as
soon as such prohibition ceases to be in effect, all royalties that Licensee
would have been under obligation to transmit or deposit but for the prohibition,
shall forthwith be deposited or transmitted promptly to the extent allowable.
The actual currency conversion calculations by Licensee for any country for a
particular Calendar Quarter shall be included in the royalty report provided to
Immunex for such Calendar Quarter under Section 3.5 above.

     3.7  WITHHOLDING TAXES.  All royalty amounts required to be paid to Immunex
pursuant to this Agreement may be paid with deduction for withholding for or on
account of any taxes (other than taxes imposed on or measured by net income) or
similar governmental charge imposed by a jurisdiction other than the United
States ("Withholding Taxes"). At Immunex's request, Licensee shall provide
Immunex a certificate evidencing payment of any Withholding Taxes hereunder and
shall reasonably assist Immunex to obtain the benefit of any applicable tax
treaty, at Immunex's sole cost for providing such reasonable assistance.

4.  RECORDS

     4.1  LICENSEE'S RECORDS.  Licensee shall keep and maintain, and shall
require each Affiliate to keep and maintain, in accordance with generally
acceptable accounting principles, adequate records in sufficient detail to
enable the payments due under Sections 3.3 and 3.4 to be determined. Nothing
herein shall require Licensee or any Affiliate to retain such records longer
than three (3) years after the payments to which they relate are paid.

                                       6
<PAGE>
     4.2  AUDITS.  At Immunex's request and expense. Licensee shall permit such
records under Section 4.1 to be inspected at any time during regular business
hours, but not more than once in any calendar year, by an independent public
accountant, appointed by Immunex for this purpose and reasonably acceptable to
Licensee, who shall report to Immunex only the amount of the royalties due
hereunder. If such independent public accountant reasonably determines that such
royalties, after adjustments in accordance with generally acceptable accounting
principles, have been understated by Licensee, for any calendar year. Licensee
shall pay the amount due for all royalties not properly reported. If it is
determined that Licensee has understated such royalties by an amount equal to or
greater than * Licensee shall pay all reasonable fees and costs
incurred by such independent public accountant in the course of making such
determination.

5.  TERM AND TERMINATION

     5.1 TERM This Agreement shall be effective as of the Effective Date and
shall continue in full force and effect until the later of the expiration,
lapse, revocation, unenforceability or invalidation of the last of the Licensed
Patent Rights, on a country-by country basis, unless earlier terminated earlier
as provided in this Agreement (the "Term"). Upon expiration of this Agreement,
all rights licensed hereunder shall become irrevocable upon payment of any
amounts due that have accrued hereunder prior to expiration. Expiration of this
Agreement shall not preclude Licensee from continuing to make, have made, use,
sell, offer for sale or import Developed Product worldwide without further
royalty payments or other remuneration to Immunex with respect to Licensed
Patent Rights.

     5.2 IMMUNEX'S RIGHT TO TERMINATE. Immunex shall have the right to terminate
this Agreement, including the licenses granted herein, in the event that any
material term or condition of this Agreement is breached by Licensee or an
Affiliate, and such breach is unremedied for a period of sixty (60) days after
Licensee's receipt of Immunex's written notice thereof. If such breach is
corrected within the sixty (60) day period, this Agreement and the rights
granted shall continue in force.

     5.3  LICENSEE'S RIGHT TO TERMINATE.  In the event that Licensee determines
that it will no longer carry out or continue drug discovery, research,
development of manufacturing using Licensed Patent Rights or continue
development or sale of Developed Products. Licensee shall notify Immunex in
writing, and this Agreement shall be terminated as of the date Immunex receives
such notice from Licensee.

     5.4  CONTINUING OBLIGATIONS.  Termination of this Agreement shall not
relieve License of any obligations to make payment of any sum due prior to
termination

                                       7
<PAGE>
under Article 3, or to keep records and provide written reports with
respect thereto, and to permit inspection thereof in accordance with Section 4.2

6.  WARRANTIES

     6.1  WARRANTIES AND REPRESENTATIONS OF IMMUNEX.  Immunex warrants to
Licensee that:

          6.1.1  Immunex is a corporation duly organized, validly existing and
     in good standing under the laws of the State of Washington and has all
     necessary corporate power to enter into and perform its obligations under
     this Agreement.

          6.1.2  the execution, delivery and performance of this Agreement by
     Immunex have been duly authorized and approved by all necessary corporate
     action, and this Agreement is binding, upon and enforceable against Immunex
     in accordance with its terms (subject to bankruptcy and similar laws
     affecting the rights of creditors generally);

          6.1.3 as of the Effective Date, Immunex is the owner of the Licensed
     Patent Rights and has the right to grant Licensee the licenses granted
     hereunder; and

          6.1.4 Immunex is not aware of any special or unusual hazards that
     would would proscribe Licensee's right to develop and sell Developed
     Products.

     6.2  WARRANTIES AND REPRESENTATION OF LICENSEE.  Licensee represents and
warrants to Immunex that:

          6.2.1  Licensee is a corporation duly organized, validly existing, and
     in good standing, under the laws of the State of Texas and has all
     necessary corporate power to enter into and perform their obligations under
     this Agreement;

          6.2.2  the execution, delivery and performance of this Agreement by
     Licensee, have been duly authorized and approved by all necessary corporate
     action, and this Agreement is binding, upon and enforceable against
     Licensee, in accordance with its terms (subject to bankruptcy and similar
     laws affecting rights of creditors generally); and

          6.2.3  during the Term of this Agreement, Licensee shall not practice
     the Licensed Patent Rights other than as specifically authorized in this
     Agreement.

     6.3  LIMITATION OF LIABILITY.  Immunex has no control over the manner in
which the Licensee intends to use the Developed Products or Licensed Patent
Rights. Immunex shall not be liable to Licensee for any losses, damages, costs
or

                                       8
<PAGE>
expenses of any nature incurred or suffered by Licensee or by a Third Party,
arising, out of any dispute or other claims or proceedings made by or brought
against Licensee, (including, without limitation, product liability claims and
claims by a Third Party alleging infringement of its intellectual property
rights by the use or sale of any Developed Product), nor shall Immunex be
responsible in any way for dealing with any such dispute, claim or proceedings,
except to the extent that any such dispute, claim or proceeding arises from (a)
a breach by Immunex of any warranty set forth in Section 6.1 hereof, or (b) the
gross negligence or willful misconduct by Immunex, its employees, agents or
directors. EXCEPT AS SET FORTH IN SECTION 6.1 OR 6.2 HEREOF, NEITHER PARTY MAKES
ANY PRODUCT WARRANTY, EXPRESS OR IMPLIED, INCLUDING ANY WARRANTY OF
MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. IMMUNEX SHALL NOT BE LIABLE
TO LICENSEE FOR ANY USE OF LICENSED PATENT RIGHTS BY LICENSEE OR FOR ANY LOSS,
CLAIM, DAMAGE, OR LIABILITY, OF ANY KIND OR NATURE, WHICH MAY ARISE FROM OR IN
CONNECTION WITH THIS AGREEMENT. NEITHER PARTY TO THIS AGREEMENT SHALL BE
ENTITLED TO RECOVER FROM THE OTHER ANY SPECIAL INCIDENTAL, CONSEQUENTIAL OR
PUNITIVE DAMAGES. IN ADDITION, THE PARTIES MAKE NO REPRESENTATIONS AND EXTEND NO
WARRANTIES OF ANY KIND, EITHER EXPRESS OR IMPLIED, AND PARTICULARLY THAT
PRODUCTS WILL BE DEVELOPED HEREUNDER, WILL HAVE COMMERCIAL UTILITY OR
MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. FURTHERMORE, IMMUNEX MAKES
NO WARRANTY EITHER EXPRESS OR IMPLIED THAT THE COMMERCIALIZATION OF DEVELOPED
PRODUCTS USING THE LICENSED PATENT RIGHTS WILL NOT INFRINGE ANY OTHER
INTELLECTUAL PROPERTY OF A THIRD PARTY.

     6.4  NO CONFLICT.  Each Party represents and warrants that, notwithstanding
anything to the contrary in this Agreement, the execution and delivery of this
Agreement and the performance of its obligations hereunder (a) do not conflict
with or violate any requirements of applicable laws or regulations and (b) do
not and shall not conflict with, violate or breach or constitute a default or
constitute a default or require any consent under, any contractual obligation.

7.  INDEMNIFICATION

     7.1  Licensee shall indemnify and hold harmless each of Immunex, its
successors and assigns, and the officers, employees, agents and counsel thereof
(the "Immunex Indemnities") from and against any and all claims of whatever
kind or nature, including, without limitation, any claim or liability based upon
any theory of negligence, warranty, strict liability, violation of government
regulation or infringement of patent or other proprietary rights, arising from
or occurring as a

                                       9
<PAGE>
result of (a) the use of Licensed Patent Rights and Developed Products by
Licensee or any agent of Licensee, or (b) any breach of this Agreement by
Licensee, provided:

          7.1.1  Licensee shall not be obligated under this Section to the
     extent that such claim or liability was the result of the breach of any
     warranty of Immunex set forth in Section 6.1 hereof, or gross negligence or
     willful misconduct of any employee or agent of Immunex;

          7.1.2  Licensee shall have no obligation under this Article unless
     Immunex (a) gives Licensee at least thirty (30) days written notice of any
     claim or liability for which it seeks to be indemnified under this
     Agreement, (b) Licensee is granted full authority and control over the
     defense, including settlement, of such claim or liability, and (c) Immunex
     cooperates fully with Licensee and its agents in defense of the claim or
     liability; and

          7.1.3  Immunex shall have the right, at its own expense, to have its
     own counsel participate in the defense of any such claim or liability
     referred to in this Article, provided, however, that Licensee shall have
     full authority and control to handle any such claim or liability, including
     any settlement or other disposition thereof, for which Immunex seeks
     indemnification under this Article and such counsel shall cooperate with
     Licensee.

8.  MISCELLANEOUS

     8.1  NOTICES.  All notices, reports, and other communications to Immunex or
Licensee shall be in writing (including electronic facsimile transmissions),
shall refer specifically to this Agreement and shall be sent by electronic
facsimile transmission or by registered mail or certified mail, return receipt
requested, postage prepaid, by express courier services providing evidence of
delivery, in each case to the respective address specified below (or to such
address as may be specified in writing to the other Party);

If addressed to Licensee:

                            Tanox, Inc.
                            10301 Stella Link
                            Houston, Texas 77025
                            Attention:  Nancy T. Chang, President
                            Fax:  (713) 664-8914

                            with a copy to:
                            Head of Legal Affairs
                            Fax:  (713) 664-8914

                                       10
<PAGE>
and if to Immunex shall be sent to:

                            Immunex Corporation
                            51 University Street
                            Seattle, Washington 98101
                            Attn:  General Counsel
                            Fax:  (206) 233-0644

     8.2  FORCE MAJEURE.  Immunex and Licensee shall each be excused for any
failure or delay in performing any of its respective obligations under this
Agreement if such failure or delay is caused by Force Majeure. The Party
affected by the Force Majeure shall use all reasonable efforts to correct the
Force Majeure as quickly as possible and to give the other Party prompt written
notice when it is again fully able to perform its obligations hereunder.

     8.3  ASSIGNABILITY.  Neither this Agreement nor the rights herein granted
may be assigned by either Party to any Third Party without the written consent
of the other, which consent shall not be unreasonably withheld; provided,
however, that either Party may assign this Agreement to any Affiliate, or to any
corporation with which it may merge or consolidate or to which it may transfer
all or substantially all of its assets to which this Agreement relates, without
obtaining the consent of the other Party.

     8.4  AMENDMENTS.  No terms or provisions of this Agreement shall be varied
or modified by any prior or subsequent statement, conduct or act of either of
the Parties, whether oral or written, except that the Parties may amend this
Agreement by written instruments specifically referring to and executed in the
same manner as this Agreement.

     8.5  SEVERABILITY.  If any provision hereof should be held invalid, illegal
or unenforceable in any respect in any jurisdiction, then, to the fullest extent
permitted by law, (a) all other provisions hereof shall remain in full force and
effect in such jurisdiction and shall be liberally construed in order to carry
out the intentions of the parties hereto as nearly as may be possible and (b)
such invalidity, illegality or unenforceability shall not affect the validity,
legality or enforceability of such provision in any other jurisdiction. To the
extent permitted by applicable law, Immunex and Licensee hereby waive any
provision of law that would render any provision hereof prohibited or
unenforceable in any respect. In the event that the terms and conditions of this
Agreement are materially altered as a result of this Section, the parties will
renegotiate the terms and conditions of this Agreement to resolve any
inequities.

                                       11
<PAGE>
     8.6  HEADINGS.  Headings used herein are for convenience only and shall not
in any way affect the construction of, or be taken into consideration
interpreting this Agreement.

     8.7  COUNTERPARTS.  This Agreement may be executed in any number of
counterparts, each of which shall be deemed an original, and all of such
counterparts taken together shall constitute one and the same instrument.

     8.8  ENTIRE AGREEMENT.  This Agreement, on and as of the Effective Date
hereof, constitutes the entire agreement between the parties relating to the
subject matter hereof and supersedes all previous or contemporaneous writings
and understanding, whether written or oral.

     8.9  BANKRUPTCY.  Notwithstanding the bankruptcy of Immunex, or the
impairment of performance by Immunex of its obligations under this Agreement as
a result of bankruptcy or insolvency of Immunex, Licensee shall be entitled to
retain the licenses granted herein, subject to Immunex's rights to terminate
this Agreement for reasons other than bankruptcy or insolvency as expressly
provided in this Agreement, and subject to performance by Licensee of its
preexisting obligations under this Agreement.

All rights and licenses granted under or pursuant to this Agreement by Immunex
to Licensee, are, and shall otherwise be deemed to be, for purposes of Section
365(n) of the U.S. Bankruptcy Code, licenses of rights to "intellectual
property" as defined under Section 101(52) of the U.S. Bankruptcy Code. The
parties agree that Licensee, as a license of such rights under this Agreement,
shall retain and may fully exercise all of its rights and elections under the
U.S. Bankruptcy Code, subject to performance by Licensee of its preexisting
obligations under this Agreement. The parties further agree that, in the event
of the commencement of a bankruptcy proceeding by or against Immunex under the
U.S. Bankruptcy Code, Licensee shall be entitled to a complete duplicate of (or
complete access to, as appropriate) any such intellectual property and all
embodiments of such intellectual property, and same, if not already in its
possession, shall be promptly delivered to Licensee (a) upon any such
commencement of a bankruptcy proceeding upon written request therefor by
Licensee, unless Immunex elects to continue to perform all of its obligations
under this Agreement, or (b) if not delivered under (a) above, upon the
rejection of this Agreement by or on behalf of Immunex upon written request
therefor by Licensee, provided, however, that upon Immunex's (or its
successor's) written notification to Licensee that it is again willing and able
to perform all of its obligations under this Agreement. Licensee shall promptly
return all such tangible materials to Immunex, but only to the extent that
Licensee does not require continued access to such materials to enable Licensee
to perform its obligations under this Agreement.

                                       12
<PAGE>
     8.10  RELATIONSHIP.  The relationship of employer and employee shall not
exist between Immunex and Licensee under this Agreement. This Agreement shall
not be deemed to establish a joint venture or partnership between Licensee and
Immunex. Nothing contained in this Agreement shall be construed, by implication
or otherwise, as an obligation incurred by Licensee to enter into any further
agreement with Immunex.

     8.11  APPLICABLE LAW.  This Agreement is acknowledged to have been made in
and shall be construed in accordance with the laws of the state of Washington
without reference to any rules govening conflicts of laws.

                      [This space is intentionally left blank.]

                                       13
<PAGE>
     8.12 PRESS RELEASE. No public announcement or other disclosure to Third
Parties (other than Affiliates and external collaborators) concerning the
existence of or terms of this Agreement shall be made, either directly or
indirectly, by either party, without first obtaining the written approval of the
other Party and agreement upon the nature and text of such announcement or
disclosure. The Party desiring to make my such public announcement or other
disclosure shall inform the other Party of the proposed announcement or
disclosure in reasonably sufficient time prior to public release and shall
provide the other Party with a written copy thereof, in order to allow such
other Party to comment upon such announcement or disclosure. Once any such
public announcement or disclosure has been approved in accordance with this
Section 8.12. then either Party may appropriately communicate information
contained in such permitted announcement or disclosure. Each Party shall
cooperate fully with the other with respect to all required disclosures
regarding this Agreement to the Securities and Exchange Commission or any other
governmental or regulatory agency. Each Party shall be entitled to disclose this
Agreement, its terms or other confidential information of the other obtained
pursuant to this Agreement with respect to disclosures regarding this Agreement
that are required by the Securities and Exchange Commission or any other
governmental or regulatory agency under applicable laws, rules and regulations.
Either Party may disclose such confidential information without the other
Party's prior written approval provided that the other Party is given an
opportunity to review and comment on the information being disclosed prior to
its disclosure, and that such information is disclosed only to the extent
required in order to comply with such applicable laws, rules and regulations or
with orders by courts of competent jurisdiction requiring such disclosures.

IN WITNESS WHEREOF, the parties have executed the Agreement and have entered the
effective date of the first page hereof.

         IMMUNEX CORPORATION                    TANOX, INC.
         By:  /s/BARRY G. PEA                   By:  /s/NANCY T. CHANG
         Name:  Barry G. Pea                    Name:  Nancy T. Chang
                Vice President and              Title:  President and CEO
         Title: Deputy General Counsel
         Date:  1-12-00                         Date:  1/11/00

                                       14

                                                                   EXHIBIT 10.24

     CERTAIN INFORMATION IN THIS EXHIBIT IS SUBJECT TO A REQUEST FOR
CONFIDENTIAL TREATMENT. IN ACCORDANCE WITH RULE 406 UNDER THE SECURITIES ACT OF
1933, AS AMENDED, SUCH INFORMATION HAS BEEN OMITTED AND FILED SEPARATELY WITH
THE SECURITIES AND EXCHANGE COMMISSION. THE LOCATION OF SUCH OMITTED INFORMATION
HAS BEEN INDICATED WITH AN ASTERISK (*).

                                MASTER AGREEMENT

     This MASTER AGREEMENT (the "Agreement") is entered into as of March 17,
2000 (the "Effective Date") by and between PROTEIN DESIGN LABS, INC., a
Delaware corporation having its principal office at 34801 Campus Drive, Fremont,
California 94555 U.S.A. ("PDL"), and TANOX, INC., a Delaware corporation
having offices at 10301 Stella Link, Houston, TX 77025 U.S.A. ("TANOX").

                                    RECITALS

     WHEREAS, PDL owns certain patents and related patent applications related
to humanized antibodies and antibody humanization technology that are sometimes
referred to as the "Queen et al. Patents."

     WHEREAS, PDL and TANOX are parties to a Patent License Agreement dated June
30, 1998, as amended by an amendment dated June 28, 1999 (as amended, the "Prior
Agreement").

     WHEREAS, PDL and TANOX desire to terminate the Prior Agreement and to enter
into this Agreement to provide TANOX the right to obtain certain nonexclusive
license rights under the Queen et al. Patents for the development, manufacture
and commercialization of antibody products directed against up to four antigens,
under the terms and conditions set forth below.

                                    AGREEMENT

     NOW, THEREFORE, the parties agree to follow:

1.  DEFINITIONS

     All references to particular Exhibits, Articles and Sections shall mean the
Exhibits to, and Articles and Sections of, this Agreement, unless otherwise
specified. References to this "Agreement" include the Exhibits. For the purposes
of this Agreement the following words and phrases shall have the following
meanings:

     1.1 "AFFILIATE" means, with respect to a party hereto, any corporate or
other entity which, directly or indirectly controls, is controlled by, or is
under common control with such party during the term of this Agreement, where
"control" means the ownership of not less than fifty percent (50%) of the voting
shares of a corporation, or decision-making authority as to an unincorporated
entity, provided that such entity shall be an Affiliate only so long as such
control exists.

     1.2 "ANTIBODY" means any antibody directed against an Antigen and shall
include, without limitation, monospecific and bispecific antibodies (but a
separate license shall be required for each Antigen targeted by a bispecific
antibody); less than full-length antibody forms such as Fv, Fab, Fab' and
F(ab')2; single-chain antibodies; and antibody conjugates bound to a toxin,
label or other moiety.

     1.3 "ANTIGEN" means a target molecule to which an Antibody specifically
binds and includes all epitopes on that target molecule.

     1.4 "LICENSED PRODUCT" means an Antibody with respect to which TANOX has
either significant marketing rights or has done significant development
(including without limitation created, humanized or conducted preclinical or
clinical development), the manufacture, import, use, offer to sell or sale of
which would infringe, if not licensed under this Agreement, a Valid Claim. In no
event shall Licensed Product include an Antibody identified and created by
Genentech, Inc. binding to IgE.

     1.5 "PDL LICENSE AGREEMENT" means the form of PDL License Agreement
attached as Exhibit B.
<PAGE>
     1.6 "PDL PATENT RIGHTS" means the patent applications or patents (as well
as any foreign counterparts thereto identified on Exhibit A. PDL Patent Rights
shall include U.S. or foreign patents or patent applications which claim
priority to any application to which a listed U.S. Patent also claims priority.
PDL Patent Rights shall also include any foreign equivalents, including any
additions, continuations, continuations-in-part or divisions of such patents or
patent applications, or any substitute applications therefor; any patents issued
with respect to such patent applications, any reissues, extensions or patent
term extensions of any such patent, and any confirmation patents or registration
patents or patents of addition based on any such patents.

     1.7  "TANOX NAMED ANTIGENS"  shall mean: *

     1.8 "VALID CLAIM" means (a) any claim in any issued patent included in the
PDL Patent Rights which would be infringed but for the license granted under
Section 2.01 and which claim has not been disclaimed or held unenforceable or
invalid by a governmental agency or court of competent jurisdiction by a
decision from which no appeal has been taken within the time period permitted
for filing an appeal or may be taken; and (b) any pending claims under PDL
Patent Rights which, if granted, would be infringed but for the license granted
under Section 2.01 and which pending claim would be a Valid Claim if the pending
claim were treated as granted, provided that examination has been timely
requested for such pending claims and they are otherwise being diligently
prosecuted in an effort to have them allowed and granted in an issued patent.

2.  RIGHTS TO LICENSES

     2.1 ELECTION. Subject to the terms and conditions of this Agreement, PDL
hereby grants to TANOX through the fifth (5th) anniversary of the Effective Date
(or until such earlier time as TANOX has exercised its rights under this Section
2.1 with respect to four (4) Antigens), the rights upon written notice to
receive licenses under the PDL Patent Rights for up to four (4) Antigens
designated by TANOX. Each license shall be a nonexclusive, worldwide license
under the PDL Patent Rights to make, have made, use, import, market, promote,
offer for sale and sell or otherwise dispose of Antibodies pursuant to a PDL
License Agreements. The rights of TANOX under the PDL License Agreements shall
include the right to grant sublicenses for Antibodies in accordance with the
terms of the applicable PDL License Agreement. Each license elected by TANOX
hereunder shall be pursuant to a separate PDL License Agreement and effective as
of the date when the election for such license by TANOX becomes irrevocable,
pursuant to Section 2.2.

     2.2 PROCEDURE FOR EXERCISE OF LICENSE RIGHTS. TANOX shall provide PDL with
written notice identifying the Antigen for which TANOX desires to enter into a
PDL License Agreement pursuant to the provisions of Section 2.1. A separate
notice shall be provided with respect to each Antigen for which a license is
requested. Within fifteen (15) business days of the written notice or upon
execution and return of the relevant PDL License Agreement by PDL, whichever is
later, TANOX shall pay the applicable License Exercise Fee specified in Section
3.2. PDL shall promptly review and respond in writing to the request by TANOX
for a license within ten (10) business days of receipt of the written request.
PDL may refuse to grant TANOX a license only if PDL has previously granted an
exclusive or co-exclusive license or an unexpired option for an exclusive or
co-exclusive license with respect to an Antibody to the identical Antigen, can
demonstrate that it is then actively engaged in bona fide negotiations for such
an exclusive or co-exclusive license or option for an exclusive or co-exclusive
license, or then has development, marketing or co-promotion rights, or an option
to obtain such rights, to a product or a potential product directed against the
Antigen and which is on the market or in research or development and reasonably
expected to enter human clinical trials within twenty-four (24) months;
provided, however, that with respect to each of the Tanox Named Antigens, PDL
shall provide Tanox with written notice prior to entering into an exclusive or
co-exclusive license, development, marketing or co-promotion rights, or option
for such license or rights, with any third party with respect to that Tanox
Named Antigen and shall permit Tanox the opportunity to exercise its rights
under Section 2.1 for a period not to exceed fifteen (15) days for a

                                        2
<PAGE>
license for that Tanox Named Antigen prior to conclusion of an agreement with
such third party for a license or option; and further provided that in no event
shall PDL have the right to refuse to grant a license to the IgE Antigen to
TANOX during the term of TANOX' rights under Section 2.1 (except as provided in
Section 1.4). In the event that PDL validly refuses to grant TANOX a license
under the PDL Patent Rights, TANOX' right under Section 2.1 shall not be
considered exercised. If PDL affirms TANOX' request or has not responded by
notice in writing with ten (10) business days of receipt of TANOX' request under
this Section 2.2, then TANOX' election shall be deemed irrevocable and TANOX and
PDL shall enter into a PDL License Agreement with respect to that Antigen.

3.  PAYMENTS

     3.1 INITIAL FEES. Within thirty (30) days after the Effective Date, TANOX
shall pay an initial nonrefundable, noncreditable fee of * for the right to
obtain nonexclusive licenses pursuant to Section 2.1.

     3.2 LICENSE EXERCISE FEES. Within fifteen (15) business days after the
delivery of a written notice to PDL for a nonexclusive license for Antibodies
for one (1) Antigen under Section 2.1 or PDL's execution of a PDL license
Agreement for the same, whichever is later, TANOX shall pay to PDL an exercise
fee ("License Exercise Fee") of * provided that such amount shall be increased
annually beginning April 1, 2001 and on each April 1 thereafter by an amount
equal to the Consumer Price Index-U (or its successor) published by the U.S.
Bureau of Labor Statistics ("CPI-U") for the prior calendar year; provided,
however, that if the CPI-U for the prior year has not been published by April 1
of the applicable year, any adjustments hereunder shall be payable within
fifteen (15) days of the publication of the CPI-U for the applicable year.

4.  TERMINATION OF PRIOR AGREEMENT

     In partial consideration of the rights granted to TANOX in Article 2, the
parties agree that upon execution and delivery of this Agreement, the Prior
Agreement shall immediately terminate and be of no further force or effect.

5.  REPRESENTATIONS, DISCLAIMERS

     5.1 VALID AGREEMENT. Each party represents and warrants to the other that
it knows of no legal reason to, and is not a party to any agreement which would,
prevent it from entering into and performing its obligations under this
Agreement, and the the signatory hereto is duly authorized to execute and
deliver this Agreement.

     5.2 CURRENT PDL PATENT RIGHTS. The PDL Patent Rights constitute all of the
patents and patent applications owned by PDL as of the Effective Date which
relate generally on the humanization of antibodies.

     5.3 NO WARRANTY OF VALIDITY, NON-INFRINGEMENT. Nothing in this Agreement
shall be construed as (a) a warranty or representation by PDL as to the validity
or scope of any PDL Patent Rights; or (b) a warranty or representation that any
Licensed Product made, used, sold or otherwise disposed of under any PDL License
Agreement is or will be free from infringement of patents, copyrights,
trademarks, trade secrets or other rights of third parties.

     5.4 DISCLAIMER OF WARRANTIES. EXCEPT AS SPECIFICALLY SET FORTH IN SECTIONS
5.1 AND 5.2, NEITHER PDL NOR TANOX MAKE TO THE OTHER ANY REPRESENTATIONS OR
EXTEND ANY WARRANTIES OF ANY KIND, EITHER EXPRESS OR IMPLIED. FURTHER, PDL DOES
NOT MAKE ANY IMPLIED WARRANTIES OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR
PURPOSE OR THAT PRACTICE UNDER THE PDL PATENT RIGHTS UNDER A PDL LICENSE
AGREEMENT WILL NOT INFRINGE ANY THIRD PARTY RIGHTS.

                                        3
<PAGE>
6.  CONFIDENTIALITY

     6.1 PRIOR AGREEMENTS. This Agreement supersedes the Prior Agreement;
provided, however, that with respect to all Confidential Information disclosed
thereunder and/or within the definition of "Confidential Information" in the
Prior Agreement, or information otherwise subject to the terms and conditions of
Section 6.02 of the Prior Agreement, such Confidential Information shall be
subject to the terms and conditions of Section 6.2 of this Agreement.

     6.2 CONFIDENTIALITY. PDL and TANOX acknowledge that in the course of
negotiations of this Agreement or other discussions between the parties of
prospective agreements or business relationships and/or in furtherance of the
interests of the parties hereunder that it ("Recipient") has received and/or may
receive confidential information of the other party ("Provider"). "Confidential
Information" means any and all data and information which (a) has been reduced
to tangible form and marked clearly and conspicuously with a legend identifying
its confidential or proprietary nature; or (b) with respect to any oral
presentation or communication, is or was designated as confidential immediately
before, during, or within a reasonable time after the oral presentation or
communication and such designation is subsequently confirmed in writing; (c) is
or was otherwise characterized by Provider as confidential information; or (d)
is subject to the terms and conditions of this Section 6.2 as provided in
Section 6.1.

     Each party shall keep and protect as confidential, and shall not use for
any purpose (other than TANOX' use for the development and commercial
exploitation of Licensed Products or either party's use for specific purposes
otherwise contemplated by a business relationship entered into between them),
during the term of this Agreement and for five (5) years after termination
hereof, all Confidential Information heretofore and hereafter supplied by the
other, provided however, that the foregoing obligations of confidentiality shall
not apply to the extent that any Confidential Information (a) is already known
to the Recipient at the time of disclosure, as evidenced by written record, or
is developed by Recipient thereafter in the course of work entirely independent
of any disclosure by the other party; (b) is publicly known prior to or becomes
publicly known after disclosure other than through acts of omissions of the
Recipient; (c) is disclosed in good faith to Recipient by a third party who is
not under obligations of non-disclosure to the Provider; (d) is required to be
disclosed pursuant to an order of a court of law or regulation of a governmental
agency; provided that the disclosing party shall advise the other party promptly
of any such disclosure requirement (other than a filing of information or
materials with the U.S. Securities and Exchange Commission made with a request
for confidential treatment for portions of such material for which such
treatment may reasonably be expected to be granted) in order to permit such
other party to undertake efforts to restrict or limit the required disclosure
including by cooperating in drafting a protective order; or (e) disclosure is
made to a government regulatory agency as part of such agency's biological
license approval process.

7.  TERM AND TERMINATION

     7.1 TERM. Unless earlier terminated in accordance with this Article 7, this
Agreement shall remain in effect until the expiration of the last PDL License
Agreement.

     7.2  TERMINATION.

     (a) If either party shall at any time default in the making of any payment
hereunder, or shall commit any material breach of any covenant or agreement
herein contained, and shall fail to have initiated and actively pursued remedy
of any such default or breach within sixty (60) days after receipt of written
notice thereof by the other party, the other party may, at its option, cancel
this Agreement and revoke any rights herein granted by notice in writing to such
effect, but such act shall not prejudice the right of the party giving notice to
recover any sums due at the time of such cancellation, it being understood,
however, that if within sixty (60) days after receipt of any such notice the
receiving party shall have initiated and actively pursued remedy of its default,
then the rights herein

                                        4
<PAGE>
granted shall remain in force as if no breach or default had occurred on the
part of the receiving party, unless such breach or default is not in fact
remedied within a reasonable period of time.

     (b) This Agreement may be terminated by either party upon the occurrence of
any of the following which is not stayed or vacated within ninety (90) days of
such occurrence: (i) petition in bankruptcy filed by or against the other party;
(ii) adjudication of the other party as bankrupt or insolvent; (iii) appointment
of a liquidator, receiver or trustee for all or a substantial part of the other
party's property; or (iv) an assignment for the benefit of creditors of the
other party.

     (c) All right and licenses granted under or pursuant to this Agreement by
PDL to TANOX, are, and shall otherwise be deemed to be, for purposes of Section
365(n) of the U.S. Bankruptcy Code, licenses of rights to "intellectual
property" as defined under Section 101(52) of the U.S. Bankruptcy Code. The
parties agree that TANOX, as a licensee of such rights under this Agreement,
shall retain and may fully exercise all of its right and elections under the
U.S. Bankruptcy Code, subject to performance by TANOX of its preexisting
obligations under this Agreement.

     (d) To the extent permitted under applicable law, the rights granted under
this agreement may be terminated as to any country by PDL upon thirty (30) days
prior written notice in the event that TANOX challenges the PDL Patent Rights in
that country.

     7.3 NO WAIVER. The right of either party to terminate this Agreement as
provided herein shall not be affected in any way by its waiver of, or failure to
take action with respect to, any previous failure to perform hereunder.

     7.4 RIGHTS AND OBLIGATIONS UPON TERMINATION OR EXPIRATION. Upon expiration
or termination of this Agreement for any reason, nothing herein shall be
construed to release either party from any obligation that matured prior to the
effective date of such termination. In addition, the obligations set forth in
Articles 6 and 7 shall survive the expiration or termination of this Agreement.
Upon termination of this Agreement, each party shall return to the other party
any confidential information disclosed by the other party under this Agreement.

8.  MISCELLANEOUS

     8.1 ASSIGNMENT. This Agreement may not be assigned by either party without
the prior written consent of the other, except to Affiliates upon prior written
notice to the other party, and except that either party may assign this
Agreement to a party which acquires all or substantially all of its business,
whether by merger, sale of assets or otherwise.

     8.2 ENTIRE AGREEMENT. This Agreement constitutes the entire Agreement
between the parties hereto with respect to the within subject matter and
supersedes all previous Agreements (except as provided in Section 6.1), whether
written or oral. This Agreement shall not be changed or modified orally, but
only by an instrument in writing signed by both parties.

     8.3 SEVERABILITY. If any provision of this Agreement is declared invalid by
a court of last resort or by any court, the decision of which appeal is not
taken within the time provided by law, then and in such event, this Agreement
will be deemed to have been terminated only as to the portion thereof which
relates to the provision invalidated by that decision and only in the relevant
jurisdiction, but this Agreement, in all other respects and all other
jurisdictions, will remain in force; provided, however, that if the provision so
invalidated is essential to the Agreement as a whole, then the parties shall
negotiate in good faith to amend the terms hereof as nearly as practical to
carry out the original interest of the parties, and, failing such amendment,
either party may submit the matter to a court of competent jurisdiction for
resolution.

     8.4 NOTICES. Any notice or report required or permitted to be given under
this Agreement shall be in writing and shall be sent by expedited delivery or
telecopied and confirmed by mailing, as follows and shall be considered received
three (3) days after such delivery:

                                        5
<PAGE>
If to PDL:                 Protein Design Labs, Inc.
                           34801 Campus Drive
                           Fremont, California 94555 USA
                           Attention: Chief Executive Officer
                           Fax No: 510-574-1500

Copy to:                   Protein Design Labs, Inc.
                           34801 Campus Drive
                           Fremont, California 94555 USA
                           Attention: General Counsel
                           Fax No: 510-574-1473

If to TANOX:               Tanox, Inc.
                           10301 Stella Link
                           Houston, TX 77025 USA
                           Attention: Nancy T. Chang, President and CEO
                           Fax No: (713) 664-8914

Copy to:                   Tanox, Inc.
                           10301 Stella Link
                           Houston, TX 77025 USA
                           Attention: Head of Legal Affairs

     8.5  DISPUTE RESOLUTION.

     (A) NEGOTIATIONS. Any dispute, controversy or claim arising out of or
relating to any provision of this Agreement or a PDL License Agreement or the
interpretation, enforceability, performance, breach, termination or validity
hereof or thereof, including without limitation, this dispute resolution
provision, shall be subject to the procedures set forth in this Section 8.5. A
designated representative of PDL and TANOX will meet as reasonably requested by
either party to review any dispute, controversy or claim arising out of or
relating to any provision of this Agreement or a PDL License Agreement. If the
disagreement is not resolved by the designated representatives by mutual
agreement within thirty (30) days after a meeting to discuss the disagreement,
either party may at any time thereafter provide the other written notice
specifying the terms of such disagreement in reasonable detail. Upon receipt of
such notice, the chief executive officers of PDL and TANOX shall meet at a
mutually agreed upon time and location for the purpose of resolving such
disagreement. They will discuss the problems and/or negotiate for a period of up
to sixty (60) days in an effort to resolve the disagreement or negotiate an
acceptable interpretation or revision of the applicable portion of this
Agreement or a PDL License Agreement, as applicable, mutually agreeable to both
parties, without the necessity of formal procedures relating thereto. During the
course of such negotiations, the parties will reasonably cooperate and provide
information that is not materially confidential in order that each of the
parties may be fully informed with respect to the issues in dispute. The
institution of a formal legal proceeding under Section 8.5(b) or (c) to resolve
the disagreement may occur by written notice to the other party only after the
earlier of: (a) the chief executive officers mutually agreeing that resolution
of the disagreement through continued negotiation is not likely to occur, or (b)
following expiration of the sixty (60) day negotiation period.

     (B) ARBITRATION. Subject to Section 8.5(a), any dispute, controversy or
claim arising out of or in connection with or relating to this Agreement or a
PDL License Agreement or the breach or alleged breach thereof, but not including
any dispute, controversy or claim concerning the validity of any PDL Licensed
Patent, shall be submitted by the parties to arbitration in Denver, Colorado in
accordance with the then-current JAMS Comprehensive Arbitration Rules and
Procedures under the auspices of JAMS ("JAMS") except as otherwise provided
herein. If the dispute, controversy or claim concerns the validity of any PDL
Licensed Patent, all matters subject to dispute, controversy or claim hereunder
shall be removed to Federal District Court as provided in Section 8.5(c).

     Any arbitration proceeding hereunder shall be held in English and a
transcribed record prepared in English. The parties shall choose, by mutual
agreement, one (1) neutral arbitrator within thirty (30)

                                        6
<PAGE>
days of receipt of notice of the intent to arbitrate. If no arbitrator is
appointed within the times herein provided or any extension of time which is
mutually agreed upon, JAMS shall make such appointment of a person who shall
devote substantial time to arbitrating within thirty (30) days of such failure.
Discovery permitted by the arbitrator shall be pursuant to the Federal Rules of
Civil Procedure, provided that all discovery shall be completed within sixty
(60) days of the appointment of such arbitrator and the decision rendered by
such arbitrator shall thereafter be delivered in writing setting forth the basis
therefor within thirty (30) days after the completion of discovery. The award
rendered by the arbitrator shall include costs of arbitration, reasonable
attorneys' fees and reasonable costs for expert and other witnesses, and
judgment on such award may be entered in any court having jurisdiction thereon.
Nothing in this Agreement shall be deemed as preventing either party from
seeking injunctive relief (or any other provisional remedy) from any court
having jurisdiction over the parties and the subject matter of the dispute but
only to the extent necessary to protect either party's name, proprietary
information, trade secrets, know-how or any other similar proprietary rights. If
the issues in dispute involve scientific or technical matters related to
monoclonal antibody technology, any arbitrator chosen hereunder shall have not
less than five (5) years of educational training and/or experience sufficient to
demonstrate a reasonable level of relevant scientific and/or technical knowledge
related to monoclonal antibody technology or such arbitrator shall have the
right to appoint an expert with such experience to assist such arbitrator as
necessary. If the issues in dispute involve patent matters (other than validity
of a PDL Licensed Patent), then such arbitrator shall also be knowledgeable
about patent law matters and to the extent possible, with monoclonal antibody
technology. The decision of the arbitrator shall be in writing and shall set
forth the basis therefor. The arbitrator shall have the authority to award such
remedies as he or she believes appropriate in the circumstances, including, but
not limited to, compensatory damages subject to the Three and Three-Quarters
Percent (3.75%) royalty maximum set forth in the PDL License Agreement,
consequential and incidental damages, interest, tort damages (but not punitive
or similar damages) and specific performance and other equitable relief.

     (C) PATENT VALIDITY. Subject to Section 8.5(a), any dispute, controversy or
claim (i) which involves the validity of a PDL Licensed Patent issued in the
United States shall be subject to actions before the United States Patent and
Trademark Office and/or adjudicated in Federal District Court, Central District,
Santa Clara County in the State of California and (ii) which involves the
validity of a PDL Licensed Patent issued in any other country shall be brought
before an appropriate regulatory or administrative body or court in that
country. The prevailing party shall be entitled to recover from the other party,
the reasonable attorneys' fees, costs and expenses incurred by such prevailing
party in connection with any action or proceeding under this Section 8.5(c).

     8.6 CHOICE OF LAW. The validity, performance, construction, and effect of
this Agreement shall be governed by the laws of the State of California which
are applicable to contracts between California residents to be performed wholly
within California.

     8.7 WAIVER. None of the terms, covenants and conditions of this Agreement
can be waived except by the written consent of the party waiving compliance.

     8.8 FORCE MAJEURE. Neither party shall be responsible to the other for
failure or delay in performing any of its obligations under this Agreement or
for other non-performance hereof provided that such delay or non-performance is
occasioned by a cause beyond the reasonable control and without fault or
negligence of such party, including, but not limited to war, terrorism,
earthquake, fire, flood, explosion, discontinuity in the supply of power, court
order or governmental interference, act of God, strike or other labor trouble
and provided that such party will inform the other party as soon as is
reasonably practicable and that it will entirely perform its obligations within
a reasonable time after the relevant cause has ceased its effect.

     8.9 PUBLICITY. PDL will issue a press release concerning the parties' entry
into this Agreement and the amount of the initial fees to be paid hereunder,
with the content of such release to be

                                        7
<PAGE>
approved in advance by TANOX, which approval shall not be unreasonably withheld.
Except as required by law or regulation, neither party shall publicly disclose
the other terms and conditions of this Agreement unless expressly authorized to
do so by the other party, which authorization shall not be unreasonably
withheld; provided, however that the parties may disclose such terms and
conditions to their respective investors, prospective investors, advisors, and
consultants under a written confidentiality agreement protecting the
confidentiality of the terms hereof as provided under Article 6, and to their
accountants and attorneys provided that such accountants and attorneys agree to
maintain the confidentiality of the terms hereof as provided under Article 6,
and either party may disclose such terms and conditions as deemed required in
connection with any securities offering it elects to make.

     8.10 HEADINGS. The captions used herein are inserted for convenience of
reference only and shall not be construed to create obligations, benefits, or
limitations.

     8.11 COUNTERPARTS. This Agreement may be executed in any number of
counterparts, each of which shall be deemed to be an original, and such
counterparts together shall constitute one agreement. Execution and delivery of
this Agreement by facsimile copies bearing the facsimile signatures of the
parties shall constitute a valid and binding execution and delivery of this
Agreement by the signing party, and such facsimile copies shall constitute
original documents.

     IN WITNESS WHEREOF, the parties hereto have duly executed this Agreement as
of the Effective Date.


PDL:                               TANOX:
PROTEIN DESIGN LABS, INC.          TANOX, INC.

By:  /s/ LAURENCE JAY KORN         By:  /s/ NANCY T. CHANG
    ----------------------             --------------------
     Laurence Jay Korn                  Nancy T. Chang
     CEO                                President and CEO

                                        8
<PAGE>
                                    EXHIBIT A

                                PDL PATENT RIGHTS

The following are patents and patent applications (also known as the "Queen et
al. patents") issued and filed in certain countries in the world and licensed as
part of the PDL Patent Rights under the Agreement. (Updated as of January 27,
2000.)

1.  The following issued U.S. patents and U.S. patent applications:

        No. 5,585,089, "Humanized Immunoglobulins," issued December 17, 1996.

        No. 5,693,761, "Polynucleotides Encoding Improved Humanized
        Immunoglobulins," issued December 2, 1997.

        No. 5,693,762, "Humanized Immunoglobulins," issued December 2, 1997.

        *

2.  The following patents and patent applications outside the U.S.:

<TABLE>
<CAPTION>
PATENT NO.                          COUNTRY                           TITLE*
<S>             <C>                 <C>              <C>
                                                          "Novel Immunoglobulins, Their

Issued          647383              Australia                  Production and Use"
Issued          671949              Australia                           "
Issued          AT E133452          Austria                             "
Issued          0451216             Belgium                             "
Issued          61095               Bulgaria                            "
Issued          98389               Chile                               "
Issued          P920500A            Croatia                             "
Issued          0451216B1           Europe1                             "
Issued          0682040 B1          Europe1                             "
Issued          FR0451216           France                              "
Issued          DE 68925536         Germany                             "
Issued          DE 68929061         Germany                             "
Issued          DD 296 964          East Germany                        "
Issued          GB 0451216          Great Britain                       "
Issued          1001050             Greece                              "
Issued          211174              Hungary                             "
Issued          IT 0451216          Italy                               "
Issued          2828340             Japan                               "
Issued          LU 0451216          Luxembourg                          "
Issued          92.2146             Monaco                              "
Issued          NL 0451216          Netherlands                         "
Issued          231984              New Zealand                         "
Issued          132068              Pakistan                            "
Issued          29729               Philippines                         "
Issued          92758               Portugal                            "
Issued          2126046             Russia                              "
Issued          SG 0451216          Singapore                           "
Issued          8912489             Slovenia                            "
Issued          89/9956             South Africa                        "
Issued          178385              South Korea                         "
Issued          0231090             South Korea                         "
Issued          2081974 T3          Spain                               "
Issued          2136760             Spain
</TABLE>

                                        9

LEGAL COMMON/CONTRACTS/TANOX/LIC OPTN/MSTR000316                          000316
<PAGE>
<TABLE>
<S>             <C>                 <C>              <C>
Issued          SE 0451216          Sweden                              "
Issued          CH 0451216          Switzerland                         "
Issued          50034               Taiwan                              "
Issued          13349               Uruguay                             "
Issued          56455               Venezuela                           "
Issued          48700               Yugoslavia                          "
<CAPTION>
                COUNTRY             APPLICATION NO.                   TITLE*

Pending            *                      *                             *
Pending
Pending
Pending
Pending
Pending
Pending
Pending
Pending
Pending
Pending
Pending
Pending
Pending
</TABLE>

- ------------

* Exact titles may differ in different countries.

1 and corresponding European national patents issued therefrom.

                                       10
<PAGE>

                                    EXHIBIT B

                          FORM OF PDL LICENSE AGREEMENT

                                       11
<PAGE>
                                    EXHIBIT B

                            PATENT LICENSE AGREEMENT

     This Agreement ("Agreement"), effective as of

("Effective Date"), is made by and between PROTEIN DESIGN LABS, INC., a
Delaware corporation having offices at 34801 Campus Drive, Fremont, CA 94555,
U.S.A. (hereinafter "PDL") and TANOX, INC., a Delaware corporation having
offices at 10301 Stella Link, Houston, TX 77025, U.S.A. (hereinafter "TANOX").

                                    RECITALS

     A. TANOX and PDL have entered in a Master Agreement effective March 17,
2000 (the "Master Agreement"), pursuant to which TANOX may enter into this
Agreement with respect to a license under the PDL Patent Rights (as defined
below) for TANOX'S antibody products.

     B. The Master Agreement provides TANOX with the right to obtain a
nonexclusive, worldwide, royalty-bearing license under the PDL Patent Rights
under the terms and conditions of this Agreement.

                                    AGREEMENT

     NOW THEREFORE, in consideration of the mutual covenants herein contained
and intending to be legally bound, the parties agree as follows:

1.  DEFINITIONS

     All references to Exhibits, Articles and Sections shall be references to
Exhibits, Articles and Sections of this Agreement. In addition, except as
otherwise expressly provided herein, the following terms in this Agreement shall
have the following meanings:

     1.01 "AFFILIATE" means with respect to a party hereto, any corporate or
other entity which, directly or indirectly, controls, is controlled by, or is
under common control with such party where "control" means the ownership of not
less than 50% of the voting shares of a corporation, or decision-making
authority as to an unincorporated entity.

     1.02 "ANTIBODY" means any antibody directed against an Antigen, including,
without limitation, monospecific and bispecific antibodies; less than
full-length antibody forms such as Fv, Fab, and F(ab')2; single-chain
antibodies; and antibody conjugates bound to a toxin, label or other moiety.

     1.03  "ANTIGEN" means the target molecule:
                                    .

     1.04 "COMBINATION PRODUCT(S)" shall mean any product containing both a
pharmaceutically active agent or ingredient which constitutes a Licensed Product
and one or more other pharmaceutically active agents or ingredients which do not
constitute Licensed Products.

     1.05 "LICENSED PRODUCT(S)" shall mean therapeutic products of TANOX or
TANOX'S sublicensees or Affiliates that include an Antibody developed by or for
TANOX or its Affiliates, jointly or otherwise, binding to the Antigen whose
development, manufacture, use or sale would, but for a license under this
Agreement, infringe a Valid Claim.

     1.06 "NET SALES" shall mean the aggregate gross revenues, whether in cash
or in kind, derived by or payable from or on account of the sale of Licensed
Products, less actual amounts incurred for (a) credits or allowances, if any,
actually granted on account of price adjustments, recalls, rejection or return
of items previously sold, (b) excise and sales taxes, duties or other taxes
imposed on and paid with respect to such sales (excluding income or franchise
taxes of any kind) and (c) outer packing, freight and freight insurance costs.
All amounts deducted under this Section 1.06 shall be properly documented and
specified in any summary report provided to PDL under Section 3.07. If TANOX or
any of its Affiliates or sublicensees receive non-cash consideration for any
Licensed Product sold or

                                        1
<PAGE>
otherwise transferred to an independent third party not an Affiliate of the
seller or transferor, the fair market value of such non-cash consideration on
the date of such transfer as known to TANOX, or as reasonably estimated by TANOX
if unknown, shall be included in the definition of Net Sales.

     1.07 "PDL PATENT RIGHTS" means the patent applications or patents (as well
as any foreign counterparts thereto) identified on EXHIBIT A. PDL Patent Rights
shall include U.S. or foreign patents or patent applications which claim
priority to any application to which a listed U.S. Patent also claims priority.
PDL Patent Rights shall also include any foreign equivalents, additions,
continuations, continuations-in-part or divisions of such patents or patent
applications or any substitute applications therefor; any patents issued with
respect to such patent applications, any reissues, extensions or patent term
extensions of any such patent, and any confirmation patents or registration
patents or patents of addition based on any such patents.

     1.08 "VALID CLAIM" means (a) any claim in any issued patent included in the
PDL Patent Rights which would be infringed but for the license granted under
Section 2.01 and which claim has not been disclaimed or held unenforceable or
invalid by a governmental agency or court of competent jurisdiction from which
no appeal has been taken within the time period permitted for filing an appeal
or may be taken; and (b) any pending claims under PDL Patent Rights which, if
granted, would be infringed but for the license granted under Section 2.01 and
which pending claim would be a Valid Claim if the pending claim were treated as
granted, provided that examination has been timely requested for such pending
claims and they are otherwise being diligently prosecuted in an effort to have
them allowed and granted in an issued patent.

2.  LICENSE

     2.01 LICENSE GRANT. Subject to the terms and conditions of this Agreement,
PDL hereby grants and TANOX hereby accepts a worldwide nonexclusive license
under the PDL Patent Rights, including the right to grant sublicenses in
accordance with Section 2.02 to make, import, have made, use, offer to sell or
sell Licensed Products.

     2.02 LIMITATION ON SUBLICENSES; NOTIFICATION. TANOX shall have the right to
grant sublicenses of its rights with respect to the Licensed Product under
Section 2.01 only to its Affiliates or in connection with the assignment or
license by TANOX of a Licensed Product to a third party. Notwithstanding the
assignment or grant of a sublicense by TANOX hereunder, TANOX shall remain
obligated to pay all royalties due to PDL with respect to the sale of Licensed
Products by its assignee or sublicensee. In addition, the grant of any
sublicenses under Section 2.01 shall be on terms and conditions which are
subject to and subordinate to the terms of this Agreement and TANOX shall remain
fully responsible to PDL for the performance of any and all such terms by its
sublicensees. Promptly following execution of any sublicense hereunder, but in
any event not less than ten (10) days thereafter, TANOX shall notify PDL of the
identity of the sublicensee and the scope of the sublicense.

     2.03 NO OTHER LICENSE RIGHTS. TANOX expressly acknowledges and agrees that,
except for the license expressly granted under Section 2.01, no rights to any
other PDL patents, patent applications, know-how or licenses are included in
this Agreement and that any royalties or payments that may be due to third
parties in order for TANOX to make, have made, use or sell Licensed Products
shall be the sole responsibility of TANOX.

     2.04 UPDATES TO LIST OF PDL PATENT RIGHTS. Upon written request of TANOX,
which request shall not be made more than once per calendar year, PDL agrees to
provide a written update listing the patents and patent applications under the
PDL Patent Rights, and such update shall constitute an amendment to Exhibit "A."
PDL may, at its option, furnish such update to TANOX from time to time during
the terms of this Agreement as part of an update to the Master Agreement.

                                        2
<PAGE>
3.  PAYMENT; ROYALTIES, REPORTS

     3.01 PAYMENTS.  In consideration for the licensed granted by PDL under
Article 2 of this Agreement TANOX shall pay to PDL a nonrefundable signing and
licensing fee by the later of fifteen (15) business days after Tanox' exercise
of its right under the Master Agreement to enter into this Agreement or the
Effective Date, the sum of                         United States Dollars
(US$            [DRAFTING NOTE: ENTER AMOUNT CALCULATED UNDER SECTION 3.2 OF THE
MASTER AGREEMENT]

     3.02 ROYALTIES TO PDL. Subject to reduction for any offset as provided in
Section 3.05, or withholding under Section 3.09(b), and in further consideration
of the rights and licenses granted under Article 2, TANOX shall pay to PDL a
royalty of * of the Net Sales of all Licensed Products sold by TANOX or its
Affiliates or sublicensees in each country until the last date on which there is
a Valid Claim that, but for a license granted to TANOX under this Agreement,
would be infringed by the making, using, having made or sale of that Licensed
Product in such country or by the manufacture of Licensed Product in the country
of manufacture.

     3.03 SALES AMONG AFFILIATES. Sales between and among TANOX and its
Affiliates or sublicensees of Licensed Products which are subsequently resold or
to be resold by such Affiliates or sublicensees shall not be subject to royalty,
but in such cases royalties shall accrue and be calculated on the sale of such
Licensed Products to a third party.

     3.04 COMBINATION PRODUCTS. Net Sales in a particular country, in the case
of the Combination Products for which the pharmaceutically active agent or
ingredient constituting a Licensed Product and each of the other
pharmaceutically active agents or ingredients not constituting Licensed Products
have established market prices in that country in the Territory when sold
separately, shall be determined by multiplying the Net Sales for each such
Combination Product by a fraction, the numerator of which shall be the
established market price for the Licensed Product(s) contained in the
Combination Product and the denominator of which shall be the sum of the
established market prices for the Licensed Product(s) plus the established
market prices for the other pharmaceutically active agents or ingredients
contained in the Combination Product. When such separate market prices are not
established in that country, then the parties shall negotiate in good faith to
determine a fair and equitable method of calculating Net Sales in that country
for the Combination Product in question.

     3.05 ANNUAL MAINTENANCE FEE. In further consideration of the licenses
granted under Article 2, following the second (2nd) anniversary of the Effective
Date and not later than each anniversary thereafter within thirty (30) days
after receipt of an invoice from PDL, TANOX shall pay PDL a nonrefundable annual
maintenance fee in the amount of *. An amount of fifty percent (50%) of the
annual maintenance fee paid by TANOX hereunder shall be creditable against
royalties payable to PDL pursuant to Section 3.02 beginning in the year in which
a Biologist License Application ("BLA") or foreign equivalent thereof is filed
with the U.S. Food and Drug Administration (or any successor thereto, or a
foreign counterpart agency), with respect to a Licensed Product; provided that
in no event shall any portion of the annual maintenance fees paid prior to the
year in which a BLA is filed with respect to the Licensed Product be creditable
against royalties hereunder.

     3.06 CURRENCY CONVERSION. All amounts payable to PDL under this Agreement
shall be payable in U.S. Dollars by wire transfer to a bank account designated
by PDL. In the case of royalties on Net Sales, all amounts payable shall first
be calculated in the currency of sale and then converted into U.S. Dollars using
the average of the daily exchange rates for such currency quoted by Citibank,
N.A. for each of the last fifteen (15) banking days of each calendar quarter.

     3.7  ROYALTY REPORTS.

     (A)  CURRENT REPORTS.  TANOX agrees to make written reports and royalty
payments to PDL within sixty (60) days after the close of each calendar quarter
during the terms of this Agreement,

                                        3
<PAGE>
beginning with the calendar quarter in which the date of first sale of Licensed
Product by TANOX, its Affiliates or sublicensees, following regulatory approval
occurs. These reports shall show for the calendar quarter in question Net Sales
by TANOX, its Affiliates and sublicensees of the Licensed Products in the
Territory on a country-by-country basis, details of the quantities of Licensed
Products sold in each country and the country of manufacture, if different,
applicable offsets, withholding taxes and the net royalty due to PDL thereon
pursuant to Article 3. No later than at the time of the making of each such
report, TANOX shall make any payment due to PDL of royalties for the period
covered by such report.

     (B) TERMINATION REPORT. For each Licensed Product, TANOX also agrees to
make a written report to PDL within ninety (90) days after the date on which
TANOX, its Affiliates or sublicensees last sell that Licensed Product stating in
such report the same information required by quarterly reports for all such
Licensed Products made, sold or otherwise disposed of which were not previously
reported to PDL.

     3.08 INSPECTION. TANOX agrees to keep clear, accurate and complete records
for a period of at least three (3) years after each reporting period in which
Net Sales occur showing the manufacturing, sales and other disposition of
Licensed Products in the Territory in sufficient detail to enable the royalties
payable hereunder to be determined. TANOX further agrees to permit its books and
records to be examined by an independent accounting firm selected by PDL and
reasonably satisfactory to TANOX from time-to-time but not more than once a
year. Such examination is to be made at the expense of PDL, except in the event
that the results of the audit reveal that TANOX underpaid PDL by * or more, then
the audit fees shall be paid by TANOX. Any such discrepancies will be promptly
corrected by a payment or refund, as appropriate.

     3.09  WITHHOLDING.

     (A) PAYMENTS. All amounts payable under Section 3.01 and 3.05 shall
represent the actual proceeds to be received by PDL, net of any withholding or
other taxes or levies that may be applicable to such payments. PDL agrees to
reasonably cooperate with TANOX in obtaining a refund of any withholding taxes
or levies paid by TANOX if any, with respect to any payments to PDL hereunder.
In the event that PDL is successful in obtaining any refund of tax withholding
amounts paid by TANOX under this Agreement, PDL agrees to promptly remit such
refund amount to TANOX.

     (B) ROYALTY PAYMENTS. TANOX may withhold from royalties due to PDL amounts
for payment of any withholding tax that TANOX has actually paid to any taxing
authority with respect to the royalty payments due to PDL hereunder, provided
that such amounts are properly documented and specific in any summary report to
PDL hereunder. TANOX agrees to reasonably cooperate with PDL in obtaining a
foreign tax credit in the U.S. with respect to royalties due to PDL on the sale
or manufacture of Licensed Products at the sole expense of PDL.

4.  PATENT PROSECUTION AND MAINTENANCE.

     4.01  PROSECUTION.  PDL hereby agrees that, at its own expense it will use
commercially reasonable efforts to:

     (a) prosecute any patent applications included in the PDL Patent Rights and
     to secure the most extensive protection reasonably obtainable under the PDL
     Patent Rights; and

     (b) maintain the claims in patents included in the PDL Patent Rights as
     valid and enforceable claims for the full term thereof.

     4.02 UPDATES. Upon the written request of TANOX (which request shall not be
made more than once per calendar year), PDL agrees to provide a written update
of the information relating to the PDL Patent Rights as set forth on EXHIBIT A.

                                        4
<PAGE>
     4.03 DEFENSE OF PDL PATENT RIGHTS. With respect to the PDL Patent Rights
licensed under this Agreement, PDL at its sole cost and expense agrees to take
all steps and proceedings and to undertake such other acts as PDL may, in its
sole discretion, deem necessary or advisable to restrain any infringement or
improper or unlawful use of the PDL Patent Rights and to recover any actual or
punitive compensation therefor. TANOX shall provide reasonable assistance to PDL
and permit PDL to have the sole right to take such steps, conduct any such
proceedings or undertake any such action to restrain any infringement or
improper or unlawful use of the PDL Patent Rights, whether or not TANOX is a
party to such steps, proceedings or actions, all of which shall be at PDL's
expense. Any monies recovered from alleged infringers shall be retained by PDL.

5.  REPRESENTATIONS AND WARRANTIES; INDEMNIFICATION

     5.01 VALID AGREEMENT. Each party represents and warrants to the other that
it knows of no legal reason to, and is not a party to any agreement which would,
prevent it from entering into and performing its obligations under this
Agreement and that the signatory hereto is duly authorized to execute and
deliver this Agreement.

     5.02 NO WARRANTY OF VALIDITY, NON-INFRINGEMENT. Nothing in this Agreement
shall be construed as (a) a warranty or representation by PDL as to the validity
or scope of any PDL Patent Rights; or (b) a warranty or representation that any
Licensed Product made, used, sold or otherwise disposed of under the license
granted in this Agreement is or will be free from infringement of patents,
copyrights, trademarks, trade secrets or other rights of third parties.

     5.03 NO OTHER WARRANTIES. EXCEPT AS SPECIFICALLY SET FORTH IN ARTICLE 5,
PDL MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND, EITHER EXPRESS OR
IMPLIED, WITH RESPECT TO ANY CELL LINES, ANTIBODIES OR LICENSED PRODUCTS
DEVELOPED BY TANOX UNDER THE LICENSE SET FORTH IN THIS AGREEMENT AND PDL FURTHER
MAKES NO EXPRESS OR IMPLIED WARRANTIES OF MERCHANTABILITY OR FITNESS FOR A
PARTICULAR PURPOSE, OR THAT THE USE OF ANY CELL LINES, ANTIBODIES, LICENSED
PRODUCTS OR OTHER MATERIALS DEVELOPED BY TANOX UNDER THE LICENSE SET FORTH IN
THIS AGREEMENT WILL NOT INFRINGE ANY THIRD PARTY RIGHTS.

     5.04 INDEMNIFICATION. TANOX shall at all times, during the term of this
Agreement and thereafter, indemnify and hold harmless PDL and its Affiliates,
sublicensees, directors, officers, agents and employees from any claim,
proceeding, loss, expense, and liability of any kind whatsoever (including but
not limited to those resulting from death, personal injury, illness or property
damage and including legal expenses and reasonable attorneys' fees) arising out
of or resulting from (a) any claim of patent infringement (direct or
contributory) or including patent infringement with respect to the activities of
TANOX and (b) the development, manufacture, holding, use, testing,
advertisement, sale or other disposition by TANOX, its Affiliates or
sublicensees, or any distributor, customer or representative of TANOX or any one
in privity therewith, of any Licensed Product; provided, however, that PDL shall
promptly notify TANOX of such claim, proceeding, loss, expense or liability and
TANOX, at TANOX's cost, shall have sole control over the defense, including
settlement of any claim or action, with full cooperation from PDL.

6. CONFIDENTIALITY. PDL and TANOX acknowledge that in the course of negotiations
of this Agreement or other discussions between the parties of prospective
agreements or business relationships and/or in furtherance of the interests of
the parties hereunder that each has received and/or may receive confidential
information of the other party. To the extent that such information is
"Confidential Information" as defined in Section 6.2 of the Master Agreement,
each party is subject to the obligations of such Section 6.2 with respect to the
Confidential Information.

                                        5
<PAGE>
7.  TERM AND TERMINATION

     7.01 TERM. Unless earlier te